• Volume 26,Issue 1,2026 Table of Contents
    Select All
    Display Type: |
    • >Articles in English
    • Efficacy and safety of inferonasal goniotomy with an MVR blade in open-angle glaucoma

      2026, 26(1):1-6. DOI: 10.3980/j.issn.1672-5123.2026.1.01

      Abstract (239) HTML (0) PDF 969.43 K (390) Comment (0) Favorites

      Abstract:AIM: To investigate the efficacy and safety of 90° inferonasal sectoral goniotomy with an micro-vitreoretinal(MVR)blade in patients with mild-to-moderate primary open-angle glaucoma(POAG)and pseudoexfoliation glaucoma(PEXG).

      METHODS: This retrospective study included data from 60 patients(60 eyes)who underwent stand-alone goniotomy or goniotomy with phacoemulsification between August 2021 and January 2023, and 45 eyes underwent goniotomy combined with phacoemulsification, and 15 eyes underwent goniotomy as a stand-alone procedure. Postoperatively, intraocular pressure(IOP)and the number of medications were collected at 1, 3, 6, and 12 mo. The side effects of surgery were recorded 1 d, 1 wk, and 1, 3, 6, and 12 mo postoperatively. The primary outcomes were a reduction in IOP of at least 20% from baseline and a decrease in the number of antiglaucomatous medications in 1 a postoperatively. The secondary outcome was surgical success, defined as an IOP<18 mmHg with(qualified)or without(complete)antiglaucomatous medication at 1 a postoperatively.

      RESULTS: At the end of 1 a, 78% of patients achieved both a >20% reduction in IOP and a reduction in the number of medications used. Overall success was achieved in 63% of patients. Microhyphaema was the most common complication, none of the patients experienced a complication requiring surgical intervention.

      CONCLUSION: Sectoral inferonasal goniotomy with an MVR blade significantly reduced IOP and the number of medications required in patients with POAG and PEXG, and 1-year follow-up after goniotomy showed that the need for filtering surgery was either eliminated or delayed in a significant number of patients.

    • >Experimental Article
    • Effect of miR-1246 on high glucose-induced retinal microvascular endothelial cells by regulating METTL3-mediated m6A modification

      2026, 26(1):7-15. DOI: 10.3980/j.issn.1672-5123.2026.1.02

      Abstract (161) HTML (0) PDF 3.45 M (377) Comment (0) Favorites

      Abstract:AIM:To explore the effect of miR-1246 on high glucose-induced retinal microvascular endothelial cells(RMECs)injury by regulating methyltransferase like 3(METTL3)mediated sirtuin 1(SIRT1)N6-methyladenosine(m6A)modification.

      METHODS:Dual luciferase assay was used to detect miR-1246 regulation of METTL3 expression; RMECs cells were divided into control group, high glucose(HG)group, high glucose+knocking down control(HG+anti-miR-NC)group, high glucose+knocking down miR-1246 expression(HG+anti-miR-1246)group, high glucose+overexpression control(HG+NC)group, high glucose+overexpression METTL3(HG+METTL3)group, high glucose+overexpression miR-1246+control(HG+miR-1246+NC)group, and high glucose+overexpression miR-1246+METTL3(HG+miR-1246+METTL3)group. After induction of high glucose for 48 h, CCK-8 method was used to detect cell survival; Annexin V-FITC/PI method was used to detect cell apoptosis; Transwell experiment was used to detect cell migration and invasion; ELISA method was used to detect cell oxidative stress and inflammation levels; Colorimetric method was used to detect m6A methylation level in total RNA; MeRIP-qPCR method was used to detect SIRT1 m6A methylation level; Real-time quantitative PCR was used to detect miR-1246, METTL3, SIRT1 mRNA expression in cells; Western blot was used to detect METTL3, SIRT1 and endothelial mesenchymal transition(EndMT)markers protein expression in cells.

      RESULTS: The MiR-1246 regulated METTL3 expression. Compared with the control group, cell survival rate was decreased in the HG group, apoptosis rate was increased, and the number of migrating and invading cells were increased, lactate dehydrogenase(LDH)activity, tumor necrosis factor-α(TNF-α), and interleukin(IL)-6 levels in cell culture supernatant were increased, IL-10 level was decreased, malondialdehyde(MDA)level was increased, superoxide dismutase(SOD)activity was decreased, miR-1246 expression was increased, total RNA m6A level and SIRT1 m6A level were decreased, METTL3, SIRT1, cluster of differentiation 31(CD31)and vascular endothelial cadherin(VE-cadherin)expression were decreased, while Vimentin and Snail1 expression were increased(all P<0.05); compared with the HG+anti-miR-NC group, cell survival rate was increased in the HG+anti-miR-1246 group, apoptosis rate was decreased, and the number of migrating and invading cells were decreased, LDH activity, TNF-α, and IL-6 levels in cell culture supernatant were decreased, IL-10 level was increased, MDA level was decreased, SOD activity was increased, miR-1246 expression was decreased, total RNA m6A level and SIRT1 m6A level were increased, METTL3, SIRT1, CD31 and VE-cadherin expression were increased, while Vimentin and Snail1 expression were decreased(all P<0.05); compared with the HG+NC group, cell survival rate was increased in the HG+METTL3 group, apoptosis rate was decreased, and the number of migrating and invading cells were decreased, LDH activity, TNF-α, and IL-6 levels in cell culture supernatant were decreased, IL-10 level was increased, MDA level was decreased, SOD activity was increased, miR-1246 expression was decreased, total RNA m6A level and SIRT1 m6A level were increased, METTL3, SIRT1, CD31 and VE-cadherin expression were increased, while Vimentin and Snail1 expression were decreased(all P<0.05); compared with the HG+miR-1246+NC group, cell survival rate was increased in the HG+miR-1246+METTL3 group, apoptosis rate was decreased, and the number of migrating and invading cells were decreased, LDH activity, TNF-α, and IL-6 levels in cell culture supernatant were decreased, IL-10 level was increased, MDA level was decreased, SOD activity was increased, miR-1246 expression was decreased, total RNA m6A level and SIRT1 m6A level were increased, METTL3, SIRT1, CD31 and VE-cadherin expression were increased, while Vimentin and Snail1 expression were decreased(all P<0.05).

      CONCLUSION:The miR-1246 promotes high glucose-induced apoptosis, invasion and metastasis, oxidative stress, inflammatory response, and EndMT process in RMECs cells by regulating METTL3 mediated SIRT1 m6A modification.

    • >Experimental study
    • Study on the effect of apoptosis stimulation protein 2 on traumatic proliferative vitreoretinopathy in rabbits

      2026, 26(1):16-20. DOI: 10.3980/j.issn.1672-5123.2026.1.03

      Abstract (141) HTML (0) PDF 1.23 M (321) Comment (0) Favorites

      Abstract:AIM:To investigate the effect of apoptosis stimulation protein 2(ASPP2)on the development of traumatic proliferative vitreoretinopathy(PVR)in a rabbit model.

      METHODS:A total of 30 New Zealand white rabbits were selected, and the right eyes of all rabbits were inflicted with a scleral penetrating wound of approximately 6 mm. Then rabbits were randomly and evenly divided into experimental and control group. The experimental group received an intravitreal injection of 0.1 mL of ARPE-19 cell suspension transfected with lentivirus-ASPP2, while the control group received an intravitreal injection of 0.1 mL of ARPE-19 cell suspension transfected with negative control lentivirus. At 1, 2, 3, and 4 wk after PVR modeling, a handheld tonometer was used to measure the intraocular pressure. Moreover, fundus photography and ocular ultrasound examination were performed to detect the retinal proliferation. At 4 wk after modeling, hematoxylin-eosin staining was used to observe the morphological retinal changes, and Western blot was used to determine the protein expressions of ASPP2 and the epithelial-mesenchymal transition(EMT)marker Vimentin in the rabbit retinas.

      RESULTS:At 1, 2, 3, and 4 wk after modeling, there were no significant changes in intraocular pressure within the experimental and control group of rabbit eyes, either before or after PVR modeling, the success rate of PVR modeling in the experimental group was lower than that in the control group(P<0.05), and the retinal proliferation and structural disorder was less severe in the experimental group. At 4 wk after modeling, the retinal protein expression level of ASPP2 in the experimental group was significantly higher than that in the control group(t=3.193, P=0.033), while the Vimentin protein expression level was significantly lower in the experimental group(t=-3.599, P=0.023).

      CONCLUSION:ASPP2 may be involved in regulating the process of EMT in retinal pigment epithelial cells, thereby delaying the development and progression of traumatic PVR in rabbit eyes.

    • >Clinical Article
    • Differences and correlations in vascular density of the optic disc area and macular thickness among different degrees of adolescent myopia patients

      2026, 26(1):21-28. DOI: 10.3980/j.issn.1672-5123.2026.1.04

      Abstract (182) HTML (0) PDF 1.46 M (356) Comment (0) Favorites

      Abstract:AIM: To explore the impact of myopia severity in adolescents on the vascular density in the optic disc area and macular thickness, as well as their correlationship.

      METHODS: Cross-sectional study. A total of 106 cases(176 eyes)of adolescent myopia patients who chose Shanghai Zhongye Hospital for treatment were selected as the research subjects. They were divided into three groups according to the spherical equivalent(SE): low myopia, moderate myopia and high myopia. The vascular density in the optic disc area, macular thickness and microperimetry-related indicators of the three groups were compared. The correlation of the vascular density in the optic disc area with macular thickness was analyzed, as well as the mediating role of the two in SE with the average macular light sensitivity(MLS)of the retina.

      RESULTS: The baseline characteristics of the three groups of patients were comparable. With the increase of myopia degree, SE, the vessel density in all directions and the average vascular density of the optic disc area, the thickness of all regions of the macular area except the fovea, and the related indicators of microperimetry all decreased significantly, while the axial length and the thickness of the macular fovea increased significantly(all P<0.05). The generalized additive model showed that the vascular density in all directions and the average vascular density of the optic disc area, and the thickness of all regions of the macular area except the fovea had a negative impact on the degree of myopia, while the thickness of the macular fovea had a positive impact(all P<0.05). Pearson correlation analysis indicated that the vascular density of the optic disc area negatively correlated with the thickness of the macular fovea, and positively correlated with the thickness of other regions of the macula(all P<0.05). The mediation effect analysis showed that the thickness of all regions of the macula and the vascular density of some areas of the optic disc area had a significant mediating regulatory effect between SE and the overall MLS(all P<0.001).

      CONCLUSION: With the increase of myopia degree, the vascular density in the optic disc area and the thickness of all regions of the macula except the fovea decrease, while the thickness of the macular fovea increases; the vascular density in the optic disc area negatively correlated with the thickness of the macular fovea, and positively correlated with the thickness of other regions; the thickness of the macula and the vascular density in the optic disc area play a significant mediating role between SE and MLS.

    • Visual function training combined with surgical intervention for the treatment of intermittent exotropia

      2026, 26(1):29-34. DOI: 10.3980/j.issn.1672-5123.2026.1.05

      Abstract (349) HTML (0) PDF 511.92 K (333) Comment (0) Favorites

      Abstract:AIM: To observe clinical outcomes of visual function training combined with surgical intervention in children with intermittent exotropia.

      METHODS: Retrospective study. A total of 100 pediatric patients with intermittent exotropia admitted to the Children's Hospital of Soochow University from January 2022 to December 2024 were selected and divided into two groups based on treatment modality. Both groups underwent intermittent exotropia correction surgery. The control group did not follow a visual rehabilitation program postoperatively, while the visual rehabilitation group did. The differences were compared between the two groups in preoperative and postoperative 12 wk results of perceptual eye position examinations, visual perception stereopsis function tests, multifocal visual evoked potential outcomes, Chinese version of the Child-International Quality of Life for Children with Strabismus(Child-IXTQ)scores, and strabismus angle.

      RESULTS: The baseline data of the two groups were comparable. Both groups showed reduced horizontal and vertical perceptual eye position deviation at 12 wk postoperatively compared to preoperative levels, with the visual group exhibiting lower values than the control group(all P<0.01). At 12 wk postoperatively, the number of children in the visual group who recovered fine and dynamic stereopsis increased compared to preoperative levels, and this number was higher than that in the control group(all P<0.05). There was no significant difference between the two groups in the number of children who recovered coarse stereopsis preoperatively and 12 wk postoperatively(all P>0.05). Both groups showed reduced latency for the first and second rings at 12 wk postoperatively compared to pre-surgery, with the visual group exhibiting lower latency than the control group(all P<0.01). There was no significant difference in latency for the third and fourth rings between pre-surgery and 12 wk postoperatively in either group(all P>0.05). Both groups showed increased Child-IXTQ scores at 12 wk postoperatively compared to preoperatively, with the visual group scoring higher than the control group(all P<0.05). Both groups exhibited reduced strabismus angles at 33 cm and 6 m at 12 wk postoperatively compared to preoperatively(all P<0.01), but the visual group showed no difference compared to the baseline group(all P>0.05).

      CONCLUSION: Combining visual function training with surgical intervention for intermittent exotropia can improve multifocal visual evoked potentials, promote visual function recovery, and enhance quality of life.

    • >Review Aritcle
    • Advances in the mechanisms of endothelial-to-mesenchymal transition in corneal endothelial cell

      2026, 26(1):35-38. DOI: 10.3980/j.issn.1672-5123.2026.1.06

      Abstract (223) HTML (0) PDF 448.63 K (325) Comment (0) Favorites

      Abstract:Corneal endothelial cells(CECs), which form the innermost cellular layer of the cornea, play a pivotal role in sustaining corneal transparency and preserving visual acuity. However, CECs are vulnerable to damage induced by a spectrum of pathological conditions or traumatic injuries. Once the density of CECs declines below a critical threshold, corneal endothelial dysfunction is precipitated, ultimately leading to corneal edema and progressive visual impairment. Penetrating keratoplasty and corneal endothelial transplantation remain the first-line therapeutic strategies for managing advanced corneal endothelial dysfunction. Nevertheless, the global shortage of donor corneas severely limits the accessibility and scalability of these surgical interventions. Consequently, regenerative medicine approaches targeting corneal endothelial repair and regeneration have emerged as a major focus of international research in ophthalmology. A key challenge in the in vitro expansion of CECs is their propensity to undergo endothelial-to-mesenchymal transition(EndMT). EndMT is a process of cellular phenotypic transformation, through which endothelial cells lose their intrinsic functions and acquire the characteristic features of mesenchymal cells. The EndMT significantly impedes the clinical translation of in vitro-cultured CECs for regenerative applications. In this review, the risk factors and related signaling pathways involved in EndMT were summarized, aiming to provide references for the basic research and clinical treatment of relevant diseases.

    • New advances in etiological diagnosis, prevention, and treatment of infectious keratopathy

      2026, 26(1):39-44. DOI: 10.3980/j.issn.1672-5123.2026.1.07

      Abstract (237) HTML (0) PDF 559.61 K (329) Comment (0) Favorites

      Abstract:Infectious keratitis(IK)is a major blinding eye disease worldwide. Early diagnosis and treatment are crucial for improving prognosis and reducing the economic burden. This article reviews advances in the diagnosis and treatment of IK, aiming to provide new insights for clinical management. In terms of diagnosis, in addition to conventional methods such as microbial culture and confocal microscopy, molecular diagnostic technologies—including high-throughput sequencing(NGS), CRISPR, and nanotechnology-based systems—have significantly enhanced the sensitivity and specificity of multiplex pathogen detection. These approaches are particularly valuable for identifying mixed infections and rare pathogens. Regarding treatment, in response to the growing challenge of drug resistance, novel drug delivery systems employing nanotechnology and bioactive dressings have markedly improved antibacterial efficacy by enhancing drug penetration and retention. Immunomodulatory therapy and photodynamic therapy effectively control inflammatory responses and improve outcomes. Integrated traditional Chinese and Western medicine, as well as microbiome-based therapies, have demonstrated significant advantages in reducing recurrence rates. Stem cell therapy offers new hope for repairing severe corneal damage, while gene therapy—through gene editing or transduction—strengthens the innate defense mechanisms of the cornea and reduces treatment-related side effects.

    • Research progress on the mechanisms of oxidative stress in retinopathy of prematurity

      2026, 26(1):45-49. DOI: 10.3980/j.issn.1672-5123.2026.1.08

      Abstract (168) HTML (0) PDF 897.77 K (297) Comment (0) Favorites

      Abstract:Retinopathy of prematurity(ROP)is a leading cause of childhood blindness, with extremely preterm and very-low-birth-weight infants now constituting the main high-risk group. ROP progresses in two stages: early retinal microvascular degeneration and progressive vascular arrest, followed by abnormal neovascularization in the avascular area. Early oxidative and nitrosative stress—amplified by oxygen fluctuations and immature antioxidant defenses—drives the two-phase pathogenesis via hypoxia-inducible factor/vascular endothelial growth factor(HIF/VEGF), NOX/STAT3, and nuclear factor erythroid 2 related factor 2(Nrf2)-antioxidant response element(ARE)pathways, mediating apoptosis of endothelial cells, damage to barrier and pathological angiogenesis. This review systematically analyzes different oxygen-induced retinopathy(OIR)models, elucidates key signaling pathways including Notch, Wnt in physiological and pathological vascularization, with particular emphasis on the biphasic effects of Nrf2 and the differential roles of NOX signaling between phases. We also discuss the limitations of anti-VEGF therapy and oxygen management principles. Reactive oxygen species(ROS)play context-dependent roles across vaso-obliteration and neovascularization phases. Based on mechanistic insights, we propose future directions including combined/sequential interventions, ferroptosis and lipid peroxidation targeting, nano-delivery systems for enhanced bioavailability, and perinatal safety assessment strategies, aiming to provide translatable mechanistic basis for reducing pathological neovascularization while promoting physiological vascular development.

    • Analysis of the interaction between circadian rhythm and other influencing factors in age-related macular degeneration

      2026, 26(1):50-55. DOI: 10.3980/j.issn.1672-5123.2026.1.09

      Abstract (186) HTML (0) PDF 899.84 K (311) Comment (0) Favorites

      Abstract:Circadian rhythm(CR)is an intrinsic biological clock mechanism within organisms that regulates physiological and biochemical processes, enabling synchronization with periodic fluctuations in the external environment. This rhythmicity not only influences the sleep-wake cycle but also encompasses various physiological functions, including metabolism, hormone secretion, cell proliferation, and immune responses. Age-related macular degeneration(ARMD), a prevalent retinal disease, has been significantly associated with disruptions in CR. ARMD is among the leading causes of vision loss in the elderly, with a complex pathogenesis involving multiple factors such as genetics, environmental influences, and lifestyle choices. This article will focus on the molecular mechanisms linking CR and ARMD, analyzing how disruptions in CR affect the physiological state and metabolic processes of retinal cells, ultimately contributing to the onset and progression of ARMD. Additionally, this article will elucidate the interactions effects of CR on ARMD in relation to oxidative stress, regulation of Aβ, inflammatory pathways, and mitochondrial homeostasis. By deepening our understanding of the relationship between CR and ARMD, we aim to provide new insights and directions for future clinical interventions and treatments.

    • Current strategies and future directions in the treatment of age-related macular degeneration

      2026, 26(1):56-62. DOI: 10.3980/j.issn.1672-5123.2026.1.10

      Abstract (271) HTML (0) PDF 1.95 M (337) Comment (0) Favorites

      Abstract:Age-related macular degeneration(ARMD)is a progressive visual impairment fundus disease that frequently occurs in individuals aged >55 years. The main risk factors are aging, long-term smoking, genetics, and racial differences. Pathogenesis includes abnormal function of the retinal pigment epithelium, damaged blood-retinal barrier, and abnormal immune function. Currently, intravitreal injection(IVI)of anti-vascular endothelial growth factor(VEGF)drugs is the preferred treatment option for ARMD in clinical practice. However, it also faces challenges such as repeated treatments, high medical costs, and poor patient compliance. The predicament in the treatment of ARMD has given rise to several new treatment options. This article aims to review the treatment methods and progress of dry ARMD and wet ARMD, providing new ideas for addressing the limitations of the current clinical anti-VEGF treatment.

    • Research progress on imaging examinations of macular hole

      2026, 26(1):63-66. DOI: 10.3980/j.issn.1672-5123.2026.1.11

      Abstract (242) HTML (0) PDF 473.75 K (338) Comment (0) Favorites

      Abstract:Macular hole is an age-related disorder defined by a full-thickness defect of the foveal retina and a profound loss of central vision. First described in the mid-19th century, its study has now extended across more than 150 years. Breakthroughs in science and technology—especially the relentless refinement of retinal imaging platforms—have progressively refined our understanding of the disease. Optical coherence tomography(OCT)in particular has revolutionized characterization of the condition. At the same time, the widespread adoption of macular hole surgery has not only driven deeper investigations into pathogenesis and pre-operative assessment but also facilitated the global dissemination of surgical expertise and a marked rise in anatomical success. This review synthesizes the multimodal imaging hallmarks of macular holes and highlights the remaining clinical challenges in the application of OCT technology.

    • Research progress on the diagnosis of dry eye in children

      2026, 26(1):67-73. DOI: 10.3980/j.issn.1672-5123.2026.1.12

      Abstract (217) HTML (0) PDF 562.32 K (357) Comment (0) Favorites

      Abstract:The prevalence of dry eye among children has been progressively increasing each year; however, clinical diagnosis remains challenging due to the unique physiological attributes of the pediatric tear film functional unit, as well as symptoms that are often atypical and clinical signs that differ from those seen in adults. In healthy children, tear secretion is generally greater, the meibomian gland structure is typically more intact, and the meibum composition and physicochemical properties are more favorable for the maintenance of tear film stability. Compared to adults, the etiology of pediatric dry eye is more frequently associated with meibomian gland dysfunction, allergic ocular conditions, orthokeratology lens wear, environmental influences, such as growing screen time, and systemic disorders. Affected children frequently exhibit non-specific symptoms such as excessive blinking or rubbing of the eyes, which may be overlooked due to their limited ability to verbalize discomfort. Clinical signs can include conjunctival hyperemia, decreased tear meniscus height, and corneal epithelial punctate lesions, though these tend to be milder or less distinct compared with adults. Diagnostic requires the use of age-appropriate tear metrics, such as the Schirmer test and tear film breakup time, alongside ocular surface evaluation, with particular attention to features specific to children that distinguish it from dry eye in adults. Going forward, it is essential to establish and validate pediatric-specific diagnostic criteria to improve ocular surface health and maximize visual quality in this vulnerable population.

    • Research progress on the correlation of dry eye with depression

      2026, 26(1):74-79. DOI: 10.3980/j.issn.1672-5123.2026.1.13

      Abstract (215) HTML (0) PDF 699.07 K (299) Comment (0) Favorites

      Abstract:Dry eye disease is a chronic ocular surface disorder of multifactorial origin, characterized by a loss of tear film homeostasis and associated with a range of ocular discomfort symptoms. Growing evidence underscores a significant bidirectional relationship between dry eye and depression: individuals with dry eye disease exhibit a higher prevalence of depressive disorders, and conversely, those diagnosed with depression demonstrate an increased susceptibility to developing dry eye. This interplay is mediated through several pathophysiological pathways, such as chronic inflammation, cerebral functional alterations, gut microbiome dysregulation, and sleep disturbances, which may collectively sustain a vicious cycle. The use of antidepressant therapy introduces further complexity, exerting heterogeneous effects on dry eye—some agents may offer symptomatic relief, whereas others can aggravate ocular surface impairment. The mechanisms responsible for these differential outcomes remain incompletely elucidated and merit further investigation. This review systematically consolidates epidemiological data on the dry eye-depression link, examines potential shared pathological mechanisms, and evaluates current therapeutic options. We propose an integrated management approach that combines conventional dry eye treatments, such as traditional Chinese medicine, electroacupuncture, physical activity and antidepressants—a multimodal strategy that may yield synergistic benefits in alleviating both ocular and affective symptoms, thereby improving overall quality of life. Moving forward, research should focus on deciphering the underlying mechanistic pathways and facilitating the translation of these insights into clinical practice to inform targeted, combined treatment regimens for patients with dry eye and depression.

    • Advances in the correlation of dyslipidemia with meibomian gland dysfunction and dry eye

      2026, 26(1):80-85. DOI: 10.3980/j.issn.1672-5123.2026.1.14

      Abstract (180) HTML (0) PDF 494.80 K (319) Comment (0) Favorites

      Abstract:Meibomian gland dysfunction(MGD)and dry eye disease(DED)are prevalent ocular surface disorders, with MGD being a primary cause of DED. Although multiple observational studies, systematic reviews, and Meta-analysis have found that dyslipidemia may be associated with the rising risk of DED and MGD, the mechanisms remain unclear, and these findings have been not yet fully incorporated into Chinese expert consensus on dry eye and MGD. The article begins by comparing the similarities and differences between meibum and blood lipids in terms of composition, and their age-related trends, noting that changes in meibum composition are more likely a result of MGD rather than alterations in blood lipids. Then we systematically review epidemiological evidence revealing the association between dyslipidemia and MGD/DED, delving into the underlying pathophysiological mechanisms. Finally, we evaluate the treatment prospects as well as controversies of lipid-lowering agents on their dual mechanisms of lipid-lowering and anti-inflammatory effects. This review aims to systemically integrate current research findings, elucidate gaps and contradictions, and provide a theoretical foundation for future exploration of blood lipids' role in ocular surface homeostasis, thereby advancing systemic prevention and treatment strategies for DED and MGD.

    • Research progress of visual quality after implantable collamer lens V4c implantation

      2026, 26(1):86-90. DOI: 10.3980/j.issn.1672-5123.2026.1.15

      Abstract (244) HTML (0) PDF 495.40 K (291) Comment (0) Favorites

      Abstract:Compared to other refractive surgeries, the implantable collamer lens(ICL)implantation procedure has become one of the most popular surgical options in refractive surgery. ICL surgery offers advantages such as reversibility, high-definition visual outcomes, and preservation of the corneal anatomical structure. The V4c model, which features a central port, is currently the most widely used in clinical practice and eliminates the need for peripheral iridotomy during the perioperative period. Although excellent uncorrected visual acuity can be achieved postoperatively, some patients may experience visual disturbances in the early postoperative period, such as halo and glare, which may affect visual comfort particularly under low-light conditions. This article reviews visual quality metrics after ICL V4c implantation, including higher-order aberrations(HOA), modulation transfer function(MTF), and contrast sensitivity(CS), along with influencing factors, and discusses potential relative deficits in postoperative visual quality and their underlying mechanisms.

    • Research progress on non-surgical treatment of intermittent exotropia

      2026, 26(1):91-95. DOI: 10.3980/j.issn.1672-5123.2026.1.16

      Abstract (495) HTML (0) PDF 481.72 K (300) Comment (0) Favorites

      Abstract:Intermittent exotropia(IXT)is the most prevalent form of childhood strabismus, with an estimated prevalence of approximately 3.26% in the Chinese population. Although patients can intermittently maintain orthotropia, the deviation angle often fluctuates markedly, and frank exotropia may become evident during fatigue or lapses in attention. Without intervention, roughly 75% of cases progress over time. Management comprises surgical and non-surgical approaches. Surgery remains the most definitive treatment, however, the optimal timing is controversial, and postoperative outcomes may include under- or over-correction, necessitating additional procedures. Non-surgical options include observation, refractive correction, over-minus lens therapy, prisms, orthoptic exercises, and botulinum toxin-A injections. These modalities are particularly suitable for young, or uncooperative children, patients with small-angle, well-controlled deviations, or those seeking to defer surgery, in such cases, non-surgical treatment can maintain binocular alignment and preserve monocular function, thereby delaying or avoiding surgery. Because the efficacy of each non-surgical strategy varies, this review summarizes the current evidence on non-surgical treatment of IXT.

    • >Clinical research
    • Risk factors for postoperative anterior chamber exudation in age-related cataract patients and construction of a nomogram prediction model

      2026, 26(1):96-102. DOI: 10.3980/j.issn.1672-5123.2026.1.17

      Abstract (197) HTML (0) PDF 1.13 M (294) Comment (0) Favorites

      Abstract:AIM: To explore the risk factors for postoperative anterior chamber exudation in cataract patients and construct a nomogram prediction model.

      METHODS: Retrospective study. From July 2019 to October 2024, 450 patients(467 eyes)with age-related cataract who underwent surgery in our hospital were collected as the study subjects. They were randomly grouped into a modeling group(315 cases, 327 eyes)and a validation group(135 cases, 140 eyes)roughly estimated at a 7:3 ratio using the random number table method. Both groups were separated into a non-exudative group and an exudative group based on whether anterior chamber exudation occurred after surgery. Clinical basic data was collected; multivariate Logistic regression was applied to analyze the influencing factors of anterior chamber exudation in patients with age-related cataract after surgery; R software was applied to draw a nomogram prediction model of anterior chamber exudation in patients with age-related cataract after surgery; the calibration curve and Hosmer Lemeshow(H-L)test were applied to evaluate the calibration of the column plot model in predicting the occurrence of anterior chamber exudation in patients with age-related cataract after surgery; ROC was applied to evaluate the efficacy of anterior chamber exudation in patients with age-related cataract after surgery.

      RESULTS:The clinical characteristics of the modeling group and the validation group were comparable. The high myopia, history of uveitis, preoperative intraocular pressure, lens nuclear grade, intraoperative cumulative dissipated energy, and intraoperative posterior capsular rupture of the lens were the influencing factors for postoperative anterior chamber exudation in patients with age-related cataract(all P<0.05). The results of the modeling group verifying the occurrence of anterior chamber exudation in patients with age-related cataract after surgery showed that the area under the ROC curve(AUC)was 0.986(95% CI: 0.966-0.996), the H-L test was χ2=6.494, P=0.592, indicating that the risk of anterior chamber exudation in patients with age-related cataract after surgery predicted by model had good consistency with actual risks, the AUC of postoperative anterior chamber exudation in patients with age-related cataract based on external validation was 0.982(95% CI: 0.960-0.994); and the H-L test suggested that the risk of anterior chamber exudation in CAT patients after surgery predicted by model had good consistency with actual risks(χ2=6.117, P=0.634).

      CONCLUSION:High myopia, history of uveitis, preoperative intraocular pressure, lens nuclear grade, intraoperative cumulative dissipated energy, and intraoperative posterior capsular rupture of the lens are risk factors for postoperative anterior chamber exudation in patients with age-related cataract; the nomogram prediction model constructed based on this has high predictive value, and can provide reference for individualized prevention of anterior chamber exudation in patients with age-related cataract after surgery.

    • Serum nitric oxide synthase 4 and matrix metalloproteinase-2 expression in patients with diabetic neovascular glaucoma and their clinical significance

      2026, 26(1):103-108. DOI: 10.3980/j.issn.1672-5123.2026.1.18

      Abstract (138) HTML (0) PDF 805.05 K (304) Comment (0) Favorites

      Abstract:AIM: To investigate and analyze serum nitric oxide synthase 4(NOX4)and matrix metalloproteinase(MMP)-2 expressions in patients with diabetes mellitus(DM)complicated with neovascular glaucoma(NVG)and their clinical significance.

      METHODS: A prospective study was conducted on 161 patients with DM complicated with NVG admitted to Handan City Eye Hospital(The Third Hospital of Handan)from June 2020 to June 2023. Based on whether complications occurred 1 a after trabeculectomy in the study group patients, they were divided into a group with good prognosis(n=90)and a group with poor prognosis(n=71). During the same period, 161 patients with chronic angle-closure glaucoma without iris neovascularization were selected as the control group. ELISA method was applied to detect the expression levels of serum NOX4 and MMP-2. ROC curve was plotted to evaluate the diagnostic value and postoperative complication prediction value of NOX4 and MMP-2 in patients with DM complicated with NVG. Pearson method was applied to analyze the correlation of NOX4 and MMP-2 with vascular endothelial growth factor(VEGF)and interleukin-6(IL-6). Multivariate Logistic regression was applied to analyze the influencing factors of postoperative complications in the study group.

      RESULTS:The general information of the study group and control group of patients is comparable. Compared with the control group, the expression levels of serum NOX4, MMP-2, VEGF, and IL-6 in the study group were significantly increased(P<0.001). According to Pearson analysis, serum NOX4 and MMP-2 levels significantly positively correlated with VEGF and IL-6 levels, respectively(P<0.001). According to ROC curve, the AUC of NOX4 combined with MMP-2 in the diagnosis of DM complicated with NVG was better than that of individual diagnosis of NOX4(Z=3.341, P<0.05)and MMP-2(Z=2.788, P<0.05). The duration of DM, the proportion of people with intraocular pressure >21 mmHg, and the expression levels of NOX4, MMP-2, VEGF, and IL-6 in the poor prognosis group were all higher than those in the good prognosis group(P<0.001). The duration of DM, intraocular pressure >21 mmHg, the levels of NOX4, MMP-2, VEGF, and IL-6 were all risk factors for poor prognosis in DM patients with NVG(P<0.001). According to ROC curve, the combined prediction of NOX4 and MMP-2 for postoperative complications in patients with DM complicated by NVG was superior to the AUC predicted by NOX4(Z=3.727, P<0.05)and MMP-2(Z=2.219, P<0.05), respectively.

      CONCLUSION:NOX4 and MMP-2 are upregulated in the serum of patients with DM complicated by NVG. Combined detection of these two markers holds significant clinical value for the early diagnosis and prognosis of patients with DM complicated by NVG.

    • Correlation of serum levels of leukocyte-derived chemotaxin 2 and complement C1q/tumor necrosis factor-related protein 5 with diabetic retinopathy

      2026, 26(1):109-113. DOI: 10.3980/j.issn.1672-5123.2026.1.19

      Abstract (141) HTML (0) PDF 857.47 K (296) Comment (0) Favorites

      Abstract:AIM: To investigate the correlation of serum leukocyte-derived chemotaxin 2(LECT2)and complement C1q/tumor necrosis factor-related protein 5(CTRP5)with diabetic retinopathy(DR).

      METHODS:A single-center cross-sectional analysis was conducted on 138 patients with type 2 diabetes mellitus(T2DM)admitted to our hospital from April 2023 to April 2025. According to the diagnostic results, they were divided into a non-DR group(60 cases)and a DR group(78 cases). The DR group was further divided into a proliferative DR(PDR)group(29 cases)and a non-proliferative DR(NPDR)group(49 cases). Pearson correlation analysis was used to assess the correlation of LECT2 and CTRP5 with glucose-lipid metabolism indicators. Logistic regression analysis was conducted to identify the influencing factors for the occurrence of DR in T2DM patients. ROC curve analysis was performed to evaluate the diagnostic value of serum LECT2 and CTRP5 for DR in T2DM patients.

      RESULTS: A comparison of general patient data between the two groups showed no significant differences. The DR group had higher serum levels of LECT2, CTRP5, total cholesterol(TC), triglycerides(TG), low-density lipoprotein cholesterol(LDL-C), and homeostatic model assessment of insulin resistance(HOMA-IR)than the non-DR group, while high-density lipoprotein cholesterol(HDL-C)was lower(all P<0.05). The serum levels of LECT2 and CTRP5 in the PDR group were higher than those in the NPDR group(all P<0.05). Serum LECT2 and CTRP5 positively correlated with TC, TG, LDL-C, and HOMA-IR, and negatively correlated with HDL-C(all P<0.001). Logistic results showed that duration of diabetes, TC, TG, LDL-C, HOMA-IR, LECT2, and CTRP5 were risk factors for DR occurrence in T2DM patients(all P<0.05). The ROC curve showed that the AUCs for serum LECT2, CTRP5 alone, and combined in diagnosing DR in T2DM patients were 0.830, 0.839, and 0.915, respectively. The AUC for the combined diagnosis was higher than that of LECT2 or CTRP5 alone according to the DeLong test(Z=2.818, 2.824, P=0.015, 0.012).

      CONCLUSION:Serum LECT2 and CTRP5 levels are closely related to the development of DR in T2DM patients, and joint detection has certain clinical value in diagnosing DR in T2DM patients.

    • Correlation of serum pentraxin 3, fatty acid-binding protein 4 and prolyl hydroxylase 2 levels with the severity of diabetic macular edema

      2026, 26(1):114-118. DOI: 10.3980/j.issn.1672-5123.2026.1.20

      Abstract (141) HTML (0) PDF 621.23 K (317) Comment (0) Favorites

      Abstract:AIM: To explore the correlation of the levels of serum pentraxin 3(PTX3), fatty acid-binding protein 4(FABP4), and prolyl hydroxylase 2(PHD2)with the severity of diabetic macular edema(DME).

      METHODS:A total of 157 DME patients admitted to our hospital from March 2022 to March 2025 were selected as the DME group, categorized into mild, moderate, and severe groups based on the severity of their condition. Additionally, 157 patients with simple T2DM during the same period were also selected as the T2DM group. ELISA was used to detect serum levels of PTX3, FABP4, and PHD2; Logistic analysis was conducted to identify factors affecting severe DME; and ROC curves were drawn to analyze the evaluation value of serum PTX3, FABP4, and PHD2 in patients with severe DME.

      RESULTS: There were differences between the T2DM group and the DME group in the duration of diabetes, fasting blood sugar, glycated hemoglobin, and homocysteine levels(all P<0.05). Compared with the T2DM group, the serum levels of PTX3, FABP4, and PHD2 in the DME group were significantly elevated(all P<0.05). In comparison to the mild group, the moderate and severe groups had significantly higher serum levels of PTX3, FABP4, and PHD2(all P<0.05). Compared with the moderate group, the severe group had significantly higher serum levels of PTX3, FABP4, and PHD2(all P<0.05). Logistic analysis showed that PTX3, FABP4, and PHD2 are risk factors affecting severe DME(all P<0.05). The results of the ROC curve indicated that the AUCs for the individual and combined evaluations of serum PTX3, FABP4, and PHD2 in severe DME patients were 0.788, 0.802, 0.814, and 0.957, respectively, with the combined evaluation having a higher AUC than the individual evaluation(Z=2.696, Z=2.711, Z=2.714, all P<0.05).

      CONCLUSION: Serum levels of PTX3, FABP4, and PHD2 are significantly elevated in patients with DME, and the three are associated with the severity of the patients' condition. Combined testing has a certain clinical value in assessing patients with severe DME.

    • Relationship between traumatic infectious endophthalmitis and the levels of serum macrophage inflammatory protein 1α, heat shock protein 70, and soluble triggering receptor expressed on myeloid cells 1

      2026, 26(1):119-124. DOI: 10.3980/j.issn.1672-5123.2026.1.21

      Abstract (134) HTML (0) PDF 768.92 K (288) Comment (0) Favorites

      Abstract:AIM: To investigate the distribution characteristics of pathogens in patients with post-traumatic infectious endophthalmitis(PTIE)and their relationship with serum levels of macrophage inflammatory protein 1α(MIP-1α), heat shock protein 70(HSP70), and soluble triggering receptor expressed on myeloid cells 1(sTREM-1).

      METHODS:A total of 157 patients with PTIE from the Handan City Eye Hospital(The Third Hospital of Handan)from May 2023 to May 2025 were selected as the study group. They were divided into a good prognosis group and a poor prognosis group based on their uncorrected visual acuity at discharge. Meanwhile, 157 patients with ocular trauma but without endophthalmitis during the same period were selected as control group 1, and 157 healthy volunteers who underwent physical examinations during the same period were selected as control group 2. Aqueous humor and vitreous fluid samples were collected from the study group to detect the distribution of pathogens. The levels of serum MIP-1α, HSP70, and sTREM-1 were measured using the enzyme-linked immunosorbent assay. Multivariate Logistic regression analysis was performed to identify risk factors for poor prognosis. The predictive value of serum MIP-1α, HSP70, and sTREM-1 levels for poor prognosis was evaluated using receiver operating characteristic(ROC)and decision curve analysis(DCA).

      RESULTS: The general data of the participants in the three groups was comparable. A total of 173 pathogens were detected in the 157 patients with PTIE, with Gram-positive bacteria being the predominant type. The levels of serum MIP-1α and sTREM-1 in the study group were higher than those in control groups 1 and 2, while the level of HSP70 was lower than those in control groups 1 and 2(all P<0.05). There were no significant differences in the levels of serum MIP-1α, HSP70, and sTREM-1 between control groups 1 and 2(all P>0.05). In the poor prognosis group, the time of wound suture was ≥24 h, the wound location was in zones II/III, the type of trauma was rupture, the proportion of rupture injuries, and the levels of serum C-reactive protein, MIP-1α, and sTREM-1 were higher than those in the good prognosis group, while the level of HSP70 was decreased(all P<0.001). Multivariate Logistic regression analysis showed that the time of wound suture, wound location, type of trauma, C-reactive protein, MIP-1α, HSP70, and sTREM-1 were risk factors for poor visual prognosis in patients with PTIE(all P<0.05). The ROC curve results showed that the combined prediction of serum MIP-1α, HSP70, and sTREM-1 for poor visual prognosis in PTIE patients had an AUC value of 0.965, which was significantly higher than that of individual predictions(ZMIP-1α, ZHSP70, ZsTREM-1=3.628, 4.705, 3.930, all P<0.05). Additionally, the DCA curve showed that the combined prediction had a higher net benefit rate than individual predictions in the high-risk threshold range of 0.03-0.97.

      CONCLUSION:Gram-positive bacteria are the predominant type of pathogenic bacteria in patients with PTIE, with elevated levels of serum MIP-1α and sTREM-1 and decreased levels of HSP70. The combined detection of these three factors has a high predictive efficacy for visual prognosis in patients.

    • Application of deep range imaging-optical coherence tomography combined with IOL Master 500 in measuring choroidal thickness and axial length in pediatric myopic patients

      2026, 26(1):125-128. DOI: 10.3980/j.issn.1672-5123.2026.1.22

      Abstract (164) HTML (0) PDF 438.11 K (294) Comment (0) Favorites

      Abstract:AIM: To investigate the application of deep optical coherence tomography(DRI-OCT)combined with IOL Master 500 in measuring choroidal thickness and axial length(AL)in pediatric myopic patients, and analyze the relationship between choroidal thickness and AL.

      METHODS: Prospective study. A total of 210 pediatric myopia patients(210 eyes)admitted between August 2021 and August 2024 were enrolled. Based on spherical equivalent(SE)measurements, they were categorized into a low myopia group(-3.00 D RESULTS:There were no significant differences in age, gender, or place of residence among the four groups of participants(all P>0.05). Intraocular pressure, SE, AL, and choroidal thickness at different locations all showed significant differences(all P<0.001). Pearson correlation analysis revealed that AL negatively correlated with choroidal thickness(both P<0.001). The results of multiple linear regression analysis indicate that intraocular pressure, SE, and AL are factors influencing choroidal thickness(all P<0.001).

      CONCLUSION:DRI-OCT combined with IOL Master 500 is able to detect choroidal thickness and AL well, in addition, choroidal thickness closely correlated with intraocular pressure, SE and AL levels.

    • Influencing factors of stereoscopic function reconstruction after intermittent exotropia surgery and construction of a nomogram prediction model

      2026, 26(1):129-134. DOI: 10.3980/j.issn.1672-5123.2026.1.23

      Abstract (133) HTML (0) PDF 1.22 M (318) Comment (0) Favorites

      Abstract:AIM: To investigate the influencing factors of stereoscopic function reconstruction after intermittent exotropia(IXT)surgery and the construction of a nomogram prediction model.

      METHODS:A total of 204 patients with IXT(all underwent strabismus correction surgery)admitted to our hospital from September 2021 to October 2023 were randomly divided into modeling group(143 cases)and validation group(61 cases). The patients in the modeling group were further divided into reconstructive group and non-reconstructive group according to whether they had stereoscopic function reconstruction after surgery; the general patient information was collected; Multivariate Logistic regression analysis was performed on the influencing factors of stereoscopic visual function reconstruction after IXT surgery. The nomogram model was constructed using R software. The ROC curve was drawn to evaluate the distinction of the nomogram model. The decision curve analysis(DCA)was used to evaluate the clinical application value of the model.

      RESULTS:Reconstruction occurred in 50.5%(103 cases)of the 204 patients, and reconstruction occurred in 50.3%(72 cases)of the 143 patients in the modeling group. There were differences in age of onset, course of disease and postoperative horizontal strabismus between the reconstructive group and the non-reconstructive group(all P<0.05). Multivariate Logistic regression analysis showed that age of onset and postoperative horizontal strabismus were risk factors for stereoscopic visual function reconstruction after IXT surgery(all P<0.05), and the course of disease was a protective factor(P<0.05). The AUC of the modeling group was 0.892, and the H-L test was χ2=6.654 and P=0.615. The AUC of the validation group was 0.935, and the H-L test was χ2=6.498 and P=0.642. The DCA curve showed that the clinical value of the nomogram model was higher when the probability was 0.09-0.95.

      CONCLUSION: The age of onset, course of disease and postoperative amount of horizontal strabismus are the influencing factors of stereoscopic visual function reconstruction after IXT surgery, and the nomogram model constructed by this can better predict postoperative stereoscopic function reconstruction.

    • >Artificial intelligence and ophthalmology
    • Application progress of artificial intelligence in retinal neovascular diseases

      2026, 26(1):135-141. DOI: 10.3980/j.issn.1672-5123.2026.1.24

      Abstract (220) HTML (0) PDF 525.70 K (313) Comment (0) Favorites

      Abstract:Retinal neovascular diseases represent a critical subset of retinal diseases that severely impair vision and can lead to blindness. In recent years, artificial intelligence(AI)has demonstrated breakthrough applications in the medical field, particularly in ophthalmology, leveraging its robust capabilities in image recognition and data analysis. Machine learning and deep learning, as core AI technologies, enable precise feature extraction from vast volumes of medical imaging data and the construction of predictive models, offering novel approaches for the auxiliary diagnosis and prognosis of retinal neovascular diseases. This review synthesizes the latest advancements in AI applications for neovascular retinal diseases, including diabetic retinopathy, retinal vein occlusion, retinopathy of prematurity, and age-related macular degeneration. It further discusses the limitations and challenges in clinical implementation. Through a comprehensive summary and analysis, this review aims to provide insights for advancing AI-driven diagnosis and treatment strategies, ultimately facilitating early detection and predictive management of these vision-threatening diseases.

    • >Clinical report
    • Related research on pathogenic candidate genes for familial blepharophimosis-ptosis-epicanthus inversus syndrome

      2026, 26(1):142-147. DOI: 10.3980/j.issn.1672-5123.2026.1.25

      Abstract (115) HTML (0) PDF 2.16 M (313) Comment (0) Favorites

      Abstract:AIM: To conduct whole exome sequencing(WES)analysis on three pedigrees with blepharophimosis-ptosis-epicanthus inversus syndrome(BPES)to identify the pathogenic gene loci, uncover novel mutations, and expand the mutation spectrum of the disease-associated genes.

      METHODS:Retrospective study. A total of 3 pedigrees and 30 patients with BPES(with criteria of bilateral blepharophimosis, ptosis, epicanthus inversus and wider inner canthal distance at birth)treated in the Ophthalmology Department of the Second People's Hospital of Yunnan Province were collected from January 2021 to August 2021, including 8 patients and 22 unaffected family members. Peripheral blood samples were collected from patients and related family members, and genomic DNA was extracted for whole exome sequencing. The sequencing results were screened to identify potential pathogenic gene loci, and candidate mutations were validated using Sanger sequencing.

      RESULTS:WES analysis identified pathogenic gene mutations in 3 BPES pedigrees: pedigree 1(6 members, 3 affected individuals, with a history of disease across three generations)harbored a novel heterozygous mutation in the PIEZO2 gene(located 36 bp upstream of exon 11, G>C). Sanger sequencing confirmed that this mutation was present in all affected individuals and absent in normal family members, and it represents the first report of this mutation. Pedigree 2(14 members, 2 affected individuals)and pedigree 3(10 members, 3 affected individuals)carried known heterozygous mutations in the FOXL2 gene, namely the missense mutation c.313A>C(p.N105H)and the in-frame mutation c.672_701dupAGCGGCTGCAGCAGCTGCGGCTGCAGCCGC(p.A225_A234dupAAAAAAAAAA), respectively.

      CONCLUSION:WES successfully identified the pathogenesis of familial congenital BPES in two families, including a known FOXL2 gene mutation and a newly discovered PIEZO2 gene mutation. These findings provide a theoretical basis for genetic counseling and reproductive guidance. Notably, the PIEZO2 gene mutation(located 36 bp upstream of exon 11, G>C)discovered in the pedigree 1 is reported for the first time and plays a critical role in the onset of the disease in this family. Further investigation of this new mutation could not only expand the mutation spectrum of BPES, but also enhance our understanding of its pathogenic mechanisms.

    • Comparison of preoperative ocular biometry between Pentacam AXL and IOL Master 700 in cataract patients

      2026, 26(1):148-151. DOI: 10.3980/j.issn.1672-5123.2026.1.26

      Abstract (182) HTML (0) PDF 1.14 M (289) Comment (0) Favorites

      Abstract:AIM: To compare the preoperative ocular biometry between Pentacam AXL and IOL Master 700 in cataract patients.

      METHODS:Prospective study. A total of 150 patients(150 eyes)with cataracts who were treated in our hospital from May to December 2024 were selected. The IOL Master 700 and Pentacam AXL were preoperatively used to measure axial length(AL), corneal curvature(K1, K2 and Km), anterior chamber depth(ACD), and white-to-white(WTW). The difference and consistency of the results of the two instruments were compared.

      RESULTS: There was no significant difference between the two instruments in the AL, K1, K2, Km, ACD, and WTW(all P>0.05). The Spearman correlation analysis showed that the two instruments positively correlated with the AL, K1, K2, Km, ACD and WTW of the operated eye(all P<0.001). The Bland-Altman analysis showed that for the Pentacam AXL and IOL Master 700, there were 5/150(3.3%), 7/150(4.7%), 4/150(2.7%), 5/150(3.3%), and 0 points outside the 95%LoA for the AL, K1, K2, Km, ACD, and WTW of the examined eyes, respectively, with all of these values less than 5%, indicating good consistency.

      CONCLUSION:The AL, K1, K2, Km, ACD and WTW of Pentacam AXL and IOL Master 700 in cataract patients before cataract phacoemulsification combined with IOL implantation show no significant differences, and have good correlation and consistency. The two instruments can be used interchangeably.

    • Influence of pterygium thickness and area on corneal refractive status

      2026, 26(1):152-156. DOI: 10.3980/j.issn.1672-5123.2026.1.27

      Abstract (140) HTML (0) PDF 832.13 K (297) Comment (0) Favorites

      Abstract:AIM: To investigate the influence of pterygium thickness and area on corneal refractive status.

      METHODS: Prospective longitudinal study. A total of 60 cases(60 eyes)of pterygium patients admitted to our hospital from January 2024 to September 2024 were randomly selected. All patients underwent pterygium excision combined with pedicle conjunctival flap transplantation for treatment. Optical coherence tomography(OCT)was used to measure the preoperative thickness of patient's pterygium, and a digital slit lamp microscope was used to measure the area of pterygium. The corneal refractive status(degree of corneal astigmatism and average curvature)and changes in uncorrected visual acuity of patients before surgery, 1 d, 1, and 3 mo after surgery were compared. The relationship between preoperative thickness and area of pterygium in patients and corneal refractive status indicators at different postoperative time points were analyzed, and Logistic regression was used to analyze the impact of pterygium thickness and area on postoperative visual improvement in patients.

      RESULTS: All patients completed follow-up after surgery for 3 mo. At 3 mo after surgery, visual acuity improved in 21 eyes(35%). The results of bivariate Pearson correlation analysis showed that the thickness and area of pterygium positively correlated with the degree of corneal astigmatism and uncorrected visual acuity before surgery and 1 d, 1, and 3 mo after surgery(all P<0.05), and negatively correlated with the average corneal curvature before surgery and 1 d, 1, and 3 mo after surgery(all P<0.05). Logistic regression analysis showed that the thickness and area of pterygium before surgery, high degree of corneal astigmatism, and low uncorrected visual acuity(large LogMAR value)were all risk factors for poor postoperative visual improvement in patients(OR>1, P<0.05). The large average corneal curvature before surgery was a protective factor for poor postoperative visual improvement in patients(OR<1, P<0.05).

      CONCLUSION: The increase in thickness and area of pterygium can, to some extent, improve corneal astigmatism, reduce the average curvature of the cornea, and affect postoperative visual recovery.

    • Early predictive value of pre-treatment tear inflammatory factor levels in patients with dry eye

      2026, 26(1):157-162. DOI: 10.3980/j.issn.1672-5123.2026.1.28

      Abstract (136) HTML (0) PDF 1.21 M (308) Comment (0) Favorites

      Abstract:AIM: To investigate the application value of pre-treatment tear inflammatory factor levels in predicting therapeutic efficacy for dry eye patients.

      METHODS:Prospective controlled observational study. A total of 120 patients with dry eye(240 eyes)admitted to our hospital from November 2022 to March 2024 were included. Before dry eye treatment, the levels of inflammatory factors, including interlukin-4(IL-4), IL-6, IL-8, IL-10, IL-12, IL-13, IL-15, IL-18, IL-1β, interferon-γ(IFN-γ), tumor necrosis factor-α(TNF-α), granulocyte-colony stimulating factor(G-CSF), granulocyte-macrophage colony-stimulating factor(GM-CSF), monocyte chemoattractant protein-1(MCP-1)in the tear fluid were detected by ELISA. According to the treatment protocol in the Chinese Expert Consensus on the Treatment of Dry Eye(2020), the patients were given treatments, and the related factors affecting the treatment outcomes of dry eye patients were analyzed.

      RESULTS:After continuous treatment for 4 wk, all the patients completed follow-up, and they were divided into the markedly effective group(60 patients, 120 eyes)and the ineffective group(60 patients, 120 eyes)based on their therapeutic effects. The markedly effective group had significantly lower pre-treatment levels of IL-6, IL-10, IL-18, IL-1β, and TNF-α than the poor efficacy group(all P<0.05). IL-6(OR=0.994), IL-18(OR=0.998), IL-1β(OR=0.933), and TNF-α(OR=0.998)were independently associated with treatment efficacy(all P<0.05). The nomogram model yielded a C-index of 0.971(95% CI: 0.950-0.993), with calibration curves closely aligned to the ideal curve. The model demonstrated significant predictive value for early therapeutic efficacy(sensitivity=96.67%, specificity=71.67%, cutoff=208, AUC=0.866, 95% CI=0.794-0.952, P<0.001).

      CONCLUSION:The nomogram model constructed based on the levels of inflammatory factors in dry eye patients before treatment can well predict the treatment effect of patients.

    • Role of trypsin in postoperative recovery after Nd:YAG laser dacryocystoplasty

      2026, 26(1):163-167. DOI: 10.3980/j.issn.1672-5123.2026.1.29

      Abstract (122) HTML (0) PDF 464.77 K (280) Comment (0) Favorites

      Abstract:AIM:To evaluate the efficacy and safety of trypsin irrigation in the treatment of lacrimal duct obstruction after Nd:YAG laser dacryoplasty.

      METHODS:This retrospective cohort study included 160 patients(160 eyes)with lacrimal duct obstruction who underwent Nd:YAG laser dacryocystoplasty at our institution. Based on the postoperative irrigation protocol, patients were allocated into two groups: the experimental group, which received lacrimal irrigation with a 25% trypsin solution once weekly for 4 wk postoperatively, and the control group, which received irrigation with normal saline on the same schedule. Patient data was obtained by reviewing electronic medical records, including baseline characteristics, surgical records, postoperative irrigation protocols, and follow-up outcomes at 1, 2, 4, and 6 mo post-surgery.

      RESULTS:The baseline characteristics were comparable between the two groups. At 1 mo postoperatively, the success rate in the experimental group was 90.0%, significantly higher than 71.3% in the control group(P<0.05). Preoperatively, the tear meniscus height in obstructed eyes was higher than in healthy eyes in all patients(all P<0.01). At 1 mo postoperatively, the tear meniscus height in obstructed eyes decreased significantly compared to preoperative levels(all P<0.01), and was lower in the experimental group than in the control group(P<0.01). The recurrence rates of obstruction at 2, 4, and 6 mo were 1.4%, 6.9%, and 5.6% in the experimental group, compared to 5.3%, 17.5%, and 12.3% in the control group, respectively. The total recurrence rate was significantly lower in the experimental group(13.9%)than in the control group(35.1%; P<0.05). No severe complications occurred in either group. Patient satisfaction with the treatment outcome was significantly higher in the experimental group than in the control group(P<0.01).

      CONCLUSION:Lacrimal irrigation with trypsin following Nd:YAG laser dacryocystoplasty demonstrates superior efficacy and a lower recurrence rate in the treatment of lacrimal duct obstruction. Trypsin shows promising application prospects for improving surgical success rate and reducing recurrence rate after laser treatment for lacrimal duct obstruction.

    • Effect of periocular injection of triamcinolone acetonide combined with Dexamethasone on ocular surface functions in patients with thyroid-associated ophthalmopathy

      2026, 26(1):168-173. DOI: 10.3980/j.issn.1672-5123.2026.1.30

      Abstract (177) HTML (0) PDF 1.42 M (287) Comment (0) Favorites

      Abstract:AIM:To evaluate the effects of periocular injection of triamcinolone acetonide combined with dexamethasone on ocular surface function and tear dynamics in patients with thyroid-associated ophthalmopathy(TAO).

      METHODS: In this single-center retrospective study, 26 TAO patients(52 eyes)treated between September 2020 and September 2023 received periocular injections of triamcinolone acetonide(20 mg)and dexamethasone(2.5 mg). Clinical parameters, including clinical activity score(CAS), ocular surface disease index(OSDI), Schirmer I test(SⅠt), tear film breakup time(BUT), tear meniscus height(TMH), corneal fluorescein staining(FL), meibomian gland loss, and lipid secretion score, were assessed at baseline, 1 wk, and 1 mo post-injection.

      RESULTS: There were statistically significant differences in CAS, OSDI, SⅠt, BUT, TMH, FL score, and meibomian gland secretion score before and after injection in the included patients(all P<0.05). At 1 wk after injection, there were differences in CAS, OSDI, SⅠt, BUT, TMH, FL score, and meibomian gland secretion score compared with those before injection(all P<0.0167). At 1 mo after injection, there were differences in CAS, OSDI, SⅠt, BUT, TMH, FL score, and meibomian gland secretion score compared with those at 1 wk after injection(all P<0.0167). At 1 mo after injection, there were no differences in CAS, OSDI, SⅠt, BUT, TMH, FL score, and meibomian gland secretion score compared with those before injection(all P>0.05). There was a difference in meibomian gland dropout score before and after injection in the included patients(P<0.05), but pairwise comparisons showed no differences(P=0.900, 0.306). During the treatment period, 1 patient experienced transient elevation of intraocular pressure(25 mmHg), which was alleviated after control with intraocular pressure-lowering medication, and no cases of secondary glaucoma occurred.

      CONCLUSION: Periocular injection of triamcinolone acetonide combined with dexamethasone provides short-term improvement in ocular surface symptoms, tear film stability and secretion in TAO patients. However, efficacy diminishes over time and does not reverse structural damage. Long-term maintenance therapy is recommended.

    • Analysis of the current situation of poor vision and wearing of glasses among junior high school students in Xi'an City

      2026, 26(1):174-178. DOI: 10.3980/j.issn.1672-5123.2026.1.31

      Abstract (248) HTML (0) PDF 489.25 K (295) Comment (0) Favorites

      Abstract:AIM:To investigate the prevalence of visual impairment and its correction status among junior high school students in Xi'an, so as to provide evidence for the development of targeted myopia prevention and control strategies.

      METHODS: A stratified cluster sampling design was adopted. From March to May 2025, students in grades 7-9 were recruited from three schools in Xi'an, Shaanxi Province, China: Dongfang Middle School, the Middle School Attached to Xi'an University of Technology, and the Xingqing Campus of the High School Affiliated to Xi'an Jiaotong University. In total, 3 974 students were invited, including 1 726 in grade 7, 1 206 in grade 8, and 1 042 in grade 9. The visual acuity was measured monocularly using a 5 m standard logarithmic visual acuity chart, with the fellow eye occluded; the line corresponding to the smallest optotype that could be correctly identified was recorded as the visual acuity value. Non-cycloplegic autorefraction was performed with a desktop autorefractor to obtain spherical equivalent(SE)values for refractive error screening.

      RESULTS: This study initially included 3 974 students, of whom 32 did not participate in the vision test, resulting in 3 942 students being included in the final analysis. Among them, 3 067(77.80%)were identified with poor vision. The prevalence of myopia was 81.47%(1 746)in males and 87.55%(1 575)in females(P<0.01). A stratified analysis by grade showed myopia rates of 81.72%(1 386)in junior grade one, 84.47%(1 017)in junior grade two, and 88.10%(918)in junior grade three, demonstrating a significant upward trend with increasing grade level(χ2=19.8484, P<0.01). Among the 3 321 myopic students, 2 287 adopted corrective measures. The rates of full correction, under-correction, and non-correction among all myopic students were 48.15%(1 599), 20.71%(688), and 31.14%(1 034), respectively. The rate of non-correction was significantly higher in male students than in females(32.70% vs 29.40%, χ2=4.2222, P<0.05).

      CONCLUSION: The findings indicate a high prevalence of visual impairment among junior high school students in Xi'an, coupled with suboptimal spectacle-wearing and full-correction rates. There is an urgent need for collaborative efforts across society, schools, and families to implement effective interventions to slow the onset and progression of myopia in this population.

    • Comparison of the therapeutic effects of defocus incorporated multiple segments with orthokeratology lenses on controlling axial length growth of myopia in adolescents

      2026, 26(1):179-182. DOI: 10.3980/j.issn.1672-5123.2026.1.32

      Abstract (278) HTML (0) PDF 443.90 K (314) Comment (0) Favorites

      Abstract:AIM: To observe and analyze the clinical effect of defocus incorporated multiple segments(DIMS)and orthokeratology lenses on controlling axial length(AL)growth of myopia in adolescents.

      METHODS: A retrospective study was conducted on 120 adolescent myopia patients(120 eyes)who visited our hospital from April 2021 to April 2023(using data from the main eye for study). According to the patient's preference, they were divided into DIMS group and orthokeratology group, with 60 cases(60 eyes)in each group. Followed-up for 1 a, the changes in spherical equivalent refraction(SER)and AL before and after wearing lenses were measured.

      RESULTS: The general data of adolescents in the two groups were comparable. There were significant differences between two groups in SER before and after wearing glasses(Ftime=123.700, Ptime<0.001; Fgroup=7.499, Pgroup=0.007; Finteraction=3.580, Pinteraction=0.029). The difference of AL between the two groups in comparison of time and interaction before and after wearing glasses was statistically significant(Ftime=40.100, Ptime<0.001; Finteraction=5.830, Pinteraction=0.003), there was no statistically significant difference between groups(Fgroup=0.008, Pgroup=0.927). After wearing lenses for 6 mo and 1 a, there was a statistical difference between the two groups in the changes of SER and AL(all P<0.01). Among them, the changes in SER and AL in the orthokeratology lenses group were smaller than those in the DIMS group.

      CONCLUSION: The orthokeratology lenses have a better effect than the DIMS on controlling the AL growth in myopic adolescents.

Editors-in-Chief: Yan-Nian Hui and Peter Wiedemann

Established in April, 2008

ISSN 2222-3959 print

ISSN 2227-4898 online

Press search
Search term
From To
  • Most Read
  • Most Cited
  • Article Ranking