International Journal of Ophthalmology Press -->Basic Research

Effect of Z,E-butylidedephthalide on experimental choroidal neovascularization in rat and ocular blood flow in rabbits

Wei Jiang,Wun-Chang Ko,Shu-Huei Hsiao and George C Y Chiou

To investigate the effect of Z,E-butylidedephthalide (Bdph)on laser-induced experimental choroidal neovasculari- zation (CNV) in rat model and choroid blood flow in rabbits' eyes. · METHODS: Male Brown Norway rats were treated with Nd:YAG laser to break Bruch's membrane. 30mg/kg and 15mg/kg Bdph were given daily through intraperitoneal injection for 4 weeks after laser treatment. Fluorescein angiography (FA) and choroidal flat mount were used to measure the development of CNV. Female New Zealand white rabbits' eyes were instilled with 10g/L Z,E-BdPh solution, and ocular blood flow was measured with colored microsphere technique. · RESULTS: The intensity of fluorescein leakage, indicating the ocular lesion, decreased significantly in group Bdph 30mg/kg and 15mg/kg, as compared to the control at P <0.01. The area of neovascularization checked by FA in both groups of Bdph, at 30mg/kg and 15mg/kg decreased significantly compared to the control group at P <0.05. On the choroid flat mount, the areas of CNV were also smaller in both Bdph groups than that in control group. One percent drug solution instilled into rabbits' eyes could improve the choroid blood flow at 30 and 60 minutes after drug instillation (P <0.05). · CONCLUSION: Z,E-butylidedephthalide can inhibit the development of CNV in the rat eyes and increase the choroid blood flow in the rabbit eyes. These results suggest that Z,E-butylidedephthalide may be a good agent for the treatment of age-related macular degeneration (AMD).

Expression of transforming growth factor-β type 1 receptor and transforming growth factor-β type 2 receptor in diabetic rat retina

Dan Cao,Lin Liu and Wei Shen

To quantitatively detect gene expression level of transforming growth factor-β type 1 receptor (TβR 1) and transforming growth factor-β type 2 receptor (TβR 2) in different stage of diabetic rats’ retina and to observe and analyze the effect of transforming growth factor-β receptors on the retina of rat diabetic animal model. · METHODS: Twenty-eight healthy adult Sprague-Dawley rats were chosen and randomly divided into two groups of normal control (CON) and diabetes mellitus (DM). Diabetes was induced by streptozotocin (STZ) intraperitoneal injection. Gene expression was detected quantitatively with real-time fluorescence quantitative reverse transcription polymerase chain reaction (QRT-PCR). · RESULTS: The mRNA level of TβR 1 and TβR 2 was 0.000493±0.000133 and 0.000166±0.000057 at 4 weeks. The mRNA level of TβR 1 and TβR 2 was 0.000608±0.000232 and 0.000113±0.000049 at 12 weeks. TβR 1 expression was gradually elevated during the progression of diabetic retinopathy. TβR 2 expression was up-regulated at 4 weeks, but down-regulated at 12 weeks. · CONCLUSION: TGF-β and its receptors (TβR 1 and TβR 2) may play important role in the pathogenesis of diabetic retinopathy.

The changes of protein kinase C for human retinal

Zhao-Yi Sun and Jing Hong

To study the effect of the subretinal fluid (SRF) on proliferation of retinal pigment epithelium (RPE) cells and retinal glial (RG) cells and associated activation and translocation of protein kinase C (PKC) as well as the application of PKC inhibitor. ·METHODS: RPE and RG cells were disintegrated to obtain PKC activity of cytoplasm and cellular membrane after being treated by the subretinal fluid (SRF) from the different stages of PVR patients (grade B and C) or being treated with PKC specific activator [phorbol-12-myris-tate-13-acetate (PMA)] or normal vitreous or DMEM culture medium. PKC activity in cytoplasm and cellular membrane was measured using radioactive isotope 32P labeling in a specific reaction of phosphorylation on PKC substrate. In addition, the PKC inhibitor, dequalinium chloride, was used to pretreat the RPE and RG cells before the cells exposed to SRF or PMA or normal vitreous. 3H-TdR (tritiated thymidine) was used to measure the levels of proliferation of RPE and RG cells with or without the activation and translocation. ·RESULTS: SRF and PMA promoted the proliferation of RPE and RG cells. SRF and PMA activated PKC in the cytoplasm of RPE and RG cells and the activated cytoplasm PKC translocated to the cellular membrane of RPE or RG cells. The cell proliferation or PKC activation or translocation was not equally active in RPE as in RG cells. However, PKC inhibitor which attenuated the cell proliferation did not show significant differenceoninhibitionof RPEandRGcell proliferation( >0.05). ·CONCLUSION: SRF can lead to the activation and translocation of PKC in RPE and RG cells, which promote the proliferation of RPE and RG cells. Dequalinium chloride can inhibit PKC activation and translocation hence slow down the cells proliferation

Carnosine inhibits cataract formation and inactivation of Na⁺-K⁺ATPase induced by a glucocorticoid

Yi Sun and Hong Yan

To investigate whether carnosine can inhibit cataract formation and protect Na⁺-K⁺ATPase against inactivation induced by a glucocorticoid. METHODS: Two hundred and twenty clear lenses cultured in vitro were randomly divided into five groups: control group (DMEM), steroid group (DMEM+Dexamethason 10μmol/L), lower concentration carnosine-treated group (DMEM+Dexamethason 10μmol/L+Carnosine 2mmol/L), higher concentration carnosine-treated group (DMEM+Dexamethason 10μmol /L+ Carnosine 5mmol/L) and carnosine group (DMEM + Carnosine 5mmol/L). Progression of cataract formation was evaluated daily using a dissecting microscope. On 1, 3, 5 and 7 days, 10 lenses of every group were homogenized and the activity of Na^{+^{-K⁺ATPase was measured by using spectrophotometer.
RESULTS: During the incubation, mistlike opacity was observed in the lenses of the control group and carnosine group, but in the steroid group appeared dense nuclear opacity, while both two carnosine-treated groups came out visible demarcation between nuclear and cortical regions on 7 days. A decrease in the activity of Na⁺-K⁺ATPase was found in the lens of the steroid group. On 3, 5, 7 days, Na⁺-K⁺ATPase activity decreased 22.34% (P =0.002), 47.98% (P <0.001), 75.37%(P <0.001) compared with that at 1 day, respectively. In the carnosine group, the activity of Na⁺-K⁺ATPase remained at the level of the control throughout the 7-day incubation, indicating that carnosine itself did not interfere with the original lens enzyme activity. In the lower concentration carnosine-treated group, on 3, 5, 7 days, the activity of Na⁺-K⁺ATPase increased 10.8% (P <0.05), 44.6% (P <0.01), 57.4% (P <0.01) of control activity, respectively. In the higher concentration carnosine-treated group, the activity of Na⁺-K⁺ ATPase increased 11.3% (P <0.05), 45.7% (P <0.01), 57.6% (P <0.01), respectively on 3, 5, 7 days. The activity of Na+-K+ATPase in both two carnosine-treated groups were only 6.7% and 6.5% lower than that of the control group after 7-day incubation. After the 7-day incubation, the Na⁺-K⁺ ATPase activity of the lenses in the steroid group decreased significantly compared with carnosine-treated groups(P ＜0.01).
CONCLUSION: Carnosine prevents the cataract formation induced by a glucocorticoid, and significantly inhibits the inactivation of Na⁺-K⁺ATPase induced by a glucocorticoid.}}

Hydroxyapatite modified titanium promotes superior adhesion and proliferation of corneal fibroblast in comparison with pure titanium

Xiao Ma,Zhao-Hui Li,Yi-Fei Huang,Yu-Jie Lu,Le-Yun Wang and Jing-Xiang Huang

To determine whether hydroxyapatite modified titanium promotes superior adhesion and proliferation of rabbit corneal fibroblast in comparison with pure titanium. · METHODS: We used bioactive hydroxyapatite to modify titanium surfaces. Fourth passage fibroblasts of rabbit cornea were seeded on hydroxyapatite modified titanium surfaces, pure titanium and glass surfaces. Cell adhesion, proliferation and morphology were detected at 24, 48, and 72 hours using a acridine orange stain. Further studies of cell morphology were performed using scanning electron microscopy. · RESULTS: Cell counts were significantly greater on hydroxyapatite modified titanium surfaces at each time point (P＜0.05). At 24 hours, cell spreading was greater on hydroxyapatite-coated titanium and glass than on the pure titanium. At 72 hours, compared with pure titanium and glass surfaces, the cells on hydroxyapatite modified titanium surfaces had greater spreading area and longer stress fibers. · CONCLUSION: Hydroxyapatite modified titanium promotes superior adhesion and proliferation of rabbit corneal fibroblast in comparison with pure titanium.

Experimental study of TGF-β2 antisense oligodeoxynucleotide as an anti -scarring agent in glaucoma surgery

Jin-Ying Li,Pei Fu and Qi Yang

To investigate the effect of TGF-β2 antisense oligode- oxynucleotide on differentiation, proliferation of subconjunctival fibroblast following glaucoma filtration surgery. · METHODS: Glaucoma filtration surgery was performed on both eyes of 28 rabbits. TGF-β2 antisense oligodeoxynucleotide was subconjunctivally injected in the right eyes (group A),and TGF-β2 missense oligodeoxynucleotide (group B) or PBS (group C) was used at the same method in the left eyes as controls. Rabbits were killed at 4, 7, 14 and 28 days after surgery. Intraocular pressure (IOP), bleb characteristics were recorded at different time point. Subconjunctival fibroblasts were examined by immunohistochemistry and electron microscopy. · RESULTS: The IOP of rabbits in group A was significantly lower at 14 days (6.74±1.18mmHg) and 21 days (8.15±1.97mmHg) after operation than the IOP in group B (8.53±1.04, 9.72±1.09mmHg; P <0.01) and group C (8.79±1.21, 9.43±1.27mmHg; P <0.05). The mean bleb survival time was longer (17.2 days) in group A than that of group B (14.5 days) and group C (13.5 days) (P <0.05). The population of the cells expressing α-smooth muscle actin (α-SMA) and proliferating cell nuclear antigen (PCNA) was significantly reduced in group A compared with the group B and C. The ultrastructure of fibroblast was not altered by TGF-β2 antisense oligodeoxynucleotide. · CONCLUSION: TGF-β2 antisense oligodeoxynucleotide can prevent the scar formation after glaucoma surgery by inhibiting the differentiation and proliferation of subconjunctival fibroblast. It could be a potentially useful anti-scarring alternative for the prevention of late surgical failure.

Inhibition of human pterygium fibroblasts by vitamin E succinate

Jing Yua and Jian-Xiong Yu

To study the antiproliferation of vitamin E succinate (VES) on pterygium fibroblasts in vitro and to find a potential agent for prevention and treatment of primary and recurrence pterygium. · METHODS: Primary culture and subculture of pterygium fibroblasts were established in vitro, and different concentrations of VES (0, 10 and 20mg/L) were added to subcultured fibroblasts, respectively. Influence of VES on the growth curve of fibroblast was observed at day 2, 4 and 7 after treatment of VES. 3-[4,5-Dimethylthiazolzyl]-2,5-Diphenyl Tetrazolium Bromide (MTT) assay at 490nm was used to evaluate the effect of the cells proliferation. · RESULTS: The addition of VES to culture caused the marked descent of growth curve in comparison with the control group, and the inhibiting rate of 10 and 20mg/L of VES was 33.2% and 46.7%, 67.9% and 76.8%, 81.7% and 89.3% at day 2, 4 and 7, respectively. VES could obviously inhibit the fibroblast proliferation in dose-dependent manner by MTT assay. · CONCLUSION: VES can significantly inhibit the proliferation of pterygium fibroblast in vitro.

Construction and identification of the eukaryotic expression vector carrying specific siRNA of LEDGF p52 gene

Hai-Sheng Zhao and Yi Wang

To construct and identify LEDGFp52 eukaryotic expression vector for RNA interference. · METHODS: Recombinants were designed and established by targeting gene LEDGFp52 and plasmid pGensil-1 based on LEDGFp52 cDNA sequences of Genomes. Two pairs of oligonucleotides were synthesized according to the Tuschl principle and inserted into plasmid pGenSil-l to generate siRNA eukaryotic expression vector. DH5α strains were transformed, plasmids were extracted, and recombinant vectors were identified by the restriction map and the sequence analysis. The cultured cells were transfected by the recombinant plasmid (pGensil-1-RNA.LEDGFp52-1). At 48 hours after transfection, the whole cell protein was extracted, and the protein level was detected using Western blotting with mouse anti-human LEDGFp52 monoclonal antibody.　 · RESULTS: Recombinant plasmids completely concord with the designs by the restriction map and the sequence analysis, the protein level of LEDGFp52 was down-regulated at 48 hours after transfecting pGensil-1-LEDGFp52-1 expression vector into HeLa cells, the recombinant eukaryotic expression vectors were successfully constructed. · CONCLUSION: siRNA recombinant can be successfully constructed by RNAi technique to inhibit the expression of LEDGFp52.

Cloning and expression of immunotoxin DT389-hbFGF

Lian-Rong Yin,Jia-Qin Yuan,Lei Cui and Hai Lu

To express the DT₃₈₉-hbFGF (389 amino acid residues of the N-terminus of diphtheria toxin (human basic fibroblast growth factor) fusion protein for potential targeting therapy towards posterior capsule opacification (PCO) after cataract surgery. METHODS: The DNA of inactivated diphtheria bacillus and RNA of 12-week fetal brain cortex were extracted, respectively. The fragments of truncated diphtheria toxin (containing 389 amino acids of N-terminus, DT₃₈₉) and full-length human basic fibroblast growth factor (hbFGF) sequence (encoding 18kDa protein) were amplified by PCR. The two fragments were inserted into pGEX-4T-1 prokaryotic expression vector to obtain pGEX-DT₃₈₉-hbFGF prokaryotic expression plasmid. After sequence analysis, the expressing plasmid was transformed into Escherichia Coli BL21 strain and expression was induced under IPTG. The expressed fusion protein was purified and identified. RESULTS: The gene fragments encoding DT₃₈₉ and hbFGF were amplified and their gene sequences were confirmed. Hybrid gene expression plasmid pGEX-DT₃₈₉ (hbFGF) was constructed. The fusion protein DT389-hbFGF was expressed and purified. CONCLUSION: The successful cloning and expression of DT₃₈₉-hbFGF immunotoxin provides a foundation for targeting therapy towards posterior capsule opacification.

Alteration of intraocular pigment epithelium-derived factor and vascular endothelial growth factor in patients with diabetic retinopathy

2017/9/25 16:57:59

AIM:b To determine the aqueous, vitreous, serum levels of pigment epithelium-derived factor (PEDF) and vascular endothelial growth factor (VEGF) in patients with proliferative diabetic retinopathy (PDR), and to speculate on the source of the change in concentration and to discuss its clinical significance. METHODS:b Forty-one eyes with proliferative diabetic retinopathy were included in the study, 16 of which were complicated by neovascularization of iris (NVI). Twenty-one eyes with idiopathic macular hole (MH) were as controls. The aqueous,vitreous, serum levels of PEDF and VEGF of all the groups were determined with ELISA. PEDF, VEGF and the levels in the three groups were compared with analysis of variance(ANOVA). The PEDF, VEGF concentrations in aqueous,vitreous and serum were analyzed with Pearson correlation test, and the correlation of PEDF and VEGF levels was also analyzed with Pearson correlation test. RESULTS:b The aqueous levels of PEDF decreased significantly in sequence in groups of control, PDR without NVI,PDR with NVI. VEGF levels increased coordinately. The similar findings existed in vitreous samples. The PEDF, VEGF levels in aqueous were not correlated significantly with those in serum, but correlated positively with those in vitreous. The intraocular levels of PEDF had a negative correlation to those of VEGF. CONCLUSION:b The reduction of intraocular PEDF level and elevation of intraocular VEGF level may play an important role in the occurrence and progression of PDR. In the development of PDR, the PEDF,VEGF levels in aqueous may be mainly effected by local pathological changes, as anti-angiogenic and pro-angiogenic factors, their unbalanced intraocular distribution may promote the angiogenesis of the iris and retina.

Inhibitory effect of tetrandrine eye drops on corneal allograft rejection in rats

Yue Zhang,Shi Zhang,Xiao-Ping Chen,Dai Li and Shi-Xing Hu
To observe the effect of tetrandrine (Tet) eye drops of different concentrations on corneal graft and on allograft rejection in rats. · METHODS: Models of allograft rejection were set up in 64 SD rats and they were then randomly divided into 3, 5, 10g/L tetrandrine eye drops-treated and control groups. At different times postoperatively, neovascularization and inflammation of corneal graft were observed using slit-lamp microscopy, HE staining, light microscopy and microphoto-analysis. · RESULTS: The graft was infiltrated mainly with lymphocytes and mononuclear-macrophages. Corneal neovascularization and inflammation were significantly inhibited in the 5g/L Tet-treated group (P <0.05), compared with control group on day 7, 14, 21, 28 postoperatively. · CONCLUSION: Corneal edema and corneal epithelial bubble appear when the graft is treated with tetrandrine of higher concentration (10g/L), but 5g/L Tet eye drops significantly inhibit corneal allograft rejection in rats without serious side-effects.

A study on accommodation mechanism with numeri- cal simulation
To study accommodation mechanism with numerical simulation. · METHODS: A simulation model was constructed to study the mechanism of accommodation based on the experimental data derived from published resources. The displacement and pressure were applied on the model to study the deformation of lens during accommodating. · RESULTS: The simulation showed that, as the eye was accommodating, the thickness of the lens increased linearly, and the lens diameter decreased linearly. The optical power of the lens increased as the accommodation increased. This result was accord with the public facts in accommodation. Furthermore, the pressure was found to have a great influence on the shape of the lens and the optical power. The lens became thinner and flatter as the pressure increased and the pressure caused a remarkable increase of lens' optical power. · CONCLUSION: The outcome of this paper is consistent with the Helmholtz's hypothesis on accommodation to some extent. The analytical model presented in this paper can be used in the theoretical study of the accommodation mechanism of the human lens.

Preparation of endostatin protein andthe measurement of its biologic activity
To investigate the preparation of endostatin protein and its biologic activity on vascular endothelial cell. ·METHODS: pBlast-hEndostatin and pBlast-Mcs were identified by digesting with Nhe玉and Sal玉, by PCR reaction, by sequencing, and by alignments of PCR products with gene bank using NCBIBLAST software. The identified pBlast-hEndostatin as well as pBlast-Mcs were then purified with QIAGEN Endofree plasmid maxi kit. The purified plasmids transfected human fibroblasts. The expression of endostatin was detected by RT-PCR,Western blot and immunohistochemistry. The endostatin protein produced by transfected fibroblasts was purified by ultrafiltration and affinity chromatography. The inhibitory action of endostatin on human umbilical vein endothelium was measured by MTT assay. ·RESULTS: pBlast-hEndostatin was found to contain human endostatin gene. Endostatin protein was produced by transfected fibroblasts. The inhibitory ratio of 2.5,5,10,20, 40,80mg/L endostatin on human umbilical vein endothelium for 48 hours were 8.5%,13.1%,27.7%,38.1%,56.7%,63.8% respectively. IC50 value was 34.5mg/L. No inhibitive action was found on fibroblasts. ·CONCLUSION: Endostatin protein can be produced by the transfected fibroblasts. The produced endostatin has inhibitory action on human umbilical vein endothelium and has no inhibitive action on fibroblasts.

ET-１ expression and ultrastructural changes inthe retina after exposureto infrasound in rats
to evaluatethe exPressionof ET-1 and ultrastructural changes inthe retinaof SPrague-Dawley rats after exPosureto infrasound. ·METHODS:twenty-five male SPrague-Dawley rats were randomly divided into 5 grouPs, 5 in each grouP, and 4 grouPs were exPosedto infrasoundof 16Hz, 130dB for 2 hours each day, and 1 grouP served as control.the exPosuretime forthe 4 grouPs was resPectively 1, 7, 14 and 21 days.then,the rats were sacrificed after intravenous injection with lanthanum nitrate (La), andthe retina was examined with electron microscoPy and immunochemistry with antibodies against ET-1. ·RESULTS: After infrasonic exPosure for 1 day, ET-1 was exPressed mainly inthe endotheliaof retinal and choroidal blood vessels, so was it inthe control grouP. After infrasonic exPosure for 7 days, it was exPressed mainly inthe retinal Pigment ePithelial cells,outer nuclear layer andouter Plexiformlayer. After exPosure for 14 days, its exPression was enhanced intheouter nuclear layer, inner Plexiform layer and ganglion cell layer. After exPosure for 21 days, its exPression was weakened in all layers. With exPosure goingon,the injury in retina gradually extended fromtheoutertothe inner. Underthe electronic microscoPe, La wasobservedto have infiltrated into several layersofthe retina after 1 dayof exPosure and it became denser and denser fromthe 1sttothe 21st day excePt atthe 7th day. Meanwhile,the retinal layers showed cellular edema, swollenorganelles such as mitochondria and endoPlasmic reticula, karyoPyknosis and edging, cell membrane and karyotheca dilation, ruPture and myelin changes. ·CONCLUSION:the exPressionof ET-1 in retina is relatedtothe locationof infrasonic injury, and ET-1 may have a Protective effecton retina againstthe infrasonic injury.

Morphological investigationon acrysof natural's protective function from acute retinal light injury

Bo Qu,Li-Wei Ma and Jin-Song Zhang
to investigate whetherthe Acrysof Natural hasthe Protective function for retina from blue light in morPhology. METHODS: Fresh Porcine eye cuPs were formed in vitro. Blue light beam between 420-450nm sPectrum eradiatedthe Porcine retina and retinal Pigment ePithelial(RPE) cells were cultured in 30J/cm² and 40J/cm² resPectively.the adjacent region in 3mm diameter was eradiated in various ways: exPosed directlyto light,through AcrySofone Piece intraocular lens(IOL), PMMA IOL, AcrySof Natural IOL, and without light.thenthe eye cuPs were cultured for 48h. Lastly,tissue and cell structure wereobserved with light microscoPe andtransmission electron microscoPe (TEM). RESULTS: Inthe retinal region without light,the structureof every layer was clear; cells in neuroePithelial layer arrayed inorder； some bubbles Presented in external granular layer and internal granular layer; RPE cells were comPact, andthe colorof Pigment article was coincident. Inthe region with direct blue light andthat with 30J/cm^{2⁺Acrysofone-Piece/ PMMA, cellson PhotorecePtor and external granular layer were lost Partially, bubbles increased, RPE cells wereof different sizes, and cell edema, cell lost and Pigment article cluster could be seen. In region with 30J/cm²+ Natural, a little disorganization could be seen comParedtothat without light, but more normalthanthose with Acrysof and direct eradiation. Whenthe Power was 40J/cm2,the situation was similartothat with 30J/cm2 but more severe.
CONCLUSION: ①the blue light intensity in 30J/cm² and 40J/cm² could both inducethe acute retinal light injury； ② AcrySofone Piece IOL andother PMMA IOL have noobvious effecton retina comPared with direct eradiation; ③AcrySof Natural can weakenthe injuryof blue lightto some extent.}

Effect of d-timolol and l-timololon rat experimental choroidal neovascularization in vivo and endothelial cells in vitro

Xin-Rong Xu,Yan-Hong Zou and George C Y Chiou
ImPairmentof choroidal Perfusion was found in age-related macular degeneration(AMD) Patients. We Postulatedthat vasoactive agents, which can reduce choroidal blood flow resistance, might Preventthe develoPmentof choroidal neovascularization (CNV). D-Timolol and L-Timolol are hyPotensive agents used in cardiovascular and glaucomatheraPy.their effectson laser-induced exPerimental CNV rat model and human umbilical vein endothelial cells (HUVEC) werethus evaluated. ·METHODS: Male Brown Norway rats were anesthetizedto receive Nd:YAG laserto breakthe Bruch's membrane. D-Timolol and L-Timolol were givenonce dailythrough intraPeritoneal injection after lasertreatment for 4 weeks. Fluorescein angiograPhy(FA) was Performedon 2 weeks and 4 weeks. HUVEC weretested by Proliferation assay and adhesion assay with D-Timolol and L-Timolol at different concentrations. ·RESULTS: D-Timolol reducedthe fluorescein leakageto 83%ofthe control grouP in laser-induced rat's CNV model at a dosageof 15mg/(kg·d). L-Timolol had no effecton CNV formation even at a higher dosageof 20mg/(kg·d). D-Timolol inhibitedthe endothelial cells Proliferation significantly by 300mg/L. L-Timolol also significantly inhibitedthe cell Proliferation at 1 000mg/L. But at a lower dose such as 300mg/L, no significant inhibitory effect was found. Both drugs showed no effecton cell adhesion function in cell culture exPeriments. ·CONCLUSION: D-Timolol was foundto Prevent CNV develoPment in laser-induced model in vivo and inhibit vascular endothelial cells Proliferation in vitro . L-Timolol had no effecton cell Proliferation atthe same dose, and neitheron rat CNV model.the results indicatethesetwo isomers have different functionson rat's CNV Prevention andon HUVEC cell Proliferation.

Advanced glycation endproducts enhance proliferation but nottube formation in choroidal microvascular endothelial cells
To investigate the role of advanced glycation endproducts (AGEs) in the pathogenesis of age-related macular degeneration (AMD). ·METHODS: Bovine choroidal endothelial cells (CEC) were isolated by the modified protocol using lycopersicon esculentum agglutinin coated Dynabeads, and identified by immunocytochemical staining with anti-Factor VIII antibody and uptaking of dil-acetylated low-density lipoprotein (dil-ac-LDL). AGEs were prepared by incubating 50g/L bovine serum albumin and 150g/L glucose at 37益for 6 weeks, which were characterized by dot blot assay with anti- AGEs antibody. CEC proliferation was evaluated by 3, (4,5-dimethylthiazol-2-yl)-2,5- diphenyl tetrazolium bromide (MTT) assay, and tube formation in CEC was determined by a Vitrogen system. ·RESULTS: More than 90% of the cultured cells were positive to Factor VIII immunostaining and had the ability to uptake dil-ac-LDL, which were the features of endothelial cells. 219AGEs we prepared were affinitive to anti-AGEs antibody. After treatment with AGEs for a time course of 3 days, CEC proliferation was significantly increased in a dose-dependent manner by AGEs at concentrations between 62.5mg/L and 500mg/L. The cytokine, basic fibroblast growth factor (bFGF), enhanced strongly tube-like structure formation in CEC to 124%( <0.05) above that of untreated c ontrols. In this condition, AGEs at the concentrations of 500mg/L and 50mg/L showed no effect on CEC tube formation ( >0.05). ·CONCLUSION: The present study demonstrated that CEC proliferation was increased by AGEs. However, there was no statistical effect on CEC tube formation. These findings confirm and extend that AGEs could be a potential initiator in the pathogenesis of choroidal neovascularization in exudative AMD, at least in part, through enhancement of CEC proliferation

Quantitative researchon effectsof pyrrolidine dithiocarba mateonthe aqueous flare in a pvr ｍodel ｗith lfcＭ

Jian Jiao,Wu Liu,Bin Mo and Lin Yang
to studythe inhibitory effectof Pyrrolidine dithiocarbamate (PDTC)onthe inflammatory reaction in an exPerimental Proliferative vitreoretinoPathy (PVR) model with laser flare cell meter (LFCM). ·METHODS: Atotalof 20 Pigmented rabbits were divided intotwo grouPs randomly, with 10 rabbits in each grouP. Afterthe creationof retinal holes, 0.1mL PDTC was injected intravitreally intothe right eyesof GrouP 1(A1) andthe left eyesof GrouP 1(A2), and 0.1mL balanced saline solution (BSS) intothe right eyesof GrouP 2(B1).one hour later, 0.1mL BSS was injected intothe eyesof A1, and 5000U IL-1β in 0.1mL BSS was injected intravreally intothe eyesof A2 and B1. Clinical evaluation and LFCM examination were Performed before retinal injury (P0) and at 4, 24 hours, 1, 2 and 4 weeks afterthe second injection (P4h, P24h, P1wk, P2wk and P4wk). HistoPathologic and immunohistochemical examination were also Performed atthesetime Points. ·RESULTS: PDTC could inhibitthe inflammatory reactionobviously from P24hto P2wk.the eyesof A1 and A2 recovered earlierthanthoseof B1. Although inflammatory reaction inthe 3 grouPs resolved comPletely bythe endof P2wk measured withthe slit-lamP microscoPe,the eyesof B1 still showedobvious aqueous flare judged bythe LFCM comPared withthoseof A1 and A2. HistoPathologic and immunohistochemical examination showedthat nuclear factor-κB (NF-κB) was activated by IL-1β andthe PDTC had inhibitory effecton it withoutobvioustoxicityto retina. ·CONCLUSION: Inflammatory reaction is involved inthe rabbit modelof PVR induced by injecting intravitreally IL-1β andthe PDTC can relieve it significantly.the LFCM Provides a new, sensitive,objective and non-invasive methodto quantifythe inflammatory reaction inthe PVR model.

Expression of fas／fasl andthe apoptosis in rat ischeｍia／reperfusion-induced retinal injury and effectsof bfgf

Ying Zhao,Ying-Jun Niu,Zhan-Yu Zhou,Yun-Xia Gao and Hong-Yun Wang
to exPlorethe relationshiP betweenthe exPressionof Fas/FasL andthe aPoPtosis in retinal ischemia/rePerfusion injuryof rats, as well asthetheraPeutic effectsof basic fibroblast growth factor（bFGF）onthe ischemic retina. ·METHODS:the modelsof retinal ischemia/rePerfusion injury were made bytransiently elevating intraocular Pressure(IOP). Atotalof 28 rats were divided into Normal GrouP andoPerative GrouP.the latter was subdivided into 1, 6, 12, 24, 48 and 72 hours grouPs after rePerfusion, in whichthe left eyesofthe rats were inthe ischemia/ rePerfusion grouPs andthe rightones were inthetreatment grouPs(bFGF intracameral injection). APoPtosis was assessed bytheterminal deoxynucleotidyltransferase-mediated dUTP- biotin nick-end labelling (TUNEL) method, andthe exPressionof Fas/FasL was studied by strePt avidin-biotin comPlex （SABC）immunohistochemistry. ·RESULTS: No Positive cells wereobserved inthe normal rats’ retinae, butthere were a significant numberoftUNEL Positive cells in 6-24 hours aftertransient ischemia followed by a decrease at 48 hours.the numberoftUNEL Positive cells reached a maximum at 24 hours after ischemia.the exPressionof Fas gradually increased as early as at 6 hours, reached a Peak at 24 hours,then decreased at 48 hours. Similarly,the exPressionof Fas ligand was at Peak in 24 - 48 hours in ganglion cell layer(GCL) and INLof retina. bFGF administered before rePerfusion inhibited aPoPtotsis and amelioratedthetissue damage. It also diminished Fas and FasL exPression in ischemic/rePerfused retina. ·CONCLUSION: Retinal ischemia-rePerfusion aftertransiently elevated IOP induced aPoPtosisof cells inthe retina. Fas/FasL may have an imPortant role inthe early eventsofthe aPoPtotic Pathways. bFGF can rescue retinal ganglion cells from retinal ischemia/rePerfusion injurythrough down- regulationof Fas and Fas ligand exPression and may rePresent an imPortant mechanism fortheraPeutic neuroProtection.

Effects of high-concentration insulinon expressionof vascular endothelial groｗth factor in cultured Ｍüller cells in vitro

E Song,Wei Yang,Zhi-Hua Cui and Jia-Xiang Wu
to studythe effectof high-concentration insulinonthe exPressionof vascular endothelial growth factor (VEGF) in cultured rabbit retinal Müller cells in vitro . METHODS: Müller cells were cultured with insulinof different concentrations (4×10³ , 8×10³ , 12×10³ U/L). Immunocytochemistry,in situ hybridization and ELISA were conductedto assaythe exPressionof VEGF in cultured Müller cells in vitro at different insulin concentrations qualitatively and quantitatively. RESULTS: VEGF exPression was enhancedobviously by high concentrationof insulin. CONCLUSION: Insulin Plays an imPortant role in neovascularizationof diabetic retinoPathy(DR) by stimulatingthetranscriPtionofthe VEGF gene in Müller cells so asto enhancethe exPressionof VEGF Protein.

Effect of heat shocｋ protein-７０on lens epithelial cells in huｍan diabetic cataract

Guo-Xing Xu,Jian-Zhang Hu,ting-Ting Wang,Ｗei-dong Ｚheng,Ｗen lin and li-li Ｗu
to studythe effectof heat shock Protein-70(HSP-70)on lens ePithelial cells (LECs) in human diabetic cataract . ·METHODS:the exPressionof HSP-70 was assayed by using immunohistochemistry (strePtavidin-alkaline PhosPh- atase, S-P) in human diabetic cataract LECs (23 cases) and human normal LECs (7 cases). ·RESULTS:the exPressionof HSP-70 (x 2= 24.67, P < 0.01) was significant in diabetic human LECs (23 cases) butthere was no exPressionof HSP-70 in normal human LECs (7 cases). ·CONCLUSION: HSP-70 may Play a critical role inthe develoPment and formationof human diabetic cataract.

Effects of resveratrolon Proliferationof retinal vascular endothelial cells and exPressionof VEGF

Wen-Lin Li,Li Zhang and Yue-Li Zhang
To studythe effectsof resveratrolonthe Proliferationof human retinal vascular endothelial cells(RVEC) induced by cobalt chloride-simulated hyPoxia in vitro. METHODS: CoCl2(100μmol/L) was usedto simulate hyPoxic condition, and human RVEC were cultured in vitro as model.the cell Proliferation was determined by MTT method; SABC method was emPloyedtotestthe exPressionof vascular endothelial growth factor(VEGF); and comPuter image analyzer was usedto Process data.the effectsof resveratrolonthe Proliferationof vascular endothelial cells wereobserved. RESULTS: Resveratrol inhibitedthe Proliferationof human RVEC induced by CoCl₂ in a dose- andtime-dePendent manner in vitro, meanwhile VEGF exPression in all grouPs which were administered medicine was down-regulated. Both kindsof inhibitive effectsof resveratrol were statistically significant (P <0.01). CONCLUSION：Resveratrol can significantly inhibitthe Proliferationof human RVEC andthe exPressionof VEGF, which may Provide a new aPProach for Prevention andtreatmentof retinal neovascular diseases. "

Genotyping analysis of a polymorphic G-954C of NOS2A in diabetic retinopathy with cystoid macular edema

Huo Lei,Tao Shou,Jian-Mei Gao,Juan Liu,Xin-Min Yan and Lin Fang
AIM: To analyze the genotype of the allele distribution of a polymorphic G-954C within the 5' upstream promoter region of the nitric oxide synthetase 2A gene (NOS2A ) in samples of diabetic retinopathy in patients with cystoid macular edema in the mainland of China. · METHODS: Eighty-nine patients with diabetic retinopathy and cystoid macular edema and 90 healthy controls were enrolled in this study. Nest polymerase chain reaction (PCR) was performed, and restriction endonuclease digestion and gene fragments sequence were examined to detect the genotype of NOS2A G-954C. · RESULTS: The genotypes of the sample population of 89 cases and 90 healthy controls were all detected as GG. · CONCLUSION: The distribution of G-954C of NOS2A polymorphism are at a lower frequency in China, with little relevancy to the frequency of diabetic retinopathy combined with cystoid macular edema.

Inhibitory effects of pioglitazone on alkaline burninduced corneal neovascularization in rats

Yi-Xia Zhang and Ming-Chang Zhang
AIM: To investigate the effects of pioglitazone on corneal neovascularization（CNV）induced by alkaline burn in rats and on expression of vascular endothelial growth factor (VEGF) and basic fibroblast growth factor (b-FGF). ·METHODS: CNV was induced by alkaline burn in rats which were then administered pioglitazone subconjunctivally. Corneal angiogenesis was evaluated and observed with a slit lamp microscope and the VEGF and b-FGF level were determined by immunohistochemistry and Western blot at different intervals. ·RESULTS: The CNV of the rats was shown two days after alkaline burn, and reached its highest level in 7-10 days. The mean values of the area and length of neovascularization and the VEGF and b-FGF levels in the pioglitazone-treated group were significantly lower than those in the control group at various time. · CONCLUSION: Local application of pioglitazone could remarkably inhibit CNV, probably by means of downregulation of VEGF and b-FGF expression.

Effects of brain-derived neurotrophic factor on the expression of caspase -2 and caspase -3 and cell apoptosis in retinal ischemia/reperfusion injury

Ying-Bin Xie,Ying-Jun Niu,Chun-Yan Yuan,Ying Yang,Wei-Yan Zhou and Xiu-Ting Yu
AIM: To explore the relationship between the expression of caspase-2 and caspase-3 and the apoptosis in retinal ischemia/reperfusion (I/R) injury of rats, as well as the therapeutic effects of brain derived neurotrophic factor （BDNF）on the ischemic and reperfused retina. · METHODS: This experiment was conducted at the laboratory of Affiliated Hospital of Qingdao University Medical College from February 2007 to July 2007. The models of retinal ischemia/reperfusion injury were made by transiently elevating intraocular pressure. A total of 28 rats were divided into normal and operative groups. Operative group was divided into six subgroups. In each subgroup there were four rats. The left eyes of rats were used for I/R and the right eyes were used for intravitreal injection of brain-derived neurotrophic factor (BDNF) as treatment group. After reperfusion we divided our subgroups according to the reperfusion time as 1, 6, 12, 24, 48, 72 hours. The retinal ganglion cell number was counted by using optic microscope (BX-51,Olympus). Apoptosis was assessed by the terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick-end labelling (TUNEL) method, and the expression of caspase-2, caspase-3 was studied by enzyme linked immunosorbent assay (ELISA) and strept avidin-biotin complex (SABC) immunohistochemistry. ·RESULTS: No positive apoptotic cells were observed in the normal rats' retinae, but there were a significant number of positive apoptosis cells in 6-24 hours after transient ischemia followed by a decrease at 48 hours. The number of apoptotic cells reached a maximum at 24 hours after ischemia .The expression of caspase-2 gradually increased as early as at 6 hours, reached a peak at 24 hours, then decreased between 48 and 72 hours. Similarly, caspase-3 has the same rule with caspsae-2 in the time courses of expression in retinal tissues. BDNF administered before reperfusion inhibited the expression of apoptosis and ameliorated the retinal tissue damage. It also decreased caspase-2 and caspase-3 expression in ischemic/reperfused retina. ·CONCLUSION: Retinal ischemia-reperfusion can induce apoptosis of cells in the retina. BDNF rescues retinal ganglion cells (RGCs) fromretinal ischemia/reperfusion injury through down-regulation of cell apoptosis and caspase-2 and caspase-3 expression. BDNF have a neuroprotective effect on retina.

Effect of vitamin A on the conjunctival goblet cells of rat after corneal transplantation

Yue Zhang,Wan-Rong Huang,Shi Zhang and Ying-Peng Liu
AIM: To investigate the effect of vitamin A on the conjunctival goblet cells of rat after corneal transplantation. · METHODS: Rat graft rejection models of corneal transplant- ation were established. SD rats were receptor and Wistar rats were donors. After corneal allografts were performed, 48 SD rats were randomly divided into three groups, 16 rats in each group. Group A was blank control group; group B was treated by oculotect gel (containing vitamin A); group C was treated by 1g/L dexamethasone eyedrops. Besides, group D was normal unoperated eyes. Slit-lamp microscope was employed to record and compare rejection index (RI) of corneal transplantation. By HE, PAS staining of conjunctival histological sections and image analysis system, the number and morphology of conjunctival goblet cells were observed and analyzed between operation group and normal group. · RESULTS: The HE, PAS staining detection showed that the number of conjunctival goblet cells in oculotect gel group, 1g/L dexamethasone eyedrops group and control group is lower than that in normal group after surgery (P <0.01). The number of conjunctival goblet cells in oculotect gel group and 1g/L dexamethasone eyedrops group is higher than that in control group (P <0.05). The number of conjunctival goblet cells in 1g/L dexamethasone eyedrops group is higher than that in oculotect gel group (P <0.05). · CONCLUSION: The results indicate that vitamin A may inhibit the decrease of conjunctival goblet cells after corneal allograft rejection in rats.

Effect of carnosine on steroid-induced modification of lens α-crystallin

Hong Yan,Yi Sun,Wan-Ying Liu,Jian-Wei Wang and Yong-Qiang Wang
To explore whether carnosine can protect α-crystallin modification and decrease chaperone by a steroid, and whether carnosine could directly react with a steroid. · METHODS: Bovine lens α-crystallin was separated by size- exclusion chromatography on a Sephacyl S-300 HR column. α-Crystallin was incubated with different concentrations of prednisolone-21-hemisuccinate (P-21-H) with or without carnosine for different times. The chaperone activity of α-crystallin was monitored using the prevention thermal aggregation of α-crystallin. The modified α-crystallin was examined by SDS-PAGE and fluorescence measurements. The absorbance spectra of solutions of carnosine and P-21-H were investigated. · RESULTS: P-21-H decreased the chaperone activity of α-crystallin in a concentration- and time-dependent fashion. Carnosine only worsened this effect. The tryptophan fluorescence intensity of α-crystallin modified by P-21-H was significantly decreased compared with unmodified crystallin, whereas its non-tryptophan fluorescence was increased with a shift to longer wavelengths in a time- and dose-dependent manner, suggesting that new fluorophores were possibly formed. Carnosine readily reacted with P-21-H thereby inhibiting steroid-mediated protein modification as revealed electrophoretically. The increased absorbance was time-dependent, suggesting adducts may be formed between carnosine and P-21-H. · CONCLUSION: Carnosine reacts with P-21-H, which suggests carnosine's potential as a possible anti-steroid agent.

PTEN mRNA expression in proliferative LECs of the rabbit

Rui-Jun Zhang and Jin-Song Zhang
To observe the effects of chromosome 10 (PTEN) and the tumor suppressor gene in proliferative LECs of the rabbit. ·METHODS: Forty-two white rabbits were randomly divided into test group (36 rabbits) and control group (6 rabbits). The transparent lenses of treated rabbits were operated with extracapsular cortex extraction, and the controls were kept untouched. The rabbits were sacrificed 1 day, 3 days, 1 week, 2 weeks, 1 month and 2 months after surgery. Immunohistochemistry was applied to detect proliferative cellular nuclei antigen (PCNA) as well as hybridization and reverse-transcriptase polymerase chain reactions (RT-PCR) were applied to detect phosphatase as well as tensin homology deleted on PTEN mRNA in lens equartor. ·RESULTS: PCNA expression increased significantly to a high level at 1 week, began to reduce 2 weeks later, and recovered to the normal level 1 month or 2 months after the surgery. PTEN mRNA expressed positively in normal rabbit LECs. The relative PTEN mRNA contents reduced greatly 1 day after operation and remained low level at 3 day. It began to increase slightly at 1 week, kept rising at 2 weeks and regained the normal expression after 1 month or 2 months. There was inverse correlation between the PTEN mRNA and PCNA expression. ·CONCLUSION: PTEN mRNA expresses positively in normal rabbit LECs plasma. PTEN participates in LECs proliferation and correlates with lens proliferative conditions

The effects of laminin and fibronectin on human lens epithelial cells growth characters and vimentin expression

Xin-Ling Wang,Jin-Song Zhang and Tao Yu
To observe the morphologic characters and the expression of vimentin on human lens epithelial cells (hLECs) cultured on laminin and fibronectin. METHODS: The primary and secondary hLECs were cultured on plates treated with laminin or fibronectin. The feature of hLECS was observed and recorded using an inverse microscope with digital camera and statistical analysis was applied. MTT assay was used to show the growth curve of subcultured cells (the 3^rd passage). Immunofluorescent staining was used to demonstrate the morphologic change in vimentin expression in the 3^rd passaged hLECs. RESULTS: The hLECs in laminin or fibronectin group grew out significantly earlier than the untreated group. The cells could be subcultured fluendly in those two treated groups, while only a few survival cells were found in the untreated group. But the hLECs could undergo apoptosis in laminin group at the terminal phase of their life cycle, while lentoid bodies emerged in fibronectin treated group. There were more viable cells in the fibronectin group from the 4^th to the 7^th day by MTT reaction. Immunofluorescent staining showed a clear morphological difference between the two groups. CONCLUSION: Laminin provide a suitable growth microenvironment for the hLECs while fibronectin promotes the cells proliferation and differentiation.

COX-2 and its inhibitor Celecoxib in corneal neovascularization

Yuan Dong and Ming-Chang Zhang
To observe the expression of COX-2 in rat corneal neovascularization (CNV) and its relationship to CNV, and to explore the inhibition of Celecoxib, a COX-2 inhibitor, to CNV. · METHODS: The distribution and quantification of COX-2 and VEGF was detected by immunohistochemistry. Expression of COX-2 and VEGF mRNA was quantified by RT-PCR. The difference in protein and mRNA expressions of COX-2 and VEGF was analyzed to find the correlation between them. · RESULTS: Expression of activated COX-2 and VEGF protein and mRNA in CNV had a dynamic change. VEGF and COX-2 co-localized. Compared with the control group, expression of both protein, mRNA of COX-2 and VEGF in experimental group II and III had significant difference(P <0.05),indicating the correlation between COX-2 and VEGF, while that in experimental group I had no statistical difference (P >0.05). · CONCLUSION: COX-2 expression was up-regulated in inflammatory CNV. COX-2 modulates the expression of VEGF, playing a very important role in CNV. Celecoxib inhibit COX-2 expression so as to hold back the CNV.

PCNA, Bcl-2 and TERT expression in epiretinal membrane of rat traumatic proliferative vitreore- tinopathy

Li-Ping Xue,Feng-Ying Kang,Shi-Xing Hu,Xin-Guo Deng and Shao-Chun Lin
To explore the dynamic expression and correlation among telomerase catalytic subunit (TERT), proliferating cell nuclear antigen（PCNA）and antiapoptosis protein Bcl-2 which relate to cell proliferation in epiretinal membrane （ERM）of rat traumatic proliferative vitreoretinopathy (PVR). · METHODS: S-P technique was applied for immunohisto- chemical staining of ERM of traumatic PVR with TERT, PCNA and Bcl-2 antibody. HE staining was also carried out. The staining results were analyzed with image analysis system. · RESULTS: The positive rate and average A of PCNA protein were up regulated at first and then down regulated, with the peak value in 14 days Group, which was significantly different from those in 7 days Group and 28 days Group. The positive rate and average A of TERT and Bcl-2 were also up regulated at first and then down regulated, with the peak value in 14 days Group and 21 days Group, which were significantly different from those in 7 days Group. There was significant correlation among PCNA, Bcl-2 and TERT protein expression (P ≤0.01). · CONCLUSION: TERT and Bcl-2 take part in the regulation of proliferative cells in ERM of traumatic PVR, with high correlation with the dynamic changes of cell proliferation.

Expression of subretinal fluid hepatocyte growth factor and proliferative vitreoretinopathy

Hai-Lan Liao and Jian-Chu Wei
To explore the role that hepatocyte growth factor (HGF) plays in proliferative vitreoretinopathy (PVR) after retinal detachment（RD）. · METHODS: The contents of HGF in subretinal fluid (SRF) in 49 cases with RD were measured with enzyme-linked immunosorbent assay. · RESULTS: With the worsening of PVR and vitreous opacity and prolonging of disease course, the contents of HGF increased ，P <0.05 was considered statistically significant. · CONCLUSION: The change of HGF in SRF had a close relationship with the occurrence and development of PVR after RD.

Sequential changes of HIF-1α protein and mRNA in hypoxic bovine retinal microvessel endothelial cell

Ai-Jun Deng and De-Yong Jiang
To investigate the sequential changes of HIF-1α protein and mRNA in hypoxic bovine retinal microvessel endothelial cells. METHODS: The bovine retinal microvessel endothelial cells were cultured in normoxic and CoCl₂-induced hypoxic conditions respectively. Expressions of HIF-1α protein were measured with immunohistochemical staining, and RT-PCR was used to determine the HIF-1α mRNA. RESULTS: HIF-1α began to increase 1 hour after hypoxia, and reached the peak at 4 hour. After 16 hours, it declined significantly. Compared with the normoxic group, the expression of HIF-1α protein in the hypoxic groups had significant difference (P <0.01), and HIF-1α mRNA expression was unchanged under hypoxia. CONCLUSION: HIF-1α participates in the hypoxic procedures in retinal microvessel endothelial cells, and hypoxia induce time-dependent changes of HIF-1 α protein expression, which is not modulated on the transcription level. Analysis of HIF-1 α expression revealed a temporal and spatial changes with regard to the hyperoxic repression, indicating that HIF-1 may play a major role in the development of retinopathy of prematurity(ROP) and other ischemic retinal disorders such as diabetic retinopathy(DR).

Neuroprotective effect of Erigeron Breviscapus (vant) Hand -Mazz on NMDA -induced retinal neuron injury in rats

Jing-Ming Shi,You-Qin Jiang and Xu-Yang Liu
To investigate whether Erigeron Breviscapus (vant) Hand-Mazz (EBHM) has neuroprotective effect against N-methyl-D-aspartate (NMDA)-induced neuron death in retinal ganglion cell layer (RGCL). · METHODS: Sixty healthy SD rats were randomly divided into four groups. 6 animals were normal control group (group A). The others were divided as group B (EBHM group), group C (normal saline+NMDA group) and group D(EBHM + NMDA group), each group had 18 rats. 10nmol NMDA was intravitreally injected to induce partial damage of the neurons in RGCL in the right eyes of Groups C and D. Same volume PBS was intravitreally injected into the left eyes as self-control. Groups B and D were pretreated intraperitoneally with 6g/L EBHM solution at a dose of 150mg/kg body weight/day seven days before and after NMDA treatment. Group C were administrated intraperitoneally with 9g/L normal saline at the same time of EBHM injection. Rats were sacrificed at 4,7,14 day after NMDA treatment. Flat whole retinas were stained with 5g/L cresyl violet and neuron counting in RGCL from both eyes were observed. Each subgroup had 6 rats. · RESULTS: There was no significant difference of neuron counting in RGCL between the right eye and the left eye in group A. There was no significant difference between normal control group and EBHM group either in the right eyes or in the left eyes at 4, 7 and 14 day respectively after intravitreal injection of 10nmol NMDA in group C and group D. (P = 0.636, P =0.193). Neuron counting of RGCL in group C and D was significantly decreased in the NMDA- treated eyes 4, 7 and 14 days after intravitreal injection (P < 0.001). There was no significant difference between self-control eyes group and normal control group. However, neuron counting was significantly higher in the EBHM+NMDA group than normal saline +NMDA group 14 days after intravitreal injection (P = 0.044), but lower than normal control group (P <0.05). · CONCLUSION: EBHM has no effect on neuron counting of RGCL when administered alone in normal rats. The results indicate that EBHM plays a partial protective role in NMDA-induced neuron loss in RGCL in rats.

Inhibition of proliferation of retinal microvascular endothelial cells by pericytes through down-regulating KDR/Flk-1 in a co-culture system

Ying-Li Wang,Yan-Nian Hui,Bin Guo,Xiao-Guang Zhang,Xu Hou and Ji-Xian Ma
To investigate the role of pericytes in growth of retinal microvascular endothelial cells(RMECs) in a co-culture system in order to understand some mechanism of angiogenesis in hypoxia induced retinal neovascular disorders. · METHODS: RMECs were isolated by a modified protocol using CD31 coated Dynabeads, and identified by immunocytochemical staining with anti-Factor VIII and CD31 antibodies. Rat retinal pericytes were isolated and characterized by immunofluorescent staining with PDGFR-β; and desmin antibodies. Pericytes and RMECs were cultured in a contact co-culture system both under normoxia and hypoxia by Millicell chamber. RMECs proliferation was evaluated by MTT and cell cycle assay with flow cytometry. RT-PCR was used to detect the alteration of KDR/Flk-1 mRNA level in RMECs under normoxia or hypoxia in the co-culture system. · RESULTS: Highly pured rat RMECs and pericytes were harvested with the modified isolating method. The two cell types were identified by positive Factor VIII, CD31 and PDGFR-β, desmin cytochemical staining respectively. RMECs proliferated significantly under hypoxia from 3 to 9 day with a maximal rate on day 6 (24.9%, P < 0.01) by MTT. In the co-culture system, the proliferation of RMECs was inhibited by pericytes. After 6 days exposure to hypoxia, the fraction of S-phase RMECs number was greatly increased by 43.9%(P < 0.01). In the co-culture system, RMECs proliferation was inhibited by pericytes through decreasing the fraction of S-phase cell number both under normoxia (3.6%, P <0.05) and under hypoxia (15.1%,P <0.01). KDR/Flk-1 mRNA level in single cultured RMECs was shown to increase approximately 1.3-fold when exposed to hypoxia. Compared with single cultured RMECs, co-culture with pericytes could decrease KDR/Flk-1 mRNA by 45.1% (P <0.05) and 27.7% (P <0.05) under normoxia and hypoxia condition respectively. · CONCLUSION: The present study demonstrated that pericytes could inhibit proliferation of RMECs under both normoxia and hypoxia. The inhibition effects of pericytes maybe, at least in part, due to downregulation of KDR/Flk-1 of RMECs. These findings confirm that pericytes could be a potential inhibitor in the pathogenesis of retinal neovascularization(RNV).

The inhibitory effect of triamcinolone acetonide on the proliferation of monkey choroid-retinal endothelial cells in hypoxia condition
To observe the inhibitory effect of triamcinolone acetonide (TA) on the proliferation of monkey choroid- retinal endothelial cells (RF/6A) in hypoxia or normal conditions. · METHODS: TA was added into the cultured RF/6A of rhesus monkey. The effect of TA on the cellular activity was observed by MTT, the effect on cellular proliferation and apoptosis was detected by flow cytometry (FCM). · RESULTS: The numbers of cells in s-phase of a cell cycle were reduced and the proportion of cells in G2-M phase was increased under the hypoxia condition. TA had a great effect on the cell cycle of RF/6A of rhesus monkey and it induced apoptosis of endothelial cells. It relatively increased the s-phase cells and reduced G2-M phase cells under both normal and hypoxia conditions, which indicates its role in blocking cell cycle from s-phase to G2-M phase and reducing mitosis. · CONCLUSION: Hypoxia promotes the proliferation of RF/6A cells while TA has the opposite effect in both normal and hypoxia conditions. TA can also induce apoptosis of endothelial cells.

A new method of duplication of the chronic intraocular hypertension model: underwater electrocoagulation

Hong-Bin Lü,Yan Li,Yuan-Sheng Yuan and Qing-Li Luo
To study the experimental method of inducing the chronic intraocular hypertension in rat eyes. · METHODS: Twenty Wistar rats were randomly divided into ocular hypertension and sham control groups. Intraocular pressure (IOP) was raised by electrocoagulating at least 3 episcleral and limbal veins on the right eye of each rat in ocular hypertension group and its contralateral eye was used as control. At 1, 2, 3, 4 and 8 week after the electrocoagulation of the veins, IOP were measured. · RESULTS: The treatment of electrocoagulation caused a significant IOP increase of the right eyes over the baseline, over the contralateral eyes, and over the sham control eyes (repeated measures ANOVA, P <0.001). At 1 week, IOP was 30.12±5.18mmHg, and maintained the high IOP up to 8 weeks. · CONCLUSION: The chronic intraocular hypertension model could be successfully created by electrocoagulating three or more episcleral and limbal veins.

Inhibitory effect of Meloxicam on the cultured fibroblasts from the excised pterygium

Li-Na Huang and Xiao-Ming Yao
To investigate the association between cycloxygenase-2　(COX-2) expression and vascular endothelial growth factor (VEGF) intervention as well as the inhibitory effect of Meloxicam on the cultured human pterygium fibroblasts (HPF). · METHODS: Expression of COX-2 was measured by immun- ohistochemistry in the cultured HPF from twenty excised pterygium cases. Expression of COX-2 in HPF was measured by Western blot following the treatment of VEGF at different concentrations. In addition, the effect of Meloxicam on proliferation of HPF was studied by adding different concentrations into the cultured HPF plates by Mono-nuclear cell direct cytotoxicity (MTT) reduction assay. · RESULTS: COX-2 expression was present in the cultured HPF. The level of the expression increased following VEGF treatment. The proliferation of the cultured HPF decreased following the addition of different concentrations of Meloxicam (from 75μmol/L to 300μmol/L) and the magnitude of the inhibition was dose-time dependent. · CONCLUSION: COX-2 levels in the cultured HPF were positively associated with VEGF stimulation and Meloxicam was inhibitory to HPF proliferation.

Anti cataract potential of phyllanthus niruri in galactose induced cataractogenesis of rat
AIM: To evaluate anti cataract effect of phyllanthus niruri (PN) both in vitro and in vino galactose induced cataract. METHODS: Aqueous extract of PN was evaluated against galactose-induced cataract both in vitro and in vivo. Galactosaemic cataract was induced in rats by feeding 300g/L galactose diet. PN was administered orally at three-dose levels 75, 150 and 300mg/kg of body weight. Rat lenses were subjected to osmotic stress in vitro by incorporating galactose (30mmol/L) in the culture medium. The effect of PN (720 and 880ug/mL) on the glutathione (GSH) and polyols levels was studied. RESULTS: PN significantly delayed the onset and progression of cataract in vivo. In addition to the delay in reaching various stages of development of cataract, stage IV did not develop with lower doses till the completion of experimental period. Lenses treated with PN 880ug/mL concentration showed higher levels of GSH and decreased levels of polyols in vitro.In vivo , 75mg/kg significantly delayed the onset and progression of cataract as compared to control. CONCLUSION: Phyllanthus niruri delays the process of cataracto-genesis in the experimental models. However, further study is required to extrapolate the use in human beings for the prevention of cataract.

Gel and porous polyethylene implants for anophthalmic cavity reconstruction-evaluation using the B scan ultrasound
AIM: To evaluate the host response of the gel and porous polyethylene implants in anophthalmic cavities using the B scan ultrasound. METHODS: Thirty-six white rabbits underwent unilateral enucleation with placement of gel or porous polyethylene spheres implants. The animals were submitted to clinical examination weekly and to ultrasound evaluation on 30, 60 and 90 days after surgery. RESULTS: All rabbits with gel polyethylene spheres, except one, showed implant extrusion probably because the gel spheres have hydrated and increased in volume. The B ultrasound of the gel polyethylene implant did not show vessels inside during the following period. Five animals (27.8%) with porous polyethylene spheres presented implant extrusion after 30 days of surgery. According to B ultrasound, the porous polyethylene implant showed irregular and heterogeneous architecture and reflective peaks similar to vascularized tissues. CONCLUSION: More studies are required to determine the ideal volume of gel polyethylene implant necessary to correct the diminished orbital content in the anophthalmic cavity. The B ultrasound effectiveness showed in this study for anophthalmic socket implants evaluation provides useful information for further in vivo studies and might substitute expensive methods of implants vascularization evaluation.

Inhibitory effect of captopril on retinal neovascularization in mice

Yu Di and xiao-Long Chen
AIM: To study the inhibitory effect of captopril on retinal neovascularization (RNV). METHODS: Sixty seven-day-old mice were randomly divided into treated group and control group with thirty mice in each group. These mice were exposed to 750 ± 50mL/L oxygen for 5 days and then to room air. The treated group had been injected captopril (2.7mL/kg), while control group had been injected 9g/L sodium chloride (2.7mL/kg) by intravitreal for 5 days. The mice were sacrificed at the 17th day after birth and the eyes were enucleated. Adenosine diphosphate-ase (ADPase) stained retina flat-mounts was performed to assess the retinal vascular profiles, Hematoxylin Eosin (HE) staining method was applied to count the number of new vascular cell nuclei and the expression of matrix metalloproteinase-2 (MMP-2) and pigment epithelium derived factor (PEDF) was detected by immunohistochemical method. · RESULTS: Comparing with control group, regular distributions, good branch and reduced density of RNV were observed in the treated group. The number of nucleus of new vessels vascular endothelial cells breaking through the internal limiting membrane was less in the treated group than in the control group ( <0.05). Stain of retinal MMP-2 was weaker in the treated group than in the control group and stain of retinal PEDF was stronger in the treated group than in the control group. CONCLUSION: Intravitreal injection of captopril (2.7mL/kg) may block the RNV in the oxygen-induced mouse model and the method may provide an effective method for preventing RNV.

Effect of fetal bovine serum on the proliferation and differentiation of murine corneal epithelial cells in vitro

Xiao-Li Ma,Yan-Hong Que,Jun Kong,Han-Qing Liu and Jin-Song Zhang
AIM: To investigate the effect of fetal bovine serum (FBS) on the proliferation and differentiation of murine corneal epithelial cells in vitro . METHODS: Mouse corneal epithelial cells (MCEs) were cultured in serum-free low-Ca²⁺ medium (KSFM) and KSFM supplemented with 100mL/L FBS, respectively. Population doublings (PDs) were determined. The expressions of corneal epithelial cell markers p63, keratin 19 (K19) and involucrin were investigated by RT-PCR and Western blotting analyses. RESULTS: Cells in KSFM were stably subcultured over 25 passages; however, none of the cell lines could pass P3 in KSFM with FBS. In KSFM, the cells showed typical cobblestone appearance and expressed p63, K19 and involucrin. After medium was supplemented with FBS, cells became homogeneous, large and squamous. Furthermore, both RT-PCR and Western blotting analyses showed that the expression of involucrin was increased significantly. CONCLUSION: FBS has effects of inhibiting proliferation and triggering differentiation of MCEs.

Quantitative detection of the expression level of transforming growth factor -βand its receptors in pterygium with RT- PCR

Ming Zhong,Wei Shen,Qing Fu and Yuan Zhang
AIM: To quantitatively investigate transforming growth factor-β (TGF-β ) and its receptors in normal bulbar conjunctival tissues and pterygiumtissues. · METHODS: Thirty cases of pterygium patients were randomly selected to undergo surgical resection of pterygium lesion, and the normal margin of bulbar conjunctival tissues were collected as control. Gene expression was detected quantitatively by the method of quantitative real-time PCR (QRT-PCR) analysis. ·RESULTS: The expression level of TGF-β 1 and TGF-β 2 was 4.26×10^-7±1.45×10-7 and 1.08×10^-10±0.68×10^-10 in normal bulbar conjunctival tissues, while 10.67 ×10^-7 ±7.47 ×10-7 and 8.23 ×10^-11 ±6.63 ×10^-11 in pterygium tissues. The expression level of TGF-β RI and TGF-β RII was 0.003015±0.0036 and 5.33 ×10^-5 ±5.05 ×10^-5 in normal bulbar conjunctival tissues, while 0.000379 ±0.000281 and 1.002 ×10^-5 ±9.04 ×10^-6 in pterygium tissues. The expression level of TGF-β 1 and TGF-β 2 in pterygium was elevated ( P<0.01). TGF-β 1 expression level in pterygium increase 2.9±2.8 times than in normal conjunctiva. TGF-β 2 expression level in pterygium increase 7.5 ±1.4 times than in normal conjunctiva. The expression level of TGF-β RI in pterygium was significantly lower ( P<0.05). The expression level of TGF-β RII in pterygiumwas significantly lower (P<0.01). ·CONCLUSION: QRT-PCR is an effective method to quantitatively detect gene expression in eye. The upregulation of TGF-β 1 and TGF-β 2 and down-regulation of their receptors expression may play an important role in the pathogenesis of pterygium, which is noteworthy further investigation in diagnosis and treatment of pterygium."

N -acetylcysteine and Taurine inhibit hyperoxia - induced cataract in rabbit lens

Ping Wang,Xiao-Cui Liu,Ming-Yong Li and Hong Yan
AIM: To investigate the efficacy of N-acetylcysteine (NAC) and Taurine (Tau) in preventing hyperoxia-induced the lens opacification and the changes of biochemical parameters on organ cultured rabbit lenses. METHODS: Twenty-four lenses from adult rabbits were divided into the control group, the hyperoxia-exposed group, the hyperoxia-exposed group containing 20mmol/L of NAC, the hyperoxia-exposed group containing 80mmol/L of Tau, respectively. The treated groups incubated with hyperoxia (PO² >80%) for 4 hours per day throughout a 7-day period. Lens transparency, histology and enzymatic activities measurements were determined after this incubation. RESULTS: Gross morphological examination of these lenses revealed some severe cortical opacification in the hyperoxia-exposed group, moderate cortical opacification in the control group and the Tau treated group. There was minimal cortical opacification in the NAC treated group. The glutathione (GSH) content and the activity of Na, K-ATPase were significantly decreased in the hyperoxia-exposed group than that of the control group, by 37.8% ( P<0.05) and 53.5% ( P<0.05), respectively. However, they were increased in the two treated groups, especially in the NAC treated group. There were no significant differences in the water-soluble protein content and the catalase and GSH reductase activities in all group lenses. CONCLUSION: Hyperoxia can induce the cortical opacification in the lens. The role of NAC in the prevention of hyperoxia-induced cataract is superior to Tau.

Implantation of modified poly 2 -hydroxyethy methacrylate -Polymethyl methacrylate Keratopro - stheses in rabbit and monkey corneas

Ping Guo,Jia-Qi Chen,Li-Na Huang,Zheng Wang,Zhi-Chong Wang and Dan-Yao Nie
AIM: To investigate the bio-colonization of poly 2-hydroxyethy methacrylate (PHEMA) sponge with cornea tissue and evaluate the therapeutic effects of modified porous poly 2-hydroxyethy methacrylate-Polymethyl methacrylate (PHEMA-PMMA) Keratoprostheses (KPro) on rabbit and monkey corneas. METHODS: The KPro were made using two-stage polymerization combined with mechanical cutting. The experiments were divided into two groups. In the control group, ten normal rabbit eyes received lamellar implantation of PHEMA sponges. The sponges were obtained 2 weeks, 1, 2, 3 and 4 months after operation. The cell proliferation and neovascularization inside the sponges were observed using light and transmission electron microscopy (TEM) and immunohistochemistry. In the experimental group, the porous PHEMA-PMMA KPros were inserted into the lamellar pockets of eight rabbit corneas and two monkey corneas (stage I operation). The healing process was investigated by slit-lamp microscopy. The anterior lamellar cornea tissues were removed 3 months after surgery, exposing the underneath transparent core (stage II operation). The operated eyes were then followed up for 3-6 months. RESULTS: No complications were observed in the control group. Under the light microscope, fibroblasts started to grow into the cornea 2 weeks after operation; lots of cells, accompanied with new blood vessels, invaded into the cornea 2-3 months after surgery. Invading cells of sponge, as well as keratocytes, were positive for vimentin. Under the electron microscope, the invading cells looked healthy and were surrounded by extracellular matrix and collagen. In eight rabbit eyes which received KPro implantation, anterior lamellar cornea melting happened in two eyes after the stage II operation. The remaining six corneas retained their central cores during observation after the stage II operation. Two operated monkey eyes were found no complication throughout the whole follow-up. CONCLUSION: The PHEMA sponge can obtain a tight fusion with the host cornea. The modified PHEMA-PMMA KPros have obtained relatively stable results after implantation into animal corneas. "

Quantitative detection of the expression level of transforming growth factor -β1 and -β2 in rat retina with real time PCR

Wei Shen and Lin Liu
AIM: To quantitatively detect the expression level of transforming growth factor-β1 (TGF-β1) and transforming growth factor-β2 (TGF-β2) genes in the retina of normal rat in order to determine the expression difference of TGF-β1 and TGF-β2 in retina. METHODS: The total RNA was isolated from which the first strand of cDNA was prepared. The mRNA levels of TGF-β1 and TGF-β2 were detected quantitatively by real time polymerase chain reaction (PCR). RESULTS: The mRNA levels of TGF-β1 and TGF-β2 were 0.0008±0.0003 and 0.0378±0.009, respectively. Expression of TGF-β2 was obviously higher than that of TGF-β1 in rat retina with statistical significance (t =12.37, P <0.001).The ratio of TGF-β2/TGF-β1 was 55.00±26.61. CONCLUSION: Quantitative reverse transcription polymerase chain reaction (QRT-PCR) can specifically and accurately detect gene expression level in rat retina. In retina the TGF-β2 gene is expressed more abundantly than TGF-β1. It is suggested that TGF-β2 play an important role in retina diseases.

Effects of naringenin on ocular blood flow and choroidal neovascularization in experimental animals

Jie Ji,Xin-Rong Xu and George C Y Chiou
AIM: To investigate the effects of naringenin on laser- induced experimental choroidal neovascularization (CNV) in rat models, ocular blood flow and retinal function recovery after ischemic insults in rat eyes. METHODS: Male Brown Norway rats were treated to break the Bruch's membrane. Naringenin 10g/L (20mg/kg) was given once per day through intraperitoneal injection for 4 weeks after laser treatment. The development of CNV was determined by fluorescein angiography (FA) performed on week 2 and 4. The colored microsphere technique and electroretinography method were used for the study of ocular blood flow and retinal function recovery, respectively. RESULTS: The choroidal blood flow in elevated intraocular pressure (IOP) rabbit eyes was significantly increased by 10g/L naringenin solution as compared to control group (P < 0.05). The retinal function recovery after ischemic insults in rat eyes indicated significant increase of b-wave recovery in treated group, as compared to control group (P <0.05). The intensity of fluorescein leakage from the photocoagulated lesions significantly decreased in treated group, compared to the control group (75.8%-95.0%, P <0.01). CONCLUSION: Naringenin could prevent the development of CNV on laser-induced experimental rat models, increase the choroidal blood flow in elevated IOP rabbit eyes and be beneficial on retinal function recovery in ischemic rat eyes.

Effects of hydralazine on ocular blood flow and laser-induced choroidal neovascularization

Wei Jiang and George C Y Chiou
AIM: To investigate the effect of hydralazine on choroidal blood flow in rabbits and laser-induced choroidal neovascularization (CNV) in rats and on tube formation of human umbilical vein endothelial cells (HUVEC). METHODS: Female New Zealand white rabbits were used with raised intraocular pressure (IOP) of the left eye to 40mmHg. Hydralazine (10g/L) eye drops were instilled and ocular blood flow was measured with colored microspheres technique. Male Brown Norway rats were treated with Nd:YAG laser to break Bruch's membrane. Hydralazine (5, 10, 20g/L) eye drops or saline alone was instilled three times a day for 4 weeks after laser treatment. Fluorescein angiography (FA) and choroidal flat mount were used to measure the area of CNV. Tube formation of HUVEC was studied at different concentrations of hydralazine. RESULTS: With raised IOP to 40mmHg on rabbits, 10g/L hydralazine eye drops enhanced the choroidal blood flow significantly at 30 and 60 minutes after drug instillation. After 4 weeks of drug treatment, 5, 10 and 20g/L hydralazine eye drops all reduced the CNV formation dramatically measured by fluorescein angiography and choroidal flat mount. When HUVEC was cultured on matrix gel for 48 hours, the tube formation of HUVEC were prevented.by hydralazine at 3-30mg /L. CONCLUSION: Hydralazine prevents CNV formation in vivo and HUVEC tube formation in vitro, and enhances rabbits' choroidal blood flow after ischemia. It is hoped that hydralazine could be used to treat age-related macular degeneration in the future.

Preliminary findings of immunological characteristics in primary human corneal endothelial cells

Fan Wang,Bai-Lin Song and Hong-Yang Guo
AIM: To evaluate the function of primary human corneal endothelial cells (HCEC) serving as immunological cells. METHODS: Expression of HLA-DP, -DQ, -DR, CD40, CD80, and CD86 was determined by immunohistochemical methods. Meanwhile, purified peripheral blood mononuclear cells(PBMC) were cocultured with primary HCEC which were pre-treated with and without γ -IFN respectively. The activation of lymphocytes was determined by FACS analysis. RESULTS: In coculture system, T lymphocyte was activated by primary HCEC, HLA-DP, -DQ, -DR and CD40 expression were increased by γ -IFN induction. Costimulatory molecular CD80 was shown on the endothelial cells. CONCLUSION: Primary HCEC are assumed to be involved in the corneal transplantation rejection process as potential antigen presenting cells (APC).

Optimization of culture medium for primary retinal pigment epithelium cells and investigation of medium effects on growth factor expression

Li-Na Hao,Shou-Zhi He,Zhi-Yang Jia,Ge Wang and Su-Ting Dong
AIM: To optimize the conditions for in vitro culture of retinal pigment epithelium (RPE) cells, we characterized expressions of various growth factors in RPE cells, including tumor necrosis factor (TNF-α), vascular endothelial growth factor (VEGF), β fibroblast growth factor (βFGF), transforming growth factor β2 (TGFβ2), and interferon-γ (IFN-γ). We also studied expressions of caspase-3 under different concentrations of fetal bovine serum (FBS) with insulin- transferrin-sodium selenite (ITS) supplement. METHODS: First, we investigated if the expressions of TNF-α, VEGF, βFGF, TGFβ2, IFN-γ, and caspase-3 in FBS and ITS with of concentration. Second, we cultured primary RPE cells from eyes of forty C57 BL/6 mice in standard dulbecco's modified eagle's medium (DMEM) containing 20, 40, 100mL/L FBS and 20, 40, 100mL/L FBS together with 10g/L ITS. Immunohistochemical staining and cell counting were performed to verify the existence and growth condition of RPE cells. The expressions of TNF-α, VEGF, βFGF, TGFβ2 and IFN-γ were determined using cells and supernatant from passage-3 to -4 primary RPE cell after 48 hours of culture with RT-PCR and enzyme-linked immunosorbent assays (ELISA). The expression of casepase-3 was determined via Western blotting. The major outcome measurement was the expression level of growth factors in cultured RPE cells and the experiment design was to expose the RPE cells to different culture medium. RESULTS: TNF-α, VEGF, βFGF, TGFβ2, but not IFN-γ, were expressed and the expressions increased with concentration. No expression of the aforementioned genes was detected in presence of ITS. The primary cultures of RPE cells were successfully established. TNF-α, VEGF, βFGF, TGFβ2 (but no IFN-γ) and the active caspase-3 were detected in 20, 40, 100mL/L FBS or 20, 40, 100mL/L FBS combined with 10g/L ITS; the expressions were upregulated with increasing concentration of FBS. There was no significant difference in the expression of growth factors between these groups. However, significant differences were shown among different concentration of FBS (P＜0.01). The lowest expression was observed in 20mL/L FBS or 20mL/L FBS combined with 10g/L ITS medium with RPE cells. But RPE cells were shown in better growth condition in 20mL/L FBS combined with 10g/L ITS. CONCLUSION: TNF-α, VEGF, βFGF, TGFβ2 and caspase-3 are expressed in RPE cells and supernatants. The production of above 20mL/L FBS combined with 10g/L ITS in DMEM may be the ideal cell culture medium that supports the normal growth of RPE cells.

Injection of tissue plasminogen activator into the optic nerve in an animal model of retinal vein occlusion

Cai-Hui Jiang,Mao-Nian Zhang and Motohiro Kamei
AIM: To investigate the feasibility and efficacy of tissue plasminogen activator (tPA) injection into the optic nerve as a treatment for retinal vein occlusion in rabbits. METHODS: Rose Bengal-mediated laser-induced retinal vein occlusions were produced in rabbit eyes. Fluorescein angiography (FA) was performed on each eye 3 days before laser irradiation and 30 minutes after laser irradiation. The treatment group (n =20 veins) received intra-optic nerve injection of tPA (12.5μg in 0.05mL BSS) and the controls (n = 24 veins) received 0.05mL BSS. FA was repeated to determine the recanalization of the vessel at 3 and 7 days after treatment, followed by histological examination. RESULTS: Rose Bengal-mediated laser-induced retinal vein occlusions were successfully developed and confirmed by FA. The incidence of the recanalization of the vessels in treatment animals was 70.0%, while 16.7% in the control animals (P = 0.001). CONCLUSION: Intra-optic nerve tPA injection increases the incidence of recanalization of the occluded vessels. Although further studies are needed, our data suggested that injection of tPA into the optic nerve may have a potential benefit in the treatment of central retinal vein occlusion.

Electrophysiological evaluation of the safety of injection of tissue plasminogen activator into optic nerve in rabbits

Cai-Hui Jiang,Mao-Nian Zhang,Mihoko Suzuki and Motohiro Kamei
AIM: To investigate the safety of tissue plasminogen activator (tPA) intra optic nerve injection in rabbits. METHODS: Group 1 and 2 (6 eyes in each group) received injection of tPA 25μg and 12.5μg in 0.1mL balanced saline solution (BSS). Group 3 (6 eyes) received injection of 0.1mL BSS. Six eyes in Group 4 as a normal control received no injection. The eyes were examined with slit lamp biomicroscope, indirect ophthalmoscope, visual evoked potentials (VEP) and electroretinography (ERG) at 1, 3, 7, 14 and 28 days after injection. RESULTS: No evidence of optic nerve or retinal toxicity or physical damage were revealed by ophthalmoscopy, VEP, and ERGs after the injection of tPA into the optic nerve. The means of the latency of the first peak of the VEP were 24.6±1.5, 24.1±1.9, 24.0±2.0 and 24.6±1.3mS respectively for the above specified groups (P =0.4112). The means of the amplitude of the first peak of the VEPs were 124±42, 145±41, 132±48 and 117±29μV respectively (P =0.0649). The means of the latency of a-waves were 6.0±0.4, 5.9±0.4, 5.9±0.5 and 5.8±0.3mS respectively (P =0.6279). The means of the amplitude of a-waves were 110±14, 112±15, 110±16 and 108?1μV respectively (P =0.7248). The means of the amplitude of b-waves were 151±12, 148±14, 144±16 and 141?0μV respectively (P =0.0957). CONCLUSION: Injection of tPA upto 25μg in 0.1mL into optic nerve is well tolerated.

Neovascularization profile in rat allogenic penetrating keratoplasty

Yan Zhang,Xiao-He Lu and Xiang Li
AIM: To observe the neovascularization process with no intervention in rat allogenic penetrating keratoplasty. METHODS: Allogenic penetrating keratoplasties were successfully performed in 34 female SPF SD rats with no intervention after operations. Corneal neovascularization (CNV) process was noted on day 4, 7, 15 and 30 with operating microscope. The vascular area surface was calculated using the formula C /12×3.14×[r ²-(r -I )²]. RESULTS: CNV was noted in 29 out of 34 rats (85%). Firstly, the new vessels distributed around the cornea like a brush then gradually extended towards the center. The vessels were distorted and massive with branched tails, they continued growing to reticulated veins in peak time then gradually atrophied. The average neovascularization area (SE) on day 4, 7, 15 and 30 was 11.8±3.5mm², 18.5±4.0mm²,14.4±4.3mm² and 6.0±1.8mm², respectively and 12.7±1.9mm² in total. The average percentage that new vessels accounting the whole cornea area (SE) was 30.8%±8.7%, 65.3%±12.8%, 59.4%±14.5%,36.2%±10.9% and 48.7%±6.4% in total. CONCLUSION: In rat allogenic penetrating keratoplasties without intervention, CNV presents on day 4 and reaches the maximum area on day 7. Then the vessels gradually atrophies, about 50% of the maximum area still remains on day 30.

Comparison of IOL master and ultrasound biomi - croscopy in anterior chamber depth measurement

Wen-Kai Zhou,Xiao-Yan Li and Jin-Song Zhang
AIM: To compare the measurement of anterior chamber depth (ACD) inclusive of corneal thickness using intraocular lens (IOL) master and ultrasound biomicroscopy (UBM) and evaluate the repeatability of each method. METHODS: Two consecutive measurements of ACD were prospectively performed using IOL master and UBM in 60 eyes in 60 individuals. Mean values were compared using the paired t test. For each individual, ACD measurements was performed 5 times to estimate the repeatability of each method by a coefficient of variation (CV). RESULTS: The mean ACD was 2.95?.25mm with the IOL master and 2.96±0.22mm with the UBM. This difference was not statistically significant (P =0.631). The coefficient of variation (CV) was 0.56%±0.26% and 0.65%±0.36% in IOL master and UBM, respectively. CONCLUSION: The mean ACD of IOL master is the same as UBM. The repeatability of IOL master is better than UBM.

Effects of topical application of 5 -FU on the corneoscleral limbus of rabbits

Lucieni C B Ferraz,Silvana A Schellini and Mariangela E A Marques
AIM: To observe the effects of topical 5-fluorouracil (5-FU) application on the rabbits corneal limbus. METHODS: 5-FU was applied topically to the corneoscleral region of rabbits' eyes. The animals were sacrificed immediately or 7, 15, 30 and 60 days later, and tissues were submitted to histological examination. RESULTS: All animals presented corneoscleral deepithelization close to the site of application during the immediate postoperative period, whereas on the 4^th postoperative day ulceration was no longer present. Histological examination showed absence of epithelium and slight edema. After one week(G2), 2 animals presented epithelial defects, thickened epithelium with larger basal cells and loose chromatin, and slight subepithelial edema. The remaining groups showed no alterations. CONCLUSION: The 5-FU topically applied on the corneoscleral limbus postpones the epithelization.

Application of surface -enhanced laser desorption/ ionization time -of -flight -based serum proteomic array technique for the early diagnosis of retinoblas- toma
AIM: To find new biomarkers in the sera of retinoblastoma (Rb) patients with surface-enhanced laser desorption/ ionization time-of-flight mass spectrometry (SELDI-TOF-MS) and protein chip technique. METHODS: SELDI-TOF-MS, IMAC30 and CM10 protein chips were used to analyze the protein profiles from sera of 18 patients with Rb and 17 age-matched controls. The protein profiling was analyzed statistically by Ciphergen protein chip software 3.0.2. The Student's t -test was applied to compare the protein peak intensity. Fisher's exact test was used to compare the predominance of differential protein peaks appeared in patients. RESULTS: With IMAC30 protein chips, there were 26 proteins which appeared difference in sera of patients with Rb compared to normal children. Among them, 21 proteins, i.e. 7746, 7014, 11713, 3049, 7084, 7299, 5888, 2544, 12575, 5489, 9658, 9575, 9929, 10161, 8955, 1886, 10617, 6209, 2411, 7374, 6614m/z were up-regulated and 5 proteins, i.e. 8382,7923,7972, 8590, 66576m/z, were down-regulated (P < 0.01). Using the 7014m/z protein peak for statistical analysis, we could differentiate the patients with Rb from the healthy children with a sensitivity of 94.4% and a specificity of 82.4%. By CM10 protein chips, 4 proteins, including 3 up-regulated proteins (5888, 6097, 7798m/z) and 1 down-regulated protein (8590m/z), were detected in Rb patients (P <0.01). The sensitivity and specificity were 83.3% and 70.6% respectively when 7798m/z protein peak was selected for statistical analysis. CONCLUSION: There are a few candidates as Rb biomarkers in the sera of Rb patients. SELDI-TOF-MS protein chip technology could be a potential method in the clinical screening test of Rb.

Expression of transforming growth factor-β type I receptor and transforming growth factor-β type II receptor in rat retina

Wei Shen and Lin Liu
AIM: To quantitatively investigate the gene expression of transforming growth factor-β type I receptor (TβR I) and trans- forming growth factor-β type II receptor (TβR II) in rat retina. METHODS: Sprague-Dawley rats were chosen in this research. Gene expression was detected quantitatively by reverse transcription polymerase chain reaction (RT-PCR) analysis. RESULTS: The expression level of TβR I and TβR II were 0.00034±0.00013 and 0.0001±0.00005, respectively. The expression level of TβR I was obviously higher than that of TβR II in the rat retina with statistical significance (P <0.01). The ratio of TβR I /TβR II was 3.9±1.7. CONCLUSION: Real time quantitative RT-PCR is an effective method to detect differential expression genes in retina. The expression change of TβR I and TβR II may play an important role in the pathogenesis of retinopathy, which need further investigation on its significance in the development of proliferation retinopathy.

Experimental study on cervical lymph nodes removal enhance allograft survival in alkali-burned cornea

Shi-Qi Ling,Dao-Man Xiang,Shi-Yi Xiao and Hui Zhang
AIM: To explore the inhibitive effects of cervical lympha- denectomy on keratoplasy after alkaline burns. METHODS: The Wistar rats' corneas were transplanted into Sprague-Dawley (SD) rats' eyes which were randomly divided into 4 groups: group A (control group); group B, the cervical lymphadenectomy group; group C, corneal transplantation after the alkali burn injury; group D, cervical lymphaden- ectomy following group C. Out of 6 rats in each group, the cornea of one rat was used for macrophage immuno- histochemistry at day 14 after the transplantation, and the remaining 5 rats were used for studying corneal immune rejection with a slit lamp. The time when allograft rejection occurred was recorded and mean survival times (MST) were compared among the groups. RESULTS: Compared with the MST of group A (10.40±1.14 days),the MST of group B(46.30±9.46 days) was significantly longer (P <0.05). MST of grafts between group C (7.00±1.58 days) and group D (15.00±3.39 days) was also significant (P < 0.05). At 14^th day after the transplantation, there was no CD₆₈immunoreactivity in the graft of group B, and CD₆₈ proteins were expressed to some extent in the grafts of group A and D. However, in the graft of group C, the expression of proteins was dramatically up-regulated. CONCLUSION: Cervical lymphadenectomy therapy has a significant effect in preventing corneal allograft rejection in normal and alkali burned corneal beds.

Role of aquaporins -1 in corneal endothelial fluid transport

Li Zhang and Li Wang
AIM: To investigate the expression of aquaporins-1 (AQP-1) in cultured bovine corneal endothelial cells and to explore the role of AQP-1 in corneal endothelial fluid transport. METHODS: The bovine corneal cells were cultured in DMEM containing 200mL/L neonate bovine serum. AQP-1 expression in the bovine corneal endothelial cells was detected with immunohistochemistry method before and after treatment of the cells with aquaporin inhibitor,p -chloromercuribenzene sulfonate. The osmotic water permeability was determined by monitoring volume changes of cultured bovine corneal endothelial cells. RESULTS: Positive staining was used to reveal the AQP-1 expression in the membrane of cultured bovine (in brown color). The reading of osmotic water permeability of the cultured bovine corneal endothelial cells before treatment with p -chloromercuribenzene sulfonate was 0.044±0.005cm/s, which significantly decreased to 0.017±003cm/s after treatment (n =15). CONCLUSION: AQP-1 expressed in the membrane of cultured bovine corneal endothelial cells may play an important role in fluid transport of corneal endothelial cells. Alteration of the AQP-1 expression may cause abnormal corneal function and corneal edema.

Mechanism of angiostatin induced reduction of vascular leakage in retina and iris of rats with retinopathy of prematurity

Jing Sima,Jian-Xing Ma,Jiang Guo,Si-Si Luo and Hao-JiangYang
AIM: To study the effect of an intravitreal injection of angiostatin on vascular leakage in the retina and iris of oxygen-induced retinopathy of prematurity (ROP). METHODS: Brown Norway rats at postnatal day 7 (P7) were exposed to hyperoxia (750mL/L O₂) for 5 days (P7-12) and then returned to normoxia to induce retinopathy. Angiostatin was reconstituted in sterile Phosphate Buffered Saline (PBS) and diluted to desired different concentrations. Angiostatin solution was injected into the vitreous of the right eye of the ROP rats at P14 and the age-matched normal rats through pars plana using a glass capillary, and the left eye received the same volume of sterile PBS as the control. Vascular permeability was quantified at 1, 2 and 3 days after the injection by measuring albumin leakage from blood vessels into the retina and iris using the Evans blue method and normalized by total protein concentrations. The expression of vascular endothelial growth factor (VEGF) in retina was evaluated using the Western Blot analysis and immunohis- tochemistry 24 hours following the injection. RESULTS: ROP rats showed significant increases of vascular permeability in the retina and iris (P <0.01). Angiostatin reduces vascular permeability in a dose-dependent manner in the retina of ROP rats. The reduction showed a time course trend. Angiostatin injection reduced retinal vascular permeability by approximately 1.5 and 2-fold at P15 (P <0.05) and P16 (P < 0.01), respectively. Angiostatin injection significantly reduced VEGF levels in the retina of ROP rats but did not affect retinal VEGF levels in normal rats. CONCLUSION: Angiostatin significantly decreases patholog- ical vascular permeability in the retina and iris of ROP rats but not in normal rats. Angiostatin down-regulates VEGF expression in retina of ROP rats. These results suggest that angiostatin may have a therapeutic potential in the treatment of ROP and other diseases with vascular leakage.

Expression of junctional adhesion molecule -1 in human corneal epithelium

Li-Zhong Chen,Jing Hong,Nobuyuki Ebihara and Akira Murakami
AIM: To investigate the expression and distribution of junction adhesion molecule-1(JAM-1) in human corneal epithelium and compare with those of occludin. METHODS: The expression in RNAs of JAM-1 and occludin was revealed by RT-PCR and the presence of protein was analyzed by the FACS method. Double immunofluorescent staining was used to determine the tissue distribution of JAM-1 and occludin in human corneal epithelium. RESULTS: The expression of JAM-1 and occludin was found in cultured human corneal epithelial cells. The double immunofluorescent study showed positive staining for JAM-1 at cell borders in the entire epithelial layer, while relatively extensive staining was seen in the superficial layer, where it coexisted with the expression of occludin. CONCLUSION: JAM-1 is expressed in entire layer of human corneal epithelium encircling the cells.

Concomitant expression and combined localization of Ets-1 and VEGF in experimental diabetic rat's retina

Zhao-Jiang Du,Peng Li,Yan-Nian Hui,Bai-Ren Wang,Xiao-Li Duan and Rui Zhang
AIM: To investigate the characteristics of Ets-1 and VEGF expression and distribution in the experimental diabetic rat retina. METHODS: Diabetes was induced by intraperitoneal injection of streptozotocin (STZ). At 4 weeks after STZ-injection, animals were sacrificed. Total proteins were isolated from retinas of experimental eyes and control eyes and assessed by Western blot analysis. Frozen cross sections of eyeballs with 14μm thickness were used to perform double immunofluorescence staining with anti-Ets-1 and anti-VEGF antibodies. RESULTS: Both Ets-1 and VEGF expression were up-regulated in the diabetic retina, the distribution of Ets-1 and VEGF was identical to each other, and the two proteins were almost localized in all retinal layers. CONCLUSION: Ets-1 may contribute to the pathologic progress of the diabetic retina induced by VEGF.

HIF-1α expression and retinal cell apoptosis in rat retina ischemia-reperfusion injury

Wei Zhang,Ning-Ning Liu,Jian-Hua Xu and Zhe-Li Liu
AIM: To investigate the expression of hyporia inducing factor-1α (HIF-1α), apoptosis of retinal cells and the role of HIF-1α in apoptosis in rats’ retinal ischemia-reperfusion injury. METHODS: The rat model of experimental retinal ischemia- reperfusion injury was established by increasing the intraocular pressure to 110mmHg (1kPa =7.5mmHg) in rat eyes．At different time points of post ischemia, the expression of HIF-1α of the retina was detected by immunohistochemical staining, and the apoptosis of retinal cell was detected by terminal deoxynucleotidyl transferase mediated deoxyuridine triphosphatebiotin nick end labeling (TUNEL). RESULTS: HIF-1α appeared in the cells of retinal ganglion layer and inner nuclear layer at 2 hours after ischemia .The expression reached to a peak, 12 hours after retinal ischemia-reperfusion, then, the expression was declined. The apoptotic cells were mainly in inner nuclear layer and could be detected at the 12^th, 24^th and 48^th hour after ischemia, the peak value was the group of 24^th hour. CONCLUSION: The expression of HIF-1α in rats’ retina is greatly enhanced after ischemia-reperfusion, which may be involved in the retinal injury; the injury of retinal neurons occurs partly in the form of apoptosis. The expression of HIF-1α may play an important role in cell apoptosis.

Increased expression of Ets-1 in the diabetic retina of streptozotocin-induced rat model

Zhao-Jiang Du,Peng Li,Yan-Nian Hui,Bai-Ren Wang,Xiao-Li Duan and Rui Zhang
AIM: To determine the involvement of Ets-1 in the pathological progress of the experimental diabetic retina. METHODS: Diabetes was induced by intraperitoneal injection of STZ. Total RNA and total proteins were isolated from retinas of experimental and control eyes at 4 weeks after STZ-injection and were assessed by Northern blot analysis and Western blot analysis, respectively. RESULTS: Expression of both Ets-1 mRNA and Ets-1 protein was significantly increased in the experimental diabetic rat's retina after STZ-injection compared with the control group (P <0.001). CONCLUSION: Our results indicate that Ets-1 is involved in the pathological progress of experimental diabetic retina. Further studies should be conducted to focus on the relationship between Ets-1 and VEGF in the diabetic retina.

Expression of FLK-1 in laser-induced choroidal neovascularization in mouse

Han Zhang and Zhe-Li Liu
AIM: To investigate the expression of vascular endothelial growth factor receptor 2 (VEGFR-2, also known as FLK-1) in laser-induced choroidal neovascularization (CNV) in mouse. METHODS: CNV was induced in C57BL/6 mouse eyes by krypton laser photocoagulation. Choroidal fluorescein angiography and histopathological examination were used to assess the development of experimental CNV. Cryostat sections from lesions on day 10 after laser treatment and normal eyes were prepared for immunohistochemistry for FLK-1. RESULTS: Laser-induced CNV developed in all lesions on day 10. The expression of FLK-1 was detected in endothelial cells, retinal pigmented epithelium (RPE)-like cells and fibroblast-like cells in neovascular lesions. In normal adult mouse retinas, FLK-1 expression was mainly observed in RPE cells, inner nuclear and ganglion cell layers. CONCLUSION: Our findings demonstrate that expression of FLK-1 may play a role in the formation of laser-induced CNV in mice, which suggests that FLK-1 may be a promising potential target for antiangiogenesis therapy for CNV.

Effect of amniotic membrane transplantation on rabbit conjunctival surface reconstruction at the recovering stage of alkali burn

Jun Xu,Jiang-Yue Zhao,Rong Xin,Hong-Xue Wang,Yan-Chun Xu and Jin-Song Zhang
AIM: To investigate the effect of amniotic membrane transplantation(AMT) on rabbit conjunctival surface recon- struction with severe alkali burns.(2) To evaluate the possibility of AMT treatment for ocular alkali burns during recovering stage. METHODS: Animal models were established on 30 eyes of rabbits by creating severe alkali burns on the conjunctiva from the upper corneal limbus to the upper conjunctival fornix. Preserved human amniotic membrane transplantations and reconstruction of conjunctival fornix were performed at one week after injury (recovering stage). Epithelium growth of burned area after transplantation was observed using light microscope at 1, 2, 3, 4, and 8 weeks. Conjunctival tissue in transplantation area was collected at 1, 4 and 8 weeks. The ultrastructure of the collected tissue was studied by electron microscope. The results were compared with control group, which received only vitamin C subconjunctival injection and antibiotic eye drops as treatment for alkali burn. Exterior eye pictures were also taken at the end of the observation, the width from upper corneal limbus to the edge of upper fornix was measured. Data were analyzed statistically. · RESULTS:(1) In the transplant group, conjunctival epithelium growth was observed in the area of AMT under both light and electron microscope 1 week after surgery. At the 4th week, conjunctival epithelium with goblet cells that resembled normal conjunctival tissues was observed in the whole amniotic membrane area. At the 12th week, the conjunctival epithelium on the amniotic membrane was well formed, and the connective tissue under the epithelium was loose at the fornix. No fibrosis was identified. In contrast, conjunctival epithelium necrosis was observed in the control group at 2 weeks after alkali burns. Reepithelization did not occur through the 12-week observation. Severe fibrosis with inflammatory cells infiltration was observed between 4 to 8 weeks. At the 12th week, fibrosis of the connective tissue at the fornix developed and there were no conjunctival epithelium covering the burned area.(2) In the transplant group, the conjunctiva in transplanted area had no scarring and appeared smooth at the 12th week. Upper fornix was reconstructed. The depth of fornix was 7.9±0.3mm (7.6- 8.2mm), which was approximate to the normal depth 8.2±0.2mm (8.0-8.4mm, P >0.05). While in the control group, the burned area appeared rough with granuloma formation and severe scarring. Upper fornix became shallow. The depth of fornix was 3.1±1.7mm (1.0 - 4.5mm.), and significant difference was found between control and transplant group (P <0.01). CONCLUSION: Human amniotic membrane preserved in glycerin can promote cell adhering, migrating and differenti- ating of normal conjunctival epithelium. Reconstruction of conjunctival surface in early stage of alkali burn can be achieved by AMT. AMT can effectively prevent symblepharon formation.

Expression of caspase-9 affected by AG on retina of rats with chronic IOP elevation

Qing-Zhu Nie,Qian Sha,Ying-Shuang Wang,Dong-Mei Gui,Zhi-Li Liu and Dian-Wen Gao
AIM: To study caspase-9 expression on rat retina in the process of chronic elevation of IOP and the changes with the application of amino guanidine (AG), thus to investigate the potential protective function of AG to rat retina with chronic elevation of IOP. METHODS: Immunohistochemistry, RT-PCR and Western blot were used to observe retinal morphology and the expression of caspase-9 at different time points of rat with chronic IOP elevation, both affected and not affected by the application of AG. ·RESULTS: Compared with control group, as time passed retina of experimental group gradually had detectable morphological changes. On 21^st day of chronic IOP elevation, retinas became thinner and the quantity of retinal ganglion cells (RGCs) decreased; caspase-9 expression increased, consistent with the morphological changes. The group using AG presented relatively smaller morphology changes and less expression of caspase-9. CONCLUSION: Apoptosis-related gene caspase-9 plays a part in the process of chronic IOP elevation; AG protects retina by down-regulating expression of caspase-9.

Effect of the dipeptide Arg-Gln on retinopathy of prematurity in mice

Ai-Yuan Wang,Jun Chai and Xiao-Long Chen
AIM: To investigate the effect of the dipeptide Arg-Gln on retinal neovascularization of retinopathy of prematurity (ROP) in the oxygen-induced retinopathy (OIR) animal model. METHODS: Forty-eight 7-day-old C57BL/6J mice were exposed to 750mL/L oxygen for 5 days and then to normal situation to produce the murine model of oxygen-induced retinopathy (OIR). All mice received twice daily intra- peritoneal injections of PBS or the dipeptide Arg-Gln (1.0, 3.0, 5.0g/kg per day), starting on postnatal day 12 and continuing till postnatal day 17. Experimental groups (36 mice, 12 in each group) received Arg-Gln, while the control group (12 mice) received PBS. All mice were executed at postnatal day 17. The changes of retinal vessels of mice were observed by ADPase histochemical technique and HE staining was used to count preretinal neovascular nuclei. RNA was isolated from retinas of 28 mice (7 in each group) selected at random and VEGF mRNA level of each group was measured by real-time RT-PCR. RESULTS: Neovascularization reduced in retinas of the dipeptide Arg-Gln treated group in a dose-dependent manner. Compared with control group, experimental group had diminished non-perfusion area and neovascular tufts in retinal flatmount. The number of the endotheliocyte nuclei of new vessels extending from retina to vitreous was significantly less in the eyes of the experimental group than in control group. Arg-Gln at 5g/kg per day reduced preretinal neovascularization by about 75% (P <0.01). There was a significant reduction in VEGF mRNA at the 17^th day in Arg-Gln treated group compared with control group(P ＜0.01). CONCLUSION: Arg-Gln dramatically inhibits retinal angiogenesis in OIR and this effect is associated with a reduction in retinal VEGF mRNA level. It appears to be a safe way to prevent and treat some neovascular retinal diseases including retinopathy of prematurity.

Effect of Tetrandrine on proliferation of human pterygium fibroblasts

Guang-Li Sun,Ming-Chang Zhang and Li Jiang
AIM: To investigate the effect of Tetrandrine (Tet) on proliferation of human pterygium fibroblasts (HPF) in vitro and to search for a new method to prevent the recurrence after pterygium surgery. METHODS: With different concentrations (0 to 160μmol/L) of Tet acting on HPF cultured in vitro , the impact was observed at 24, 48, 72 hours respectively after Tet intervention. The MTT method was used to assay the biologic activities of Tet and inhibitive rate of cell growth. The expression of proliferating cell nuclear antigen (PCNA) in each group was detected by immunohistochemistry before and after Tet intervention. RESULTS: With different concentrations of 20, 40, 80 and 160μmol/L and acting for 24 to 72 hours, Tet could inhibit the proliferation of HPF in a dose- and time-dependent manner (P <0.05). After the intervention of Tet, the expression of PCNA protein declined. When the concentration of Tet was in the range of 20 to 160μmol/L, it was able to inhibit the expression of PCNA in a concentration-dependent manner (P <0.05). CONCLUSION: Tet can significantly inhibit the proliferation of pterygium fibroblasts, and the inhibitive action is in a dose- and time-dependent manner within a certain range of concentration. But in high concentration (>160μmol/L), Tet will have cytotoxity.

Promotion of proliferation and migration of Müller cells by RPE cells in a co-culture system

Hong-Mei Ma,Xiao-Mei Zhang,Xiao-Bo Fu,Wei-Jun Li,Lan Wu and Wei Wang
AIM: To investigate the role of retinal pigment epithelium (RPE) in the growth of Müller cells using a co-culture system in vitro. METHODS: Müller cells were co-cultured with RPE cells under both normoxic and hypoxic conditions in Transwell chamber culture system. Müller cell proliferation was eval- uated by MTT assay. The number of cells that migrate through micropores and stay on the outer bottom side of insert systems were observed and counted. RESULTS: The activities of proliferation and migration of Müller cells when co-cultured with RPE cells were significantly higher than those of the Müller cells when cultured alone at all time points under both normoxic and hypoxic conditions. However, for both the co-culture and control groups, there was no significant difference between the measurements at 3 and 6 hours. CONCLUSION: Evidence suggests that RPE, when co- cultured with Müller cells, can stimulate migration and prol- iferation of Müller cells under both hypoxic and normoxic conditions in a time-dependent manner; however, there is no evidence to support the synergetic interaction of RPE and Müller cells co-cultured under hypoxic conditions.

Effects of platelet-derived growth factor α receptor in experimental rabbit PVR
AIM: To determine the effect of the tyrphostin AG1295 and AG1296, a selective blocker of platelet-derived growth factor (PDGF) β and α RTK, on proliferative vitreoretinopathy (PVR) development. METHODS: Rabbit conjunctival fibroblasts (RCF) cells were cultured. The effects of AG1295, AG1296, PDGF-AA and PDGF-BB on RCF proliferation were evaluated by MTT assay. Homologous rabbit conjunctival fibroblasts were injected intravitreally to make animal PVR model, followed by injection of 100μmol/L of AG1295 or AG1296 respectively. The presence of tractional retinal detachment (TRD) was assessed to evaluate the effect of AG1295 and AG1296 in vivo. Electroretinography and histologic studies were performed after intravitreal injection of AG1295 into untreated eyes to evaluate toxicity. · RESULTS: Both AG1295 and AG1296 (10μmol/L) significantly inhibited rabbit conjunctival fibroblast cell growth stimulated by PDGF-AA or -BB in vitro . Development of TRD was significantly reduced (P <0.05) with 100μmol/L of AG1295 or AG1296 in vivo , but the effect of AG1295 only present until day 14. Inhibitive effect of AG1296 was longer than that of AG1295. No significant histological or retinal functional damage was found in both drug-treated groups. CONCLUSION: PDGF α and β receptor specific inhibitor AG1296 and AG1295 attenuate PVR without significant side effects in rabbits, and AG1296 is better than AG1295. The much longer and stronger therapeutic effect from PDGF α receptor inhibitor indicates that PDGF α receptor is more important in the development of PVR, and inhibition of this pathway can be a useful treatment alternative to prevent PVR.

Effects of hydralazine on NaIO3 -induced rat retinal pigment epithelium degeneration

Wei Jiang,Wan-Yu Zhang and George C Y Chiou
AIM: To study the effects of 10g/L hydralazine eye drops on 35mg/kg NaIO₃ -induced degeneration in rat eyes. METHODS: Various doses of NaIO₃ and/or saline alone were injected into Brown Norway rats from hypoglossal vein. After 3, 7, 14 or 28 days of injection, ERG a-, b-, c-wave, fast oscillation (FO) and light peak (LP) were measured along with retinal colored pictures and fluorescein angiography(FA) taken. Some rats were chosen to study the histology of retinas by light microscopy and autofluorescence of retina flatmounts. Different concentrations of NaIO₃ were given to RPE-19 cells, and cell proliferation rate was measured. For hydralazine study, 35mg/kg NaIO₃ was injected into Brown Norway rat from hypoglossal vein. NaIO_{3 group was treated with saline alone after NaIO₃ injection, 10g/L hydralazine+ NaIO₃ group was treated with 10g/L hydralazine eyedrops after NaIO₃ injection whereas normal group was treated with saline alone without NaIO₃ injection. All eyedrops were instilled locally 3 times a day for 4 weeks and ERG c-wave was measured at the end of 2 and 4 weeks.
RESULTS: After NaIO₃ administration, the amplitude of all ERG waves fell markedly in large dose groups at 30, 40 or 60mg/kg NaIO₃. Not many changes were observed in groups treated with <30mg/kg NaIO₃. Some retinal necrosis appeared from 3 days post-injection (PI) in 30mg/kg NaIO₃ group, which became more serious in larger dose groups or longer treatment time, but no apparent change was found in smaller dose groups. Similarly, on the retina flatmount, RPE monolayer showed necrosis from 3 days PI in the 30mg/kg NaIO₃ and larger dose groups. On histological examination, no significant change was seen in 30mg/kg NaIO₃ and lower concentration groups. In cell culture experiment, changes were found in RPE-19 cells proliferation rate with a concentration of NaIO₃ at 30mg/L or higher. In hydralazine experiments, 4 weeks after injection of NaIO₃, ERG c-wave fell markedly in NaIO₃ group to 31% of control group(P <0.01). The ERG c-wave of hydralazine +NaIO₃ group fell only to 50% of control group (P <0.05). This was a 61% reversal of the c-wave of NaIO₃ treated group.
CONCLUSION: Retinal pigment epithelium(RPE) degeneration induced by NaIO₃ was both dose and time dependent. Around 30 to 40mg/kg NaIO₃ would be the optimal to be used as a non-exudative age-related macular degeneration(AMD) rat model. Hydralazine may postpone the development of non-exudative AMD.}

Antioxidant activity of naringenin on various oxidants induced damages in ARPE-19 cells and HUVEC

Bao-Qin Lin and George C Y Chiou
AIM: To evaluate the antioxidant activity of naringenin in human retinal pigment epithelium(ARPE-19) cells and human umbilical vein endothelial cells (HUVEC). METHODS: MTT assay was used to measure the viability and proliferation of ARPE-19 cells and HUVEC. RESULTS: Three and 10mg/L naringenin significantly increased the proliferation of ARPE-19 cells by 10.8% and 11.4%, respectively. Ten mg/L naringenin increased hypoxia-, 0.3mmol/L NaN₃^-, and 200umol/L H₂O₂ -induced damage of ARPE-19 cells by 55.2%, 69.2%, and 50.3%, respectively. One mg/L naringenin increased the viability of 50umol/L t-BHP-, and 30mg/L NaIO₃-treated ARPE-19 cells by 20.2% and 30.4% , respectively. Thirty mg/L naringenin also increased the proliferation of 50umol/L t-BHP-treated ARPE- 19 cells by 32.2%, and 1mg/L naringenin increased the proliferation of 30, 100 and 300mg/L NaIO₃-treated ARPE-19 cells by 30.3% , 10.3% and 18.5% , respectively. The reduction of HUVEC was 23.9%, 70.4% and 77.9% in the 3, 10 and 30mg/L naringenin-treated groups, respectively. Furthermore, 1 and 3mg/L naringenin increased hypoxiainduced damage in HUVEC by 10.7% and 13.1% , and 300mg/L NaIO₃-induced damage in HUVEC by 41.2% and 37.7%. Three mg/L naringenin increased 200 and 400umol/L H2O2-in-jured HUVEC by 20.1%and 21.5%, respectively. CONCLUSION: Naringenin increases the proliferation of ARPE-19 cells and inhibits the growth of HUVEC, and has potent antioxidant activity in ARPE-19 cells and HUVEC.

The role of MMP-9 and TIMP-3 in induction of choroidal neovascularization in a murine model
AIM: To examine the expression of MMP-9 and TIMP-3 mRNA during choroidal neovascularization (CNV) in a murine model and to investigate the role of them in the development of CNV. METHODS: CNV was induced in C57BL/6J mice by intensive diode laser (810nm) photocoagulation (120mW, 75μm, 0.1s) of the fundus whereafter eyes were enucleated at 1, 3days, 1, 2, and 4 weeks. The MMP-9 and TIMP-3 mRNA expressions were analyzed using in situ hybridization and image analysis system. RESULTS: Both expression of MMP-9 and TIMP-3 mRNA had dynamic changes. For MMP-9, the expression was 1, 2, 4 wk>3d>1d (P <0.05), whereas TIMP-3 mRNA, 3d, 1, 2, 4 wk>1d (P <0.05). CONCLUSION: The imbalance between the changes of MMP-9 and TIMP-3 may accelerate the degrading of extracelluar matrix, and then be involved in the pathogenesis of CNV.

Support of acellular porcine corneal stroma for growth of corneal epithelium and stromal cell in vitro

Xu-Chu Lin,Yan-Nian Hui,Hao Meng,Yong-Jie Zhang and Yan Jin
AIM: To determine whether acellular porcine cornea stroma (APCS) could support the growth of the rabbit corneal cells in vitro . METHODS: APCS was prepared. The rabbit's corneal epithelium and stromal cells were cultured and seeded on APCS in vitro . The observation of phase contrast photograph and histological examination were performed. RESULTS: Histological examination showed the epithelium grew on the scaffold of APCS in 2-3 layers at 10th day. The stromal cells adhered to the surface of the scaffold after 24 hours and invaded into the interlaminar of the material at 5th day. CONCLUSION: These results indicate that APCS can support the growth and proliferation of the corneal epithelium and stromal cells in vitro .

Angiogenesis induced by micropocket assay on rat cornea

Wei Zhao,Ai-Hua Jiang and Zu-Guo Liu
AIM: To explore the skills and characteristics of corneal neovascular model in rat induced by micropocket assay. METHODS: Nine eyes of nine Sprague-Dawley rats were studied. Pellets made of vascular endothelial growth factor (VEGF), poly-2-hydroxylethylmethacrylate and sucralfate were implanted into the corneal stroma no closer than 1mm from the limbus. Biomicroscopic features of corneal neovascular were observed on 1, 3, 5, 7th day after the implantation. RESULTS: On day 1 after operation, the limbal vessels were dilated, with no angiogenesis appeared On day 3, angiogenesis began to invade pericornea with a brush shape, the area of CNV was (2.23±0.59)mm². On day 5, new vessels reached the lower margin of pellet densely, and the area of CNV was (6.81±1.35)mm². On day 7, new vessels continued to elongate, parts of them extended as loops toward the pellet, and the area of CNV was (8.92 ±1.79)mm². Neither hyphema or other complications occurred. CONCLUSION: Corneal neovascularization induced by micropocket assay in rat grows steadily without complication, and is suitable for quantitative researches.

Inhibition of β1 -integrin on apoptosis of rabbit corneal epithelial cells

You-Dong Wang,Qi Sun,Bing-Yang Liu and Jin-Song Zhang
AIM: To investigate the effect of β1-integrin overexpression on the apoptosis of rabbit corneal epithelial cells and the related mechanism. METHODS: The plasmid expressing β1-integrin-GFP fusion protein was constructed by polymerase chain reaction (PCR), and this plasmid (β1 group) or the empty vector (mock group) was transfected into rabbit corneal epithelial cells, respectively. The expression of β1-integrin-GFP fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot. The adhesion of transfected cells to extracellular matrix (ECM) proteins was determined by adhesion assay. The apoptosis of rabbit corneal epithelial cells was assayed by Hoechst 33342 staining and DNA ladder. The phosphorylation of mitogen-activated protein (MAP) kinase was examined by Western blot. RESULTS: Rabbit corneal epithelial cells overexpressing β1-integrin-GFP fusion gene were successfully established. Compared with mock group, β1-integrin transfection significantly promoted the adhesion of rabbit corneal epithelial cells to ECM proteins such as laminin, fibronectin, collagen I and collagen IV. β1-integrin overexpression inhibited apoptosis and induced MAP kinase phosphorylation in rabbit corneal epithelial cells (P <0.05). CONCLUSION: These data suggest that overexpression of β1-integrin confers resistance to apoptosis in rabbit corneal epithelial cells, and MAP kinase pathway may play an important role in this process.

Comparative study of four culture methods to engineer murine corneal epithelial sheet

Xiao-Li Ma,Jun Kong,Han-Qiang Liu,Jiang-Yue Zhao and Jin-Song Zhang
AIM: To investigate the roles of feeder cells in stratification of murine corneal epithelial cells and build an ideal method to engineer stratified epithelial sheet. METHODS: Using contact feeder culture, separated feeder culture, compound feeder culture and culture without feeder cells by air-lifting method in Transwell chamber culture system, tissue engineered corneal epithelium was reconstructed. Corneal sheets were stained with hematoxylin and eosin (HE) for histological observation. The expression of p63 and keratin 19 (K19) and involucrin (IVL) was investigated by immunocyto- chemistry analysis. RESULTS: Stratification was limited to three to four layers in the contact feeder group, whereas separate feeder sheets were slightly more stratified. The compound feeder group produced a stratified epithelium with five to seven layers of cells. The group without 3T3 feeder cells formed only two to three layers of cells. Immunostaining images in the compound feeder group showed expression of progenitor markers p63 and K19 in the basal and suprabasal layer, as well as differentiation marker involucrin in all layers. CONCLUSION: The remarkable stratification as well as the limbal phenotype makes the compound feeder system a candidate tool for cultivating transplantable epithelial sheets.

Influence on cultured human keratocytes by liposome

Xin-Yu Li,Gui-Gang Li,Lei Liu and Jing Li
AIM: To observe the effects on human keratocytes by cationic liposome Lipofectamine^TM2000 (LF2000), to investigate the efficiency and safe range applied in human keratocytes, and establish basis for gene therapy of human keratocytes. METHODS: Human keratocytes cultured in vivo within 3 to 5 passages were used in experiment after being identified. The effects on proliferation of cultured human keratocytes by LF2000 with different concentrations and time were evaluated By MTT; the effects of LF2000 on the survival rate and its relation with 5,10,20,40,80mg/L concentration and time were detected by trypan blue staining. RESULTS: LF2000's effects on human keratocytes were related with concentration and time. The cellular proliferation and survival rate declined when concentration of LF2000 was above certain level, and this effect increased as time became longer. LF2000 had no effect with concentration under 40mg/L for 24 hours. CONCLUSION：LF2000 did not cause cytotoxicity during a concentration range“tested”, and it is hoped to play an important role in gene therapy of human keratocytes.

A feasibility study of recombinant adeno-associated virus as a vector for transferring a target gene to retina

Jian-Ming Wang,Ya-Zhi Fan,Na Hui,Lei Xiong,Hai-Xiao Feng and Nai-Xue Sun
AIM: To study the feasibility of recombinant adeno-associated virus (rAAV) as a vector to transfer the green fluorescent protein (GFP) gene as a target gene into rabbit retina. METHODS: Intravitreal injection of rAAV-gfp was performed in either eye for each rabbit with the other eye taken as control. At the 3rd, 7th, and 14th day after injection, the eyeballs were removed, and the retinas were flat-mounted on glass slides to inspect the retinal fluorescence, respectively. RESULTS: After intravitreal injection of rAAV-gfp, the presence of fluorescent spots in the cytoplasm of retinal cells indicated that GFP gene was efficiently transferred and expressed in the rabbit retina. CONCLUSION: Recombinant adeno-associated virus is a reliable and simple vector for transferring target gene, e.g., GFP gene, to the retina.

Human optic nerve head astrocytes culture in vitro :I. the primary culture and passage

Wei-Jia Dai,Shelley Culp-Stewwart,Anna Cheng,John Flanagan and C Ross Ethier
AIM: To culture astrocytes from human donor eyes in order to understand the function of astrocytes in remodelling events in the glaucomatous optic nerve head (ONH). METHODS: Primary cultures were prepared by explantation of human ONH tissue in order to get astrocytes. Laminar criborsa (LC) cells were prepared concurrently for com- parison. Astrocyte cultures could be separated from LC cells by selecting medium. Similar procedures were used for LC. RESULTS: Primary cells grew from human optic nerve head explants 4-8 weeks after explantation. Astrocytes had different morphologies and growth characteristics from LC cells. Type 1B astrocyte cells could grow in medium without FBS. Purified cultures were obtained by second passage and could be harvested by third to fifth passage, which were prepared to use for further study, including being characterized by positive glial fibrillary acidic protein (GFAP) and neural cell adhesion molecule (NCAM) staining. CONCLUSION: Precise dissection of fragment is the most important step to get clear explants for primary culture. Economic and rapid method could be useful to select cells by different mediums, which will help us to get more purified cells for further study.

Effects of ZX-5 and its optical isomers on ocular blood flow in rabbits and retinal function recovery in rats
AIM: The effects of ZX-5, as nitric oxide (NO) donor, on ocular blood flow has been investigated using colored microsphere technique in previous study. The relationship between the production of NO by ZX-5 and ocular blood flow has been evaluated. ZX-5 has been shown to have strong positive effect on increasing choroidal blood flow. However, the effect of ZX-5 on retinal function recovery, the effects of its optical isomers, (R, R)-ZX-5 and (S, S)-ZX-5, on choroidal blood flow and retinal function recovery have not been studied and merit investigation. · METHODS: Colored microsphere technique was used for in vivo experiments to determine choroidal blood flow of ocular hypertension (40mmHg) in rabbit eyes. Electroretinography was used to measure the b-wave recovery as an indication of retinal function recovery. · RESULTS: (R, R)-ZX-5 increased choroidal blood flow at 10g/L, 50μL instillation into eyes at all time points (P <0.05). (S, S)-ZX-5 was not effective in increasing choroidal blood flow. ZX-5 and (R, R)-ZX-5 showed significant effects in retinal function recovery after ischemia of the retina at all time points (P <0.05); whereas (S, S)-ZX-5 did not show significant effect on recovery of b-wave after ischemia at most time points except at 120 and 240 minutes. · CONCLUSION: ZX-5 and (R, R)-ZX-5 have high potency in increasing the choroidal blood flow and improving the retinal function recovery. It is hoped that they could be used for the prevention/treatment of ocular blood flow related eye diseases.

An increased expression of CD40/CD40L costimula- tory molecules in erythema nodosum of patients with Behçet's disease
AIM: To investigate the expression and the possible implication of CD40/CD40L costimulatory molecules in erythema nodosum of patients with BehÇet's disease. METHODS: Sampling was done from erythema nodosum of 5 patients with BehÇet's disease and normal skin of 2 healthy individuals. Immunohistochemical staining was performed to examine the expression of CD4, CD8, CD19, CD68, HLA-DR, CD40 and CD40L molecules in the obtained tissues.
RESULTS: Approximately 90% of epidermic cells in erythema nodosum expressed CD40 moleculeIn the dermis and subcutaneous tissue, a significantly increased number of CD4⁺Tcells, CD8⁺Tcells, CD19⁺cells, CD68⁺cells, HLA-DR⁺cells, CD40L⁺cells, and CD40+cells were observed in the erythema nodosum as compared with that in normal skin. Double staining showed that CD40L molecules were expressed on 45% of CD4⁺ T cells. CD40 molecules were expressed on 100% CD68⁺ cells and 59.2% of HLA-DR⁺cells respectively. CONCLUSION: A number of CD40/CD40L costimulatory molecules are upregulated in the erythema nodosum of patients with BehÇet's disease.

Bioinformatics analysis and construction of eukaryotic expression plasmid of Cx50 V64G mutation
AIM: To construct and analyze eukaryotic expression plasmid inserted by Cx50 with V64G mutation through bioinformatics software. METHODS: The full coding domain sequence of Cx50 with V64G mutation was acquired from the blood of patients with cataract and was cloned into pcDNA3.1/Amp (+).The constructed plasmid was identified with PCR , enzyme digestion and sequencing. The analysis of Cx50 with V64G mutation was performed with bioinformatics software. RESULTS: Cx50 with V64G mutation was successfully amplified and its eukaryotic expression plasmid was constructed. Valine-64 is well conserved in the first extracellular loop of connexin 50 in different species and also in different human α-type gap junctional proteins. CONCLUSION: The successive reconstruction and verification of eukaryotic expression plasmid containing Cx50 with V64G mutation established the foundation for further studying the mechanism of cataract.

Antioxidant effect of hydralazine on retinal pigment epithelial cells and its potential use in the therapy of age-related macular degeneration

Yu-Wen Cheng and George C Y Chiou
AIM: To investigate the antioxidant effect of hydralazine under hypoxia-induced damage on retinal pigment epithelial (ARPE-19) cells and the role of reactive oxygen species (ROS) in this effect. ·METHODS: Human retinal pigment epithelial (hRPE) cells were used to investigate the effect of hydralazine on oxidative stress, including tert-butyl hydroxyperoxide (t-BHP), H2O2, sodium azide (NaN3), and hypoxia induced cell damage. Cell viability was determined by MTT assay. RESULTS: When ARPE-19 cells were treated with oxidative stress induced by ROS, hydralazine showed concentration-dependent protection against t-BHP, H2O2 and hypoxia induced cell damage but not NaN3. Nitric oxide (NO) was not involved in this effect. ·CONCLUSION: Hydralazine showed antioxidant potential against oxidative stress induced damage in ARPE-19 cells. These effects might be caused through scavenger of ROS. Thus, hydralazine could be used for the treatment of age-related macular degeneration (AMD).

Gene expression of transforming growth factor-β2 in retina of diabetic rats

Wei Shen and Lin Liu
AIM: To detect the gene expression of TGF-β2 in retinas of diabetic rats at different stages, to observe and analyze the effect of TGF-β2 on the retinas of diabetic rats, to explore the role of TGF-β2 in pathogenesis of diabetic retinopathy (DR), and to provide experiment data and experience for further clinic studies. METHODS: Sprague-Dawley (SD) rats were used and retinas were dissected. The total RNA was isolated from which the first strand of cDNA was prepared. Diabetes mellitus was induced by a single intraperitoneal injection of 60mg/kg streptozotocin (STZ) and the rats were held without insulin treatment until sacrifice. Besides, age-matched rats treated with saline were used as controls. Tail vein blood glucose was measured after 2 days and rats were considered hyperglycemic if blood glucose reading >16.7mmol/L. Animals with blood glucose level <16.7mmol/L were excluded from the study. The rats were killed at the 4th, 8th, 12th, 16th, 20th and 24th week respectively after hyperglycemic models were established. The retinas were separated and preserved in liquid nitrogen. The expressions of TGF-β2 gene mRNA were detected by reverse transcription PCR (RT-PCR). RESULTS: The RNA of rat retina was integrative enough to be used to further carry out PCR analysis. Compared with control groups, the expression of TGF-β2 mRNA in retinas of diabetic rats was up-regulated at the 4th week, but there was no statistical difference (P >0.05); it was down-regulated at the 8th week, and there was statistical difference (P<0.05); it was also down-regulated at the 12th week, and there was statistical difference (P<0.05); at the 16th week there was no statistical difference (P >0.05); it was up-regulated at the 20th week, but there was no statistical difference (P>0.05); it continued to be up-regulated at the 24th week, and there was statistical difference(P <0.05). CONCLUSION: Since the expression of TGF-β2 mRNA in retinas of diabetic rats was down-regulated at the 8th week and 12th week statistically, up-regulated at the 24th week statistically, it has obviously shown that TGF-β2 was down- and up-regulated through the period of DR. That is, its changes are diphasic with time. It may confirm that TGF-β2, with the characteristic of diphasic regulation, played an important role in DR. It is necessary to study it furthermore.

Expression of erythropoietin and its receptor in nor- mal and neovascularized murine corneas induced by alkali burns
AIM: To test the expression of erythropoietin (Epo) and its receptor EpoR in normal and neovascularized murine corneas induced by alkali burns, and to investigate whether Epo/EpoR is involved in the process of corneal angiogenesis. METHODS: The expression of Epo/EpoR was tested in normal and neovascularized murine corneas induced by alkali burns through immunohistochemistry of corneal frozen sections. Epo cloning, expression, and purification were carried out. Then Epo protein (6μL, 1μg) and control (6μL of vector control or saline) were injected into the corneal stroma respectively, and the corneas were checked at the 14th day after injection to see whether corneal neovascuarization occurred. RESULTS: Epo/EpoR was expressed in epithelial cells, endothelial cells and stromal cells in normal and neovascularized corneas induced by alkaline burns, and also expressed strongly in neovascularized cornea. They were expressed at the same time in stromal inflammatory cells and new vessels. Corneal neovascularization was induced by Epo intrastromal injection in 5 out of 6 eyes , but no new vessels were observed in all controls (n =6) at day 14 after vector control or saline intrastromal injection in normal corneas. CONCLUSION: This paper first reported the expression of Epo and its receptor in normal and neovascularized cornea. Injection of Epo into the corneal stroma may induce the corneal neovascularization Epo/EpoR is associated with the formation of corneal neovascularization.

Expression of EMMPRIN, MMPs and TIMP2 in retinoblastoma and normal retinal tissue

Yun Li,Luo-Sheng Tang,Qing-Hua Zhou,Dan Cao and Zhu-Lin Yang
AIM: To investigate the expression of EMMPRIN, MMP1, MMP9 and TIMP2 in retinoblastoma (RB) and normal retinal tissues and their clinicopathological significance and interrelationship. METHODS: Envision immunohistochemistry stainings of EMMPRIN, MMP1, MMP9 and TIMP2 were performed in 30 enucleated eyeballs with retinoblastoma and 15 specimens of normal retina tissue, which had been routinely imbedded with paraffin. RESULTS: Positive rate of EMMPRIN, MMP1, MMP9 expression was higher in RB tissue than in normal control ( P<0.01), while TIMP2 expression was lower in RB than in normal retinal tissue ( P<0.01). Samples from RB cases of clinical stage I, differentiated type, and life span ≥ 2 years had lower positive rate in expression of EMMPRIN, MMP1, MMP9 than those from RB cases of clinical stage III, undifferentiated type, andP life span<2 years ( P<0.05 or <0.01), while samples from RB cases of differentiated type, optic nerve unaffected, and life span ≥ 2 years had markedly higher positive rate in expression of TIMP2 than those from RB cases of undifferentiated type, optic nerve involved and life span<2 years ( P<0.05 or P<0.01). In RB tissues, EMMPRIN, MMP1, MMP9 expressions were highly consistent ( P<0.05), whereas TIMP2 expression is highly inconsistent with EMMPRIN,MMP1,MMP9 expression levels( P<0.05). CONCLUSION: The expression level of EMMPRIN, MMP1, MMP9 and TIMP2 may be an important marker of RB progression, invasion and prognosis. There exist internally mutual regulation relations among them."

Inhibition of retinal angiogenesis by PEDF

Ai-Yuan Wang and Dian-Wen Gao
AIM: To investigate the effect of PEDF on retinal neovascularization in mice. METHODS: 40 7-day-old C57BL/6J mice was exposed to 750mL/L oxygen for 5 days and then to normal situation to produce the murine model of oxygen-induced retinopathy(OIR). One eye of the mouse was regarded as experimental one and the other served as control. Eyes in experimental group received intravitreal injection of PEDF and eyes in control group received intravitreal injection of PBS at postnatal day 12. All mice were executed at postnatal day 17. The changes of retinal vessels of mice were observed by ADPase histochemical technique. The inhibitory effect of PEDF on retinal neovascularization was evaluated by counting the endotheliocyte nuclei of new vessels which extended from retina to vitreous in the tissue slice of HE staining. RESULTS: Neovascularization was reduced, retinal blood vessels distributed regularly and non-perfusion areas were not found in eyes of experimental group compared with control group. The number of endotheliocyte nuclei of new vessels extending from retina to vitreous was significantly less in the eyes of experimental group (10.18±1.74) than that in control group (38.89±2.98) (P <0.01). Retinal toxicity and inflammatory reactions were not found in tissue slice. CONCLUSION: PEDF inhibits retinal angiogenesis in OIR and the feasibility should be determined for use of PEDF in ocular angiogenesis treatment.

Carbamylation-induced inactivation of glyceraldehydes 3-phosphate dehydrogenase and thioltransferase in bovine lens

Jie Zhang and Hong Yan
AIM: To investigate whether potassium cyanate can inactivate glyceraldehydes 3-phosphate dehydrogenase (GAPDH) and thioltransferase (TTase) in bovine lens. METHODS: Fresh intact bovine lenses were incubated with 100mmol/L potassium cyanate(KCNO) for 7 and 12 days respectively. Then all lens were incubated in 50mmol/L DMEM solution. The proteins in the water-soluble fractions from the normal control and the cyanate-modified lens were extracted. The activity of GAPDH and TTase in the water-soluble fraction after incubation at 37℃ was measured by spectrophotometer. RESULTS: GAPDH activity was significantly lower in the cyanate-modified lens proteins than that of the normal control(P <0.01), and considerably diminished in protein incubated with 100mmol/L potassium cyanate for 12 days. There were statistically significant differences in the activity of TTase between the normal control lenses and the carbamylated lenses incubated for 7 days(P <0.05) and 12 days(P <0.01). However, there was no statistical difference between the samples incubated with 100mmol/L KCNO for 7 and 12 days (P =0.19296). CONCLUSION: This study provides evidence to show carbamylation is able to inactivate GAPDH and TTase in bovine lenses. This may have implications for the susceptibility of lenticular GAPDH and TTase to carbamylation, and also for the research on pathogenesis of cataract.

Effect of puerarin on retinal pigment epithelial cells apoptosis induced partly by peroxynitrite via Fas/FasL pathway
AIM: To evaluate the peroxynitrite (ONOO-) of puerarin on retinal pigment epithelial (RPE) cells apoptosis induced partly by peroxynitrite via Fas/FasL. METHODS: RPE cells from C57BL/6 mice eyes were cultured. Diabetes was induced in Sprague-Dawley (SD) rats by streptozotocin (STZ) intraperitoneal injection. Puerarin was administrated to cultured RPE cells and diabetic rats. Western blotting analysis, DNA ladder, RT-PCR, immunohistochemistry were used for determining the expression of nitrotyrosine (NT, the foot print of ONOO-), complement 3 (C3); apoptosis and inducible nitric oxide synthase (iNOS) mRNA as well as Fas/FasL signal transduction in RPE cells. RESULTS: Both RPE cells in ONOO- and puerarin group developed apoptosis and expressed NT, C3, iNOS mRNA and Fas/FasL. But latter delayed the all changes in a time-dependent manner compared with control and STZ group (P＜0.001). iNOS, C3 and Fas/FasL were up-regulated and associated with an increase of expression of ONOO- in vivo and in vitro. CONCLUSION: Puerarin decreases RPE cells apoptosis partly induced by ONOO- for diabetic retinopathy.

[Ca2+]i homeostasis and caspase-3 gene expression in verapamil-induced retinal pigment epithelium cells apoptosis in vitro

Dong-Bo Pang and Jing Hong
AIM: To study caspase-3 gene expression and [Ca2+]i homeostasis in verapamil (Ver)-induced human retinal pigment epithelium (RPE) cells apoptosis. METHODS: Ver 80mg/L was applied in cultured human RPE cells for 12, 24 and 48 hours to induce RPE cells apoptosis. The expression of apoptotic effector gene caspase-3 was assessed by reverse transcription polymerase chain reaction (RT-PCR). Single cell was measured using fluorescence indicator Fura-3/AM with MetaFluo4.5/coolsnapfx/IX70 intracellular Ca2+ fluorescence imaging system. RESULTS: High levels of expression of caspase-3 mRNA were observed in normal RPE cells and it significantly increased after co-cultured with Ver. The fluorescence in resting RPE cells was strong and distributed throughout the cells. The nucleus appeared more fluorescent than the cytoplasm. Calcium fluorescence of RPE cells attenuated after co-cultured with Ver. CONCLUSION: Up-regulation of caspase-3 gene expression and disturbance of [Ca2+]i homeostasis might play pivotal roles in Ver-induced RPE cells apoptosis.

Optic nerve lesions in diabetic rats:blood flow to the optic nerve, permeability of micro blood vessels and histopathology

Jun-Ping Zhao,Zhi-Zhong Ma,Chen Song,Xiang-Hong Li,Yu-Zhen Li and Yu-Ying Liu
AIM: To study optic nerve lesions, changes in blood flow to the optic nerve, and permeability of micro blood vessels and histopathology in diabetic rats. METHODS: Male Wistar rats (n=20) were randomly divided into control and diabetic groups. The diabetic model was prepared by a single injection of streptozotocin (50mg/kg) into the caudal vein. Three months later, laser Doppler perfusion imaging was used to observe the changes in blood flow to the optic nerve. Each rat was injected with 15g/L Evans blue (5μL/g). The permeability of microvessels in diabetic optic nerves was measured by spectrophotometry. Optic nerves were observed by light and transmission electron microscopy. RESULTS: Diabetic rats had atrophic optic nerve fibers with neurite swelling, loss of myelin, and a greater-than-normal proliferation of astrocytes, occurring within 3 months of induction of diabetes. Blood flow to the optic nerve was lower in diabetic rats than in controls. Microvessel permeability in diabetic rats increased 2.03-fold compared to controls. CONCLUSION: Diabetic rats develop significant pathological changes in the optic nerve, reduced blood flow to the optic nerve and increase microvessel permeability.

Inhibition of corneal neovascularization by vascular endothelia growth inhibitor gene

Hong Wang and Bing Wang
AIM: To evaluate the effect of EffecteneTM lipofectine mediated plasmids encoding human pcDNA4-vascular endothelia growth inhibitor (pcDNA4-VEGI) gene on corneal neovascularization (CNV). METHODS: Forty New Zealand albino rabbits were sutured by 5-0 silk on the superior cornea to induce CNV and divided into 4 random teams, ten per each team: team A: transfected by pcDNA4-VEGI gene mediated by EffecteneTM lipofectine transfection; team B: by plasmid pcDNA4; team C: by EffecteneTM, and team D: by normal saline. Length and area of CNV were observed under slit lamp every day after tran- sfection. Immunohistochemistry was performed to detect the expression of VEGI protein in corneas at day 3, 7, 14 and 21. RESULTS: 1) Average occurrence of CNV was 6.3 days in team A, 3.1 days in team B, 3.2 days in team C, and 3.2 days in team D. Difference was significant between A and other teams (P<0.01); 2) Length and average area of CNV in each period in team A was significantly different from those in team B, C and D (P<0.01); 3) VEGI expressions were observed in epithelium, stroma, endothelium and the cliff of CNV in team A at 3 days after transfection by immunohistochemical staining. None VEGI positive cells were found in the control teams (team B, C and D) all the time. CONCLUSION: EffecteneTM lipofectine transfection technique can effectively transfect pcDNA4-VEGI gene into rabbit cornea and the length and CNV areas can be inhibited by VEGI gene.

5-hydroxytryptamine level and 5-HT2A receptor mRNA expression in the guinea pigs eyes with spectacle lens-induced myopia

Ji-Wen Yang,Yan-Chun Xu,Lin Sun and Xiao-Dan Tian
AIM: To investigate 5-hydroxytryptamine (5-HT) function and 5-HT receptor 2A (5-HT2A) mRNA expression in the formation of lens-induced myopia (LIM). METHODS: Lens-induced myopia construction method was applied to generate myopia on guinea pig right eye (LIM eye). RESULTS: LIM eyes formed significant myopia with longer axial length. 5-HT level in retina, choroids and sclera from LIM eyes was significantly higher than that in control group. 5-HT2A mRNA expression was also significantly up-regulated. CONCLUSION: Refraction lens could induce myopia in guinea pig and 5-HT may play an important role in the formation of myopia by binding with 5-HT2A receptor.

β-catenin expression in rat neovascularized cornea after alkali burn

Li Wang,Ming-Chang Zhang,Ying Zhang,Zhi He,Li Zhang and Shi-Yi Xiao
AIM: To investigate the expression of β-catenin in cornea after alkali burn and explore its role in cornea neovascularization (CNV). METHODS: CNV model was established by putting filter paper with the size of 3.0mm in diameter immersed in 1mol/L NaOH solution on the left cornea of rat for 20 seconds. Twenty-five Sprague Dawley rats were randomly divided into 5 groups: post-operation 1-, 4-, 7-, 14- and 21-day groups while the right eyes as normal control group. The expression level of β-catenin protein, mRNA and VEGF were determined at the 1st, 4th, 7th, 14th and 21st day following the establishment of model by RT-PCR and immunohistochemical technique. RESULTS: No expression of β-catenin immunoreactivity was detected in normal cornea. The expressions of β-catenin and VEGF both reached the peak at the 4th and 7th day and gradually decreased to near baseline 21 days later. Alteration of β-catenin and VEGF levels showed a significant positive correlation (r=0.855, P<0.05). CONCLUSION: The levels of β-catenin are markedly related to inflammatory CNV in rat cornea after alkali burn.

Ultrastructural pathology of corneal neovascu-larization after photodynamic therapy in rabbits

Hong Chen,Ming-Chang Zhang,Zhi Wang and Ying Zhang
AIM: To investigate the ultrastructural pathogenesis of photodynamic therapy (PDT) for the experimental corneal neovascularization (CNV) by Hematoporphyrin Derivate (HPD) as photosensitizer and Argon laser as light source. METHODS: Experimental CNV models were induced in 7 white rabbits using alkali burn. Six weeks after models establishment, animals with CNV were injected with HPD intravenously, and 48 hours after the injection, 7 eyes were irradiated with argon laser (power 800mw, wavelength 514.5nm, spot diameter 200μm, exposure time 2ms). The irradiated CNV was observed by light microscopy and scanning electron microscopy. RESULTS: Histopathological study indicated that there was a striking decrease in the number of the CNV, vascular endothelium became degeneration and necrosis, some vessels were atrophy and attenuated, and vessels cavity were blocked by some thrombosis. No obvious abnormal histopathological findings were noted in surrounding tissues. CONCLUSION: The high precise action on CNV and minimal damage to surrounding tissues with PDT by HPD as photosensitizer suggested that PDT might be an effective and safe modality in the treatment of CNV.

Histological observation of RGCs and optic nerve injury in acute ocular hypertension rats

Shuang Li,Jia-Hua Fang and Fa-Gang Jiang
AIM: To explore the injury of retinal ganglion cells (RGCs) and optic nerves in acute ocular hypertension (OHT) rats. METHODS: We retrogradely labeled RGCs and optic nerves of Sprague-Dawley rats by injecting 20g/L fluorogold (FG) into bilateral superior colliculi. Twenty-four hours after the injection, the right eyes were performed physiological saline anterior chamber perfusion with intraocular pressure maintained at 100mmHg for 60 minutes, while the contralateral eyes were performed sham procedure as control group without elevation of the saline bottle. Retinal hematoxylin and eosin (HE) sections, retinal whole mounts and frozen sections were made 14 days later to observe the morphology and survival of RGCs. Frozen sections and transmission electron microscopy were utilized to investigate the histological manifestations of optic nerves at the same time. RESULTS: A larger number of RGCs presented in control group. It had an average density of 1995±125/mm2 and distributed uniformly, while RGCs in OHT eyes reduced significantly to 1505±43/mm2 compared with control group (P<0.05). The optic nerves in control group showed stronger and more uniform fluorescence on the frozen sections, and the auxiliary fibers as well as myelin sheaths were in even and intact organization by transmission electron microscopy. However, exiguous fluorescence signals, vesicular dissociation and disintegration of myelin sheaths were found in OHT group. CONCLUSION: The present study suggested that fluorogold retrograde tracing is a feasible, convenient method for quantitative and qualitative study of neuronal populations and axonal injury in acute ocular hypertension rats.

Influence and mechanism of He-Ne laser on scar formation of filtration canal after trabeculectomy in rabbit

Rui-Lin Wang,Gui-Gang Li,Zhi-Qi Chen,Yan Xiang and Hong Zhang
AIM: To investigate the influence of He-Ne laser on connective tissue growth factor (CTGF) expression and collagen formation of fibroblast in filtration site after trabeculectomy in rabbit, and to discuss the mechanism for preventing scar formation with He-Ne laser in vivo. METHODS: The upper nasal limbus area next to the upper rectus muscle in right eyes received 10 minutes He-Ne laser irradiation (200mW/cm2) every day for three days, the left eyes served as control. Twenty-four hours after the last irradiation, both eyes of the rabbits were took trabeculectomy surgery. The expressions of CTGF in the filtration area were tested on the 7th, 14th and 28th day after surgery and collagen density was tested on the 14th and 28th day after surgery. Each of the time point had 7 rabbits. RESULTS: The expression of CTGF was lower than that of the control group's on the 7th and 14th day after trabeculectomy surgery (P=0.01, P=0.005). When examined on the 14th and 28th day, the collagen density of irradiation group were significantly lower than that of the control group's (P=0.013, P=0.01). CONCLUSION: Pretreating the filtration area with 200mW/cm2 He-Ne laser may be helpful in preventing scar formation after trabeculectomy in rabbit, possibly due to downregulation of the expression of CTGF and collagen synthesis in fibroblasts. He-Ne laser may be developed into a new scar preventing method in filtration surgery.

Inhibition of corneal neovascularization by vascular endothelia growth inhibitor gene

Hong Wang,Bing Wang and Zhen-Hai Zhang
AIM: To evaluate the effect of EffecteneTM lipofectine mediated plasmids encoding human pcDNA4-vascular endothelia growth inhibitor (pcDNA4-VEGI) gene on corneal neovascularization (CNV). METHODS: Forty New Zealand albino rabbits were sutured by 5-0 silk on the superior cornea to establish the animal model and divided into 4 random group, ten per each group: group A: transfected by pcDNA4-VEGI gene mediated by EffecteneTM lipofectine transfection, group B: by Plasmid pcDNA4, group C: by EffecteneTM, and group D: by normal saline. Length and area of CNV were measured under slit lamp every day after transfection, immunohistochemistry was used to detected the expression of VEGI protein in cornea at 3, 7, 14 and 21 days. RESULTS: Average occurrence of CNV in the pcDNA4-VEGI gene transfected group (group A) was 6.3 days, in plasmid pcDNA4 control group (group B) was 3.1 days, in EffecteneTM lipofectine control group (group C) was 3.2 days, in normal saline control group (group D) was 3.2 days. Differences between groups A and B, C, D were statistically significant (P<0.01), while differences in groups B, C and D were meaningless (P>0.05). Lenth and average area of CNV in each period in group A was meaningful different from that in groups B, C, and D (P<0.01), while differences in group B, C and D were meaningless (P>0.05). Immunohistochemistry result: VEGI positive cells could be seen in epithelium, stroma, endothelium and the cliff of CNV in group A at 3 days after transfection. VEGI cells changed with the decrease of CNV. None positive cells were in the control groups (groups B, C and D) all the time. CONCLUSION: EffecteneTM lipofectine transfection technique can be effectively used in transfecting pcDNA4-VEGI gene into rabbit cornea and the lenth and areas of CNV can be inhibited by VEGI gene.

Effect of alloxan time administerDrug on establishing diabetic rabbit model

Wen-Tao Sun,Chun-Ling Lei,Chun-Chao Bi,Zheng-Lan Chen and Lu Zhang
AIM: To explore the effect of alloxan time administerDrug on establishing diabetic rabbit model. METHODS: Thirty-six healthy rabbits, weighed 2-2.5kg, were randomly divided into one time administerDrug group (Group A, n=12), two times administerDrug group (Group B, n=12) and three times administerDrug group(Group C, n=12). Every rabbit was injected with alloxan of 150mg/kg. The three groups were measured for fasting blood-glucose. The success rate and death rate of each group were also calculated. RESULTS: The success rate of diabetic rabbit model in Group B was higher than that in Group A (P<0.01) but its death rate was lower than that of Group A (P<0.01); the success rate of diabetic rabbit model in Group C was highest but the death rate was the lowest in the three groups. CONCLUSION: Separate administration of alloxan can improve success rate in establishing diabetic rabbit model, decrease the death rate and keep the stability of model.

Influence of N2O4 on multifocal electroretinogram in winstar mice
AIM: To record multifocal electroretinogram from different dosage of N2O4 injected mice. In order to provide a foundation for further study. METHODS: Normal winstar mice which were injected by different dosage of N2O4 were studied for recording multifocal electroretinogram in the same time in the evening after N2O4 injection. RESULTS: The latency and amplitude density of "b" wave of each ring of multifocal electroretinogram was studied. The latency of "b" wave of each ring of multifocal electroretinogram of each group varies to each other. But the difference of the amplitude of "b" wave of multifocal electroretinogram of each ring between each group had no significance. CONCLUSION: Recording multifocal electroretinogram of N2O4 injected mice will give more support for further study in related science and clinic research.

Effect of Tetramethylpyrazine on RPE degeneration, choroidal blood flow and oxidative stress of RPE cells

Yi Shen,Pei Zhuang,Bao-Qin Lin,Wan-Yu Zhang and George CY Chiou
AIM: To study the effects of Tetramethylpyrazine (TMP) on retinal pigment epithelium (RPE) degeneration, choroidal blood flow and oxidative stress of RPE cells. METHODS: The 35mg/kg NaIO3-induced RPE degeneration rat eyes was given 25μg 1% TMP eye drops 3 times a day for 7 days before NaIO3 injection, and then 2 to 4 weeks after NaIO3 injection. RPE function was measured with c-wave of electroretinogram (ERG). Colored microsphere technique was used for in vivo experiments to determine the choroidal blood flow in ocular hypertensive (40mmHg) rabbit eyes. Methylthiazoltetrazolium (MTT) assay was used to study in vitro effect of TMP on various oxidants induced injury in the hRPE (ARPE-19 (ATCC, Manassas, VA, USA)) . RESULTS: Two weeks after NaIO3 injection, the amplitude of ERG c-wave fell markedly in NaIO3 group to 36% of control group(P <0.01). No apparent difference was observed in TMP+NaIO3 group. Four weeks later, the NaIO3 group fell to 46% of control group (P<0.01), while the TMP+NaIO3 group fell to only 77% of control group (P<0.01). There was a 67% reversal of the ERG c-wave by TMP as compared to NaIO3 group(P<0.01). The choroidal blood flow was significantly increased at all time points (at 30, 60 and 120 minutes after TMP instillation) as compared with corresponding controls. TMP had no effect on hypoxia-(1%O2), t-BHP- and H2O2-induced damage in RPE cells. 10(g/mL TMP could reverse 1 and 3mM NaN3-induced loss of viability of RPE by 18.5% (P <0.01) and 23% (P<0.01), respectively. 30μg/mL TMP could reverse 30 and 100mM NaIO3 induced loss of viability of RPE by 18.1% (P <0.05) and 16.8% (P <0.01), respectively. CONCLUSION: TMP can significantly protect RPE from NaIO3 induced degeneration in vivo and oxidative stress in vitro and can increase choroidal blood flow markedly in vivo.

Changes of the thiol levels in the corneas of the diabetic rats: effect of carnosine, aspirin and a combination eye drops

Qiong Shi and Hong Yan
AIM: To investigate the effect of carnosine (Car), aspirin (Asp) and a combination of Car and Asp eye drops on the change of the thiol contents from glutathione (GSH) and protein in the corneas of the diabetic rats. METHODS: All the animals were randomly divided into five groups. The normal control group received injections of vehicle only. Diabetes was induced by injection of streptozotocin (STZ) in the Sprague-Dawley (SD) rats. The untreated group rats received only the vehicle solution (the placebo). One treated group rats were treated by instillation of one drop of 10g/L Car eye drops, another were treated by 0.5g/L Asp eye drops and the last group were treated alternately by Car 10g/L and Asp 0.5g/L eye drops for a period of 8 weeks. At the end of 8 weeks, the animals were killed and the thiols contents in the corneas were investigated. RESULTS: About 15.6% of the rats (blood glucose measured <14mmol/L) were rejected. In the corneas, the levels of thiols were declined in the untreated, Asp-treated group and combination-treated group, but they went up in Car-treated group. The levels of thiols in the Car-treated groups were much higher than that in the untreated group, and there was statistically significant difference between them (P<0.05). CONCLUSION: The results indicated that diabetes decreases the levels of thiols (from GSH and proteins) in the cornea. The Car eye drops in our study may protect the cornea against the oxidative damage caused by diabetes. And the combination eye drops also may have a certain protection for the diabetic corneas.

Differentiation of mesenchymal stem cell in the microenviroment of retinitis pigmentosa

Dong-Mei Huo,Fang-Tian Dong,Wei-Hong Yu and Fei Gao
AIM: To access the differentiation of rat mesenchymal stem cell (MSC) in the microenvironment of retinal degeneration induced by the administration of sodium iodate. METHODS: In-vitro cultured Lewis rat MSC were injected into the sub-retinal space of NaIO3 induced retinal degeneration rat eyes (30g/L NaIO3 100mg/kg). To observe the trace and differentiation of MSC by immuno-fluorescent method successively in 5 weeks after the surgery. RESULTS: The majority of the transplanted cells stay in retinal pigment epithelium layer and cones & rods layer. From the 2nd week after transplantation, the engrafted MSC express PCK and rhodopsin under fluorescent microscope. CONCLUSION: MSC can survive mainly in the outer layer of retina in the microenvironment of retinal degeneration and differentiate forward the RPE cell and photoreceptor.

Effect of ginsenoside-Rg3 on the expression of VEGF and TNF-α in retina with diabetic rats

Hong-Quan Sun and Zhan-Yu Zhou
AIM: To investigate the effect of ginsenoside-Rg3 on the expression of vascular endothelial growth factor (VEGF) and tumor necrosis factor-α (TNF-α) in retina with diabetic rats and its roles in preventing neovascularization in diabetes. METHODS: Sixty male Wistar rats were divided into 3 groups randomly: negative control group, diabetic control group and ginsenoside-Rg3 treatment group (5mg/kg, 0.2mg/mL) followed by establishing diabetic model. The expression of VEGF and TNF-α were measured after 8 weeks. RESULTS: There were significant differences among negative control group, diabetic control group and ginsenoside-Rg3 treatment group in the expression of VEGF and TNF-α (F =129.363, 211.992; all the P <0.01). VEGF and TNF-α expression were significantly higher in diabetic control group and ginsenoside-Rg3 treatment group than that in negative control group (P <0.01), with a significant reduction in ginsenoside-Rg3 treatment group than that in diabetic control group (P <0.01). CONCLUSION: Ginsenoside-Rg3 can down-regulate the expression of VEGF and TNF-α in retina, which may interfere in the development of diabetic retinopathy.

VEGF expression and cell apoptosis in NOD mouse retina

Cai-Rui Li and Shu-Guang Sun
AIM: To investigate retinal vascular endothelial growth factor (VEGF) level and retinal cells apoptosis in the early stage of diabetic NOD mouse retina. METHODS: Animals were divided into non-diabetes group, (control) (2-, 4-, 6-, 8- and 12-week sub-groups, n=30) and diabetes group (2-, 4-, 6-, 8- and 12-week sub-groups, n=30). Enzyme-linked immunosorbent assay (ELISA) was performed to detect VEGF level in both serum and retina. Transmission electron microscope method was used to examine retinal cell apoptosis. RESULTS: Compared with the control group, VEGF levels in serum and retina were increased significantly in the NOD group (12 weeks: 4.9±0.4μg/g vs 0.19±0.1μg/g in serum sample, P<0.01; 165±9μg/g vs 17±5μg/g in retinal sample, P<0.01). There exists a positive correlation between serum VEGF and retinal VEGF levels in the early diabetic NOD mice (γ=0.9902, P=0.001). The number of the cells apoptosis in the ganglion cells and endothelium can also been found increased significantly in the NOD group (P<0.01). CONCLUSION: The high VEGF expression may be contributed to increased retinal cells apoptosis. Many factors associated with retinal VEGF expression might involve in the early diabetes stage.

Effect of flavone on the ocular blood flow and formation of choroidal neovascularization

Pei Zhuang,Yi Shen and George C Y Chiou
AIM: To investigate the effect of flavone on ocular blood flow in rabbit eyes and the formation of choroidal neovascularization (CNV) in rat model of age-related macular degeneration (AMD). METHODS: In in vivo studies, colored microsphere technique was used to determine the ocular blood flow in ocular hypertensive rabbit eyes. The rat eyes were treated with 0.5% flavone eye drops 3 times a day for 1 week before and 4 weeks after laser-induced injury of Bruch's membrane. The development of CNV was determined by fluorescein angiography (FA) performed on the 2nd and 4th after injury. In in vitro studies, the effect of flavone on the viability of human umbilical vein endothelial cells HUVECs was measured by MTT assay. RESULTS: The ocular blood flow in rabbit eyes was significantly increased after flavone instillation. Flavone significantly inhibited the formation of laser induced CNV. In vitro results showed that flavone inhibited the proliferation of HUVECs. CONCLUSION: Flavone could increase ocular blood flow and inhibit the formation of CNV.

Effects of flavone on the oxidation-induced injury of retinal pigment epithelium cells

Pei Zhuang,Yi Shen and George C Y Chiou
AIM: To investigate the effect of flavone on oxidation- induced injury in retinal pigment epithelium cells. METHODS: In in vivo studies, NaIO3-induced RPE degene- ration in rat eyes was treated with 0.5% flavone eye drops 3 times a day for 1 week before and 4 weeks after NaIO3 injection. At the end of 2 and 4 weeks, all rats were measured c-wave by electroretinogram (ERG). In in vitro studies, ARPE-19 cells were treated with hypoxia, H2O2, NaN3 and t-BHP to induce cell damages. MTT assay was used to measure the viable cells. RESULTS: The ERG c-wave results showed that flavone reversed NaIO3-induced injury at the end of 4 weeks. In vitro results showed flavone reversed the various oxidants-induced injuries in RPE cells. CONCLUSION: Flavone could prevent the RPE from oxidation- induced injury both in vivo and in vitro.

Identification of the preferentially targeted proteins by carbamylation during whole lens incubation by using radio-labelled potassium cyanate and mass spectrometry

Hong Yan,Jie Zhang and John J Harding
AIM: To attempt to identify the primary targets of carbamylation in bovine lenses incubated under physiological condition. METHODS: Fresh intact bovine lenses were incubated with [14C]-labelled potassium cyanate for seven days. The water-soluble proteins (WSP) of both cortex and nucleus lens were isolated by size-exclusion chromatography on a Sephacryl S-300HR column. The higher radioactive fractions were pooled and freeze-dried, and separated further by loading on an Affinity Blue column to separate some enzymes. In addition, WSP from cortex was separated directly by affinity chromatography. The most reactive fractions with higher radioactivity from [14C]-cyanate were further analyzed by SDS-gels and mass spectrometry. RESULTS: The majority of protein incorporating [14C]-labelled potassium cyanate was in the water-soluble fractions, and much more in the cortex than in the nucleus. Chromatography results demonstrated that the major incorporated [14C]-carbamylated crystallins were fractions corresponding to α-crystallin, β-crystallin and ξ-crystallin in the cortex, but β-crystallin and γ-crystallin in the nucleus. The SDS gels showed that bound fractions of cortex crystallins after Affi-Gel Blue separation were abundant with 20 and 35kDa proteins. However, the bound fractions of nucleus crystallins mainly showed 20kDa proteins. Mass spectrometry analysis of these higher radioactivity fractions and a database search revealed that the proteins were originated from bovine α-crystallin A and B chains and ξ-crystallin in the cortex; βA1 and αB-crystallins with a little γB-crystallin in the nucleus respectively. Further analysis suggested the location of this carbamylation of αB-crystallin in the nucleus to be at Lys 92 and 103. CONCLUSION: α-and ξ-crystallin from cortex can be prefe- rentially targeted by carbamylation during whole lens incubations. Carbamylation of these crystallins at the earlier stage may result in further unfolding and misfolding of lens proteins, leading to aggregation of crystallins and eventually to cataract formation.

Expression of Nogo-A on the retina in rat model with chronic ocular hypertension

Qing-Zhu Nie,Zhi-Li Liu,Qian Sha and Dian-Wen Gao
AIM: To study the expressive variation of Nogo-A on rat retina in the process of chronic ocular hypertension. METHODS: Thirty-six healthy adult male Wistars were randomly divided into control group (6 rats) and chronic hypertension group (30 rats). Chronic hypertension was created by cauterizing the superficial scleral veins. Immunohistochemistry technique was used to evaluate the expressive varieties of Nogo-A at different time points during the course of chronic ocular hypertension. RESULTS: The success of the model was indicated by over 40% of increase in the IOP as compared with normal rats. Compared with control group, as time passed chronic hypertension group gradually had detectable morphology changes in the retina. At the 21st day of chronic ocular hypertension, retinas became thinner and the quantity of retinal ganglion cells (RGC) decreased (P<0.05). Assoicated with the morphological changes, the expression of Nogo-A was strongly increased (P<0.05). CONCLUSION: Myelin associated protein Nogo-A plays a part in the process of chronic ocular hypertension.

Effects of extract of Buddleja officinalis on partial inflammation of lacrimal gland in castrated rabbits with dry eye
AIM: To assess the effects of extract of Buddleja officinalis on tear secretion volume, tear film stability, expressions of TGF-β1, IL-1β, TNF-α in lacrimal gland of castrated rabbits with dry eye. METHODS: A total of 30 victory rabbits were divided averagely into normal group(A), model group(B), therapy group with low dose extract of Buddleja officinalis (C), therapy group with high dose extract of Buddleja officinalis (D) and therapy group with genistein (E). The dry eye model was established with orchiectomy on Group B, C, D, E. Group C, D, E were administered intragastrically with corresponding dose extract of Buddleja officinalis or genistein for 30 days. All rabbits were detected with SIT. TGF-β1, IL-1β, TNF-α were detected with immunohistochemistry and the ultrastructure of lacrimal gland was observed under transmission electron microscope. RESULTS: The SIT value of group C, D, E were respectively 13.167±4.957, 14.667±5.279, 8.667±0.516, obviously higher than that of group B 5.667±2.338 (P<0.01). The positive expression of IL-1β in acinar cell and glandular tube cell of group C, D were 0.470±0.048, 0.510±0.088, obviously lower than that of group B 0.770±0.118 (P<0.01). The positive expression of TNF-α of group C, D were 0.498±0.156, 0.435±0.069, obviously lower than that of group B 0.769±0.095 too (P<0.01). The positive expression of TGF-β1 of group C, D were 0.406±0.171, 0.497±0.147, obviously higher than that of group B 0.222±0.113(P<0.01). Any result of group C, D was positive compared with that of group E (P <0.05). Ultrastructure of the lacrimal gland of group C, D, E was well preserved, especially in D group it was remarkable. CONCLUSION: The extract of Buddleja officinalis can adjust lacrimal gland partial inflammation of dry eye.

CTGFsiRNA ameliorates retinal cells apoptosis in streptozotocin-induced diabetic rats

Hong-Wei Yang,Xiao-Long Chen,Zhe-Li Liu,Jie Liu and Li-Min Bu
AIM: To detect the effect of connective tissue growth factor (CTGF) on the apoptosis in the diabetic retina with small interfering RNAs (siRNA) targeting CTGF. METHODS: A total of 60 rats were divided into 6 groups including control group, diabetic 4, 8, 12, 16 weeks groups, and interference group. Diabetic rats were induced by intraperitoneal streptozotocin (STZ). Retinas were obtained from control, diabetic rats and diabetic rats of interference group treated by intravitreal injection of CTGFsiRNA to suppress the expression of CTGF mRNA. Retinal cells apoptosis was detected by Tunnel staining and mRNA expression of CTGF was analyzed by RT-PCR. RESULTS: The levels of CTGF and the apoptosis in the retinas of diabetic rats were significantly higher than those in the controls. Apoptosis occurred at 4 weeks after a diabetic model being set up, became serious with the diabetes developing, while CTGF elevated at 8 weeks. The apoptosis cell counts increased to 25.8cells/mm2 at 24weeks of diabetes. SiRNA-mediated inhibition of CTGF mRNA resulted in a significant decrease in apoptosis. Significant correlations were found between CTGF and apoptosis in the retina. CONCLUSION: It was suggested that CTGF might be involved in retinal cells apoptosis which is a characteristic of early diabetic retina. SiRNA targeting CTGF seems to have the advantage of ameliorating retinal cells apoptosis.

Effect of microkeratome suction duration on corneal flap thickness and diameter in pigs

Xiao-Li Ma,Jian-Gang Xu and Han-Qiang Liu
AIM: To determine the effect of suction duration on thickness and diameter of corneal flap created by microkeratome in porcine eyes in laser in situ keratomileusis (LASIK). METHODS: Sixty porcine eyes were randomly assigned to three groups according to different suction durations: group 1 (10 seconds), group 2 (20 seconds), and group 3 (30 seconds). A Moria M2 microkeratome (Moria, France) with a 160μm head was used to create a corneal flap. Corneal flap thickness was measured by automated ultrasonic pachymetry, and the flap diameter was measured by a vernier caliper. RESULTS: The flap thickness of group 1, group 2 and group 3 was (146.05±13.46)μm, (157.35±18.95)μm and (169.25±21.02)μm, respectively. There was a statistically significant difference among three groups (P=0.001). The mean flap diameter in groups 1, 2 and 3 was(8.63±0.19)mm, (8.89±0.24)mm and (9.06±0.18)mm, respectively. A statisti-cally significant difference was found among groups (P<0.01). CONCLUSION: In LASIK in porcine eyes, an increase in suction duration resulted in a thicker and greater flap.

Apoptosis of lens epithelial cells induced by cinobufagin in vitro

Guo-Xing Xu and Ting-Ting Wang
AIM: To investigate the in vitro effects and mechanism of action of cinobufacini on apoptosis of lens epithelial cells (LEC). METHODS: Rabbit LEC were cultured for 72 hours with cinobufacini at different concentrations(0.0 [control], 0.1, 0.2, 0.3mg/L)．The inhibition ratio of cinobufacini acting on LEC was analyzed by ethyl thiazolyl tetrazolium(MTT); the changes in DNA structure, by electrophoresis, and the apoptosis rate, by flow cytometry. The mRNA expression of apoptosis-related genes bcl-2 and bax was examined using the reverse transcription-polymerase chain reaction (RT-PCR). RESULTS: At concentrations of 0.1mg/L-0.3mg/L, cinobufacini inhibited LEC proliferation. The inhibition ratio increased as the concentration of the drug increased. The typical DNA-ladders on electrophoretic gels were observed for extracts of LEC in the treated groups. The higher the drug concentration (0.1, 0.2, and 0.3mg/L) was, the higher the apoptosis rate (20.47±0.65%, 27.14±0.95%, and 33.49±0.77%, respectively) would be. The apoptosis rates in these groups were significantly different from those of the control group (P<0.01). With the drug concentration increasing, the mRNA expression levels of the pro-apoptotic bax increased, whereas those of the anti-apoptotic bcl-2 decreased. CONCLUSION: Cinobufacini can notably induce apoptosis of LEC by decreasing the ratio of bcl-2 to bax in vitro. With its low toxicity, this medication may be effective in the prevention and treatment of posterior capsule opacification．

The influence of He-Ne laser on scar formation after trabeculectomy in rabbits
AIM: To investigate the influence of He-Ne lasers on scar formation in the filtration canal after trabeculectomy in a rabbit model, as well as to explore the mechanisms for preventing scar formation when using He-Ne lasers in vivo. METHODS: Experiment 1: Four groups were established (four eyes in each group). In 12 eyes, the upper nasal limbus area next to the upper rectus muscle received 10 minutes of He-Ne laser irradiation (100, 150, 200mW/cm2; 60, 90, 120J/cm2) every day for three days. Four eyes served as controls. Twenty-four hours after the final irradiation, the rabbits were sacrificed and the irradiated tissue was excised, fixed with paraformaldehyde and tested for proliferating cell nuclear antigen (PCNA), connective tissue growth factor (CTGF) and apoptosis (TUNEL). Experiment 2: Forty-two rabbits were randomly divided into two groups and standard trabeculectomy was performed in the right eyes either after 200mW/cm2 He-Ne laser irradiation or not in the filtration area. The expression of PCNA and CTGF, apoptosis and collagen density in the filtration area were tested on the 7th, 14th and 28th day after surgery. RESULTS: Experiment 1: There were no more PCNA and CTGF positive cells in the He-Ne irradiation group than in the control group. No apoptotic cells were found in either group. Experiment 2: The expression of PCNA and CTGF was lower in the He-Ne irradiation group than in the control group on the 7th and 14th day after trabeculectomy surgery (P＜0.05); no apoptotic cells were detected in either group. Collagen density was significantly lower in the He-Ne irradiation group than in the control group on the 14th and 28th day after surgery (P＜0.05＝. CONCLUSION: Pretreating the filtration area with 200mW/cm2 (120J/cm2) of He-Ne laser irradiation may be helpful in preventing scar formation after trabeculectomy, possibly due to the downregulation of the expression of PCNA, CTGF and collagen synthesis in fibroblasts.

MMP-2 gene polymorphisms in type 2 diabetes mellitus diabetic retinopathy

Jie Yang,Xiao-Hui Fan,Yong-Qing Guan,Yan Li,Wei Sun,Xin-Zhi Yang and Rui Liu
AIM: To study the association between polymorphisms of the MMP-2 gene and diabetic retinopathy (DR). METHODS:MMP-2 C-1306T and C-735T SNPs was genotyped by polymerase chain reaction-restrictive fragment length polymorphism (PCR-RFLP) analysis in 151 DR patients and 150 healthy individuals served as control. RESULTS: There is no significant difference between the patient and control groups in allele or genotype distributions of MMP-2 C-735T (P=0.263 and P=0.248). Also, there is no significant difference between the patient and control in allele of MMP-2 C-1306T (P=0.03). However the result has significant deviation of C/C, C/T, T/T genotypic frequencies between the patient and control groups in MMP-2 C-1306T (P=0.008). We found that subjects with the MMP-2 C-1306T genotype had an overall 2-fold increase in the risk of developing DR [adjusted odds ratio (OR)=2.446; 95% confidence interval (CI)=1.239-4.829] compared with those with the T-1306T or C-1306T genotype. Stratification analysis showed that the MMP-2 -1306C/T and -735C/T SNPs are not associated with the development of NPDR to PDR of DR in North Chinese Han population. CONCLUSION: MMP-2 C-1306T genotypes may be associated with DR development in the Chinese population. However, there is no relationship between the MMP-2 C-735T genotypes with the development of DR.

F-heparin modified intraocular lenses in Rhesus monkeys

Gui-Qin Wang,Han-Qing Gu,Jia-Qin Yuan,Hui-Min Sun and Yan-Shan Xu
AIM: In order to improve the biocompatibility of intraocular lenses (IOL), the polymethylmethacrylate (PMMA) IOL was modified with F-heparin. METHODS: The PMMA IOL was modified with F ions and heparin by the technique of ion beam combined with low temperature and low pressure plasma. The monkeys (20 eyes) with cataract partly were randomly classified into 2 groups and implanted with PMMA IOL and modified IOL respectively for 180 days. All of the eyes were examined by slit-lamp microscope at postoperative 15, 30, 60, 90, 180 days. The extracted IOL was analyzed with computer image analysis, light microscope (LM) and scanning electron microscope (SEM) at postoperative 180 days. RESULTS: The early inflammatory reactions postoperatively include anterior chamber exudation and aqueous cell count. The modified IOL group showed less than the non-modified IOL group. The late foreign body cell reaction that adhered to the surface of non-modified IOL was more predominant. The morphologic and pathological changes of posterior capsule opacification (PCO) in monkeys' eyes included fibrosis-type, pearl-type and soemmerring's ring. There was a significant difference between the two groups. CONCLUSION: F-heparin modified IOL has good uveal and capsular biocompatibility.

Effect of adenovirus-mediated brain derived neurotrophic factor in early retinal neuropathy of diabetes in rats

Chao Wan,Ning-Ning Liu,Li-Min Liu,Na Cai and Lei Chen
AIM: To observe effect of adenovirus-mediated brain derived neurotrophic factor in early retinal neuropathy of diabetes in rats. METHODS: Adult male Wistar rats, 9 weeks of age, were injected intraperitoneally with STZ to induce diabetes. Two weeks after the models were established, Ad.BDNF was administered into the vitreous cavities of rats. Four weeks after the models were set up, the rats were killed and the retina was removed for Western blotting and whole-mount immunohistochemistry for tyrosine hydroxylase (TH) to observe the changes of TH and dopaminergic amacrine cells in retina. RESULTS: The protein levels of TH and the number of positive staining dopaminergic amacrine cells and the staining gray scale of experimental group without Ad.BDNF were lower statistically. But there was no statistically significant difference between the experimental group with Ad.BDNF and control group. CONCLUSION: In the early stage of STZ diabetic, the administration of Ad.BDNF into the vitreous cavities can increase TH protein levels and the density of dopaminergic amacrine cells in the STZ rats' retina.

Effect of naringenin on NaIO3-induced retinal pigment epithelium degeneration and laser-induced choroidal neovascularization in rats

Yi Shen,Wan-Yu Zhang and George C Y Chiou
AIM: To study the effects of naringenin eye drops on NaIO3-induced retinal pigment epithelium (RPE) degeneration and laser-induced choroidal neovascularization (CNV) in rat eyes. · METHODS: The 35mg/kg NaIO3-induced RPE degeneration was prevented by 10g/L naringenin eye drops 3 times a day for 7 days in advance of NaIO3 injection, and then 2 to 4 weeks thereafter, RPE function was measured with C-wave of electroretinogram (ERG). The laser-induced CNV rats were treated with laser to break the Bruch's membrane and the CNV formation was prevented by 10g/L naringenin eye drops instilled 3 times a day for 2 to 4 weeks. The CNV formation was measured with fluorescein angiography (FA) and flat mount. · RESULTS: Two weeks after NaIO3 injection, the amplitude of ERG C-wave fell markedly in NaIO3 group to 53% of normal group (P <0.01). No apparent difference was observed in naringenin+NaIO3 group. Four weeks later, the NaIO3 group fell to 37% of normal group (P <0.01), while the naringenin+ NaIO3 group fell to only 57% of normal group (P <0.01). There was a 52% reversal of the ERG C-wave by naringenin as compared to NaIO3 treated group (P <0.05). Two weeks and four weeks after laser treatment, naringenin reduced the CNV formation to 53% and 49% of control group (100%) measured by FA (P <0.01). Four weeks after laser treatment, naringenin reduced the CNV formation by 47% as compared to control group measured with flat mount(P <0.01). · CONCLUSION: Naringenin can significantly protect RPE from NaIO3 induced degeneration and also prevent CNV formation.

Proliferation of retinal pigment epithelial cells induced by (R,R)-XY-10 and (S,S)-XY-10 and their action mechanisms

Yu-Wen Cheng,Yu-Liang Wang,Yi-Hua Zhang,Si-Xun Peng and George C Y Chiou
AIM: To investigate the mechanism of proliferation effect induced by (R,R)-XY-10 and (S,S)-XY-10 on retinal pigmented epithelial cells (ARPE-19). · METHODS: Human retinal pigmented epithelial cells (ARPE-19) and human umbilical vein endothelial cells (HUVECs) were used to investigate the effect of (R,R)-XY-10 and (S,S)-XY-10 on cell growth, and their mechanisms of proliferative action by using ERK, AKT, PI3K, Protein kinase C (PKC) and Nitric oxide synthase (NOS) inhibitors. · RESULTS: (R,R)-XY-10 and (S,S)-XY-10 dose-dependently increased ARPE-19 cell proliferation, but not on HUVECs. When treated with proliferative inhibitors, H-7 (5μmol/L), hypericin (20μmol/L), PD98059 (2μmol/L), LY294002 (50μmol/L), SH-5 (10μmol/L) and L-NAME (100μmol/L), the proliferative effect was reduced by H-7, hypericin, PD98059 and LY294002, but not by SH-5 and L-NAME. · CONCLUSION: (R,R)-XY-10 and (S,S)-XY-10 can induce cell proliferation through MAPK and PI3K dependent pathway.

Influence of topical anesthetics on oculocardiac reflex and corneal healing in rabbits
AIM: To investigate the incidence of oculocardiac reflex (OCR) with two anesthetic regimens and its prevention using topical anesthetics in a rabbit model, and to explore the effect of topical anesthetics on corneal healing. · METHODS: Forty-eight clinically healthy adult New Zealand white rabbits of either sex were divided into two groups (Group A and B) and anesthetized with either ketamine (Group A, n =24) or propofol (Group B, n =24). he incidence of OCR was recorded in each group with a variety of ocular manipulation with or without the use of topical anesthetics (40g/L lignocaine, 5g/L proparacain, 5g/L bupivacaine). Corneal toxicity and healing following the use of each topical anesthetic was assessed one day after surgery and up to 7 days postoperatively by clinical examination of the eye, histopathology and collagen staining and transmission electron microscopy. · RESULTS: No incidence of OCR was recorded with ocular manipulation under ketamine anesthesia, whereas significant reduction in heart rate (P <0.01) was recorded under propofol anesthesia. Topical anesthetics could successfully prevent the OCR without affecting the corneal healing. · CONCLUSION: Topical anesthetics may be recommended for prevention of OCR without any local adverse effect.

Effect of pan-retinal laser photocoagulation on plasma VEGF, endothelin-1 and nitric oxide in PDR

Tarek Ahmed Mohamed and Sahar El-deek Mohamed
AIM: To study plasma levels of vascular endothelial growth factor (VEGF), endothelin-1(ET-1) and nitric oxide (NO) in patients with proliferative diabetic retinopathy (PDR) before and after pan-retinal photocoagulation (PRP). · METHODS: Forty patients (23 females and 17 males, mean age 48.5±12.2 years) with PDR without previous PRP therapy were studied. Blood samples were obtained before and 3 months after the last PRP session. Baseline (prelaser) plasma levels of VEGF, ET-1 and NO were compared with their levels in 30 healthy age- and sex- matched controls and also with plasma levels 3 months post-PRP. · RESULTS: Patients with PDR had significantly raised plasma VEGF (375±89ng/L), ET-1(20±5ng/L) and NO (135±53μmol/L) when compared with healthy control group (P <0.01). After PRP, there was a significant reduction in plasma VEGF (179±66ng/L), ET-1 (11±5ng/L) and NO (91±49μmol/L) levels at 3 months' follow-up but still significantly higher than healthy controls. · CONCLUSION: Patients with PDR demonstrate elevated VEGF, ET-1 and NO, which decrease after successful laser treatment.

Differentiation of human bone marrow-derived mesenchymal stem cells into neural-like cells by co-culture with retinal pigmented epithelial cells

Ling-Ling Yang,Qing-Jun Zhou,Yao Wang and Yi-Qiang Wang
AIM: To detect the differentiation effects of retinal cells or extracts on bone marrow-derived mesenchymal stem cells (BMSC). · METHODS: Human fetal BMSC were previously labelled by carboxyfluorescein succinimidyl ester (CFSE), and co-cultured with retinal pigment epithelial (RPE) cells which were pre-treated with ultraviolet irradiation at a ratio of 1:1 to induce the differentiation of BMSC for up to 14 days. In some assays, a retinal extract of bovine retinal extract (BRE) was added to detect the potential effects of retinal component on the differentiation of BMSC. In addition, Neuron-specific enolase (NSE), Nestin and Glial fibrillary acidic protein (GFAP) immunostaining were performed to determine the characteristics of BMSC. · RESULTS: The results indicated that by co-cultured with RPE cells, fetal BMSC were differentiated into neural-like cells expressing special neuronal markers Nestin, GFAP and NSE. And the expression of these markers was obviously increased by BRE. · CONCLUSION: Retina derived cells and extracts can induce the differentiation of BMSC into neural-like cells.

Influence of geranylgeranylacetone on the expression of HSP70 in retina of rats with chronic IOP elevation

Zhi-Li Liu,Ying-Rong Wang,Qian Sha and Qing-Zhu Nie
AIM: To study the effects of geranylgeranylacetone (GGA) on the expression of heat shock protein70 (HSP70) on retinal ganglion cells (RGC) in rats with chronic intraocular pressure (IOP) elevation. · METHODS: Seventy Wistars were divided into blank control group (10 rats), chronic hypertension group (30 rats) and GGA group (30 rats). Chronic hypertension was created by cauterizing the superficial scleral veins. 800mg/kg/d GGA was given by oral daily after cauterization. Immunohis- tochemistry was used respectively to observe the changes of expression of HSP70 in the model rats and GGA interference rats at different time points during the course of chronic IOP elevation. · RESULTS: The successful model was identified as the IOP over 40% of normal rats. The retinal thickness was significantly reduced in model group and model+GGA group compared with normal rats from 21 days through 28 days after cauterization (P <0.05), and that of model rats was obviously decreased in comparison with model+GGA rats (P < 0.05). The number of ganglion cells was significantly decreased in model rats and model+GGA rats compared with normal rats from 21 days and 28 days. The stronger expression intensity (IOD) value was seen for HSP70 in the model+GGA rats by immunochemistry (P <0.01). · CONCLUSION: Systemic administration of GGA protects retina from chronic IOP elevation by regulating the expression of HSP70.

Effect of Buddleia flavonoids drug-containing plasma on the expression of STAT1 phosphoprotein in lacrimal gland epithelial cells in vitro

Fang Wang,Qing-Hua Peng,Xiao-Lei Yao,Quan-Long Wu and Dian Li
AIM: To explore the effect of Buddleia flavonoids drug-containing plasma and androgen receptor (AR) blocker on the expression of STAT1 phosphoprotein. · METHODS: In vitro lacrimal gland epithelial cells were cultivated with H2O2 to establish the dry eye apoptosis state. Blank plasma group, Buddleia officinalis plasma total flavonoids interfere with drug-containing group, and the intervention group of testosterone propionate were set. The expressions of STAT1 phosphoprotein of each group were observed by Western blot. AR blocker flutamide was used to explore the intended androgen effect of Buddleia flavonoids. · RESULTS: After the intervention of drug-containing plasma, the expression of STAT1 phosphoprotein in Buddleja officinalis drug-containing plasma intervention group (0.353±0.494) and testosterone propionate intervention group (0.502±0.036) were enhanced and the differences between the two groups were significant (P <0.01). After using AR blocker, the expression of STAT1 phosphoprotein in each group (0.268±0.061, 0.283±0.106, 0.213±0.071) had no difference. · CONCLUSION: Buddleja officinalis drug-containing plasma total flavonoids can promote the expression of STAT1 phosphorylation.

Single nucleotide polymorphisms of metabolic syndrome-related genes in primary open angle glaucoma

Gang Zhou and Bin Liu
AIM: To analyze single nucleotide polymorphisms (SNP) of primary open angle glaucoma- and metabolic syndrome-related genes in primary open angle glaucoma (POAG), in order to elucidate the roles of metabolic syndrome as a risk factor in POAG progress. · METHODS: SNP genotypes and alleles of interleukin-6 (IL-6), IL-6 receptor (IL-6R), dopamine D2 receptor (DRD2), beta-fibrinogen (FGB), peroxisome proliferator-activated receptor-γ2 (PPARG), transforming growth factor-β1 (TGF-β1), E-selectin (E-Sel), apolipoprotein A-5 (APOA5), C-reactive protein (CRP), ectonueleotide pyrophosphatase/ phosphodiesterase 1 (ENPP1), hepatic lipase (LIPC), adiponectin (ADIPOQ), paraoxonase 1 (PON1) and serine protease inhibitor E (SERPINE1) genes in POAG (n =37) and normal control (n =100) groups were measured with ABI Prism 7900HT Fluorescence Quantitative PCR and TaqMan SNP Genotyping fluorescence probe kit. · RESULTS: Genotypes and allele frequencies of IL-6R, IL-6, FGB, CRP, ENPP1, LIPC, ADIPOQ, PON1, and SERPINE1 in total POAG group were significantly different compared to the control group. · CONCLUSION: Metabolic syndrome as a risk factor for POAG may be associated with genotypes and allele frequencies of the related genes. The corresponding gene expression and function can affect POAG progress, including roles of SERPINE1 in extracellular matrix, ENPP1 in insulin inhibition, IL-6 in endogenous neuroprotection, IL-6, IL-6R and E-Sel in autoimmune response, LIPC and FGB in blood hyperviscosity syndrome, ADIPOQ in NOS/NO production, PON1 in vascular endothelial protection.

Effects of extract of Buddleja officinalis eye drops on androgen receptors of lacrimal gland cells of castrated rats with dry eye

Qing-Hua Peng,Xiao-Lei Yao,Quan-Long Wu,Han-Yu Tan and Jing-Rong Zhang
AIM: To evaluate the effects of the extract of Buddleja officinalis eye drops in basic tears secretory volume, tear film stability, expression of androgen receptors (AR) in castrated rats with dry eye, and to investigate the therapeutic effects of the extract of Buddleja officinalis on dry eye caused by gonadal hormones level imbalance. · METHODS: Forty-five Wistar masculinity rats were divided at random into nine groups, including normal groups (A1, A2 and A3); model groups (B1, B2 and B3); therapy groups with extract of Buddleja officinalis eye drops (C1, C2 and C3). The "1" stood for being fed for 1 month, and "2" for 2 months, and "3" for 3 months. The dry eye model was established with orchiectomy on groups B and C. Group C was treated with Buddleja officinalis extract eye drops for one month. All rats were checked with Schirmer I test (SIT) and tear film break-up time (BUT). Expression of AR was analyzed by flow cytometer (FCM). · RESULTS: The SIT value of group C was significantly higher than that of group B (P <0.01) and the BUT value of group C was significantly longer than that of group B (P < 0.01), which indicated the eye drop could significantly keep basic tears secretory volume and tear film stability. And the expression of AR of group C was much higher than that of group B, which showed that available composition of the eye drops maybe display androgen-like activity. · CONCLUSION: The main components of the extract of Buddleja officinalis is the flavonoids that can significantly inhibit happening of dry eye of rat after androgen level lowered. Its mechanism is like androgen's and it can display androgen-like activity to keep basic tears secretory volume and tear film stability

Culture and identification of endothelial progenitor cells from human umbilical cord blood

E Song,Cheng-Wei Lu,Li-Jian Fang and Wei Yang
AIM: To elucidate a simple method for isolating endothelial progenitor cells (EPCs) from human umbilical cord blood mononuclear cells and observe the endothelial cell-specific expression profile during proliferation and differentiation in vitro. · METHODS: Human umbilical cord blood were isolated by Percoll density gradient centrifugation from human cord blood and cultured in vitro. The adherent cells were then identified by immunohistochemical staining and flow cytometric analysis. CD34, vascular endothelial growth factor receptor-2 (VEGFR-2), EPCs specific antigen CD133, as well as endothelial cell specific markers CD31 and vWF were used. The cells were characterized by acetylated LDL(acLDL) up-taking and lectin binding by direct fluorescentstaining. · RESULTS: During culture, the attached cells exhibited spindle-shape in early stage, and gradually display endothelium- like cobblestone morphology with outgrowth. On day 7, flow cytometric analysis showed that the positive staining rate of attached cells for CD133, CD34 and VEGFR-2 were 17.8%±3.7%, 22.1%±4.4% and 81.5%±5.0%, respectively. While, immunohistochemical staining showed that the adherent cells were positive to CD31 and vWF at the rate of 92.7%±2.2% and 73.3%±4.2%, respectively. By direct fluorescentstaining, we observed that 83.0%±4.3% of the attached cells were double positive for DiI-acLDL and FITC-UEA-I. · CONCLUSION: EPCs can be separated from human cord blood under certain conditions in vitro. This observation may provide a basis for study of relationship between EPCs and retinal neovascularization, as well as further clinical application of EPCs in ischemic retinal lesions.

Inhibitory effect of propylene glycol mannate sulfate on growth of rabbit lens epithelial cells in vitro

Jin Huang and Li-Na Xie
AIM: To investigate the inhibitory effect of rabbit lens epithelial cell (RLEC) survival and growth by propylene glycol mannate sulfate (PGMS) on the rabbit capsular bag in vitro. · METHODS: Capsular bags were prepared from rabbit eyes after extracapsular cataract extraction (ECCE) and incubated in 0.2, 0.4, 0.8g/L PGMS in 2, 5, 10 minutes incubation periods. After treatment, the capsular bags were cultured for 7 days in Dulbecco minimum essential medium (DMEM) supplemented with 50mL/L fetal calf serum (FCS). The specimens were examined with light microscopy and transmission electron microscopy (TEM). Capsular bags without receiving PGMS only served as controls. · RESULTS: PGMS inhibited the proliferation of RLEC in the manner of concentration and time dependent. At the threshold protocol of incubation in PGMS at 0.8g/L for 5 or 10 minutes, proliferative activity of cells were largely arrested and nearly no RLEC was seen on the posterior capsule (P < 0.05). Control group had no effect on structure and proliferative activity of RLEC, and the growth proceeded rapidly so that the posterior capsule were totally covered by a confluent monolayer of cell by the end of 7 days. Under TEM, the cells in the control group were tightly arrayed with clearly defined cellular boundary and structure; while cellular deformity and undefined intracellular structure could be seen in the 0.4g/L and 0.8g/L experimental groups. · CONCLUSION: PGMS can effectively inhibit the proliferation of RLEC.

Differences of bFGF gene expression in lens epithelial cells between fetuses and cataract patients

Yu-Fu Liu,Hong-Wei Liu and Yi Zhou
AIM: To study the differences of basic fibroblast growth factor (bFGF) gene expression in lens epithelial cells (LECs) between fetuses and cataract patients. · METHODS: In situ hybridization was used to detect bFGF mRNA in the LECs that were cultured and in tissue sections from fetuses and in the LECs from the anterior capsule of cataract patients. Image analysis was used for the relative quantitative analysis of bFGF mRNA. · RESULTS: bFGF gene existed in the LECs that were cultured and in tissue sections from fetuses and in the LECs from the anterior capsule of cataract patients. The integral absorbance for the fetal cultured cells, the fetal tissue sections and the capsule membrane cells of cataract patients were 627.1±268.7, 131.5±42.8 and 79.2±26.3 respectively. The integral absorbance of fetal cultured LECs was significantly higher than that of fetal section LECs (P <0.01). The integral absorbance of cataract LECs was significantly lower than that of fetal LECs (P <0.01). · CONCLUSION: The in vitro culture of LECs can improve bFGF gene expression. The bFGF gene expression in fetal LECs is significantly higher than that in cataract LECs.

Effects of endothelin-1 on the cytoskeleton protein F-actin of human trabecular meshwork cells in vitro
AIM: To observe the effect of endothelin-1 (ET-1) on the cytoskeleton protein F-actin of cultured human trabecular meshwork (HTM) cells. · METHODS: Cultured HTM cells were randomly divided into four groups: control group, low-dose ET-1 (10-9 mol/L) treatment group, middle-dose ET-1 (10-8 mol/L) treatment group, and high-dose ET-1(10-7 mol/L) treatment group. After treated with ET-1, the expression of cytoskeleton protein F-actin in trabecular meshwork was analyzed with Western-blot and the distribution of F-actin was detected with FITC-Phalloidin probe. · RESULTS: ET-1 dose-dependently and significantly increased F-actin in trabecular meshwork cells (P <0.05). The F-actin stress fiber and periphery actin fiber highly increased and manifested mild reorganization after treated with ET-1; and there were much more cell-to-cell and cell-to-extracellular matrix attachments formation in ET-1 treated HTM cells than that in the untreated HTM cells. · CONCLUSION: ET-1 promotes the expression of cytoske- leton protein F-actin and induced the trabecular meshwork actin cytoskeleton reorganization.

Experimental study on the photodynamic treatment of choroidal neovasculization with nanophthaloc-yanine photosensitizer

Song-Yi Wu,Guo-Xing Xu,Yi-Ru Peng,Xiao-Fang Zhou and Jian Guo
AIM: To investigate the therapeutic effects of nanophtha- locyanine photosensitizers on an experimental rat choroidal neovescularization (CNV) model, as well as to evaluate the cytotoxicity of which on human retinal pigment epithelia (HRPE) and human retinal endothelial cells (HRECs). METHODS: Two types of photosensitizers, G1-ZnPc(COOH)8 and G1-ZnPc(COOH)8/m respectively, were administrated for photodynamic therapy (PDT) after a successful establishment of CNV model on Brown-Norway (BN) rats via fundus photocoagulation. The therapeutic effects of the two drugs were assessed through optical coherence tomography (OCT), fluorescein fundus angiography (FFA) and transmission electron microscopy (TEM). For cytotoxicity tests, cell counting kit-8 (CCK-8) assays and changes of mitochondrial transmembrane potential (△Ψm) were conducted on HRPE and HRECs after initial uptake of the two drugs. RESULTS: Both photosensitizers demonstrated an improve- ment of vascular leakage and closure of CNV 1 week after PDT as confirmed by fundus image, OCT, FFA and TEM. Two weeks after PDT, G1-ZnPc(COOH)8/m showed a better CNV closure effect versus G1-ZnPc(COOH)8 (P<0.05). A significant difference (P＜0.01) was found in uptake of the two drugs in HRPE and HRECs, with no difference between the drugs(P＞0.05). Both photosensitizers showed cytotoxicity on HRPE, but G1-ZnPc(COOH)8/m induced a lower cell viability. CONCLUSION: G1-ZnPc(COOH)8/m mediated PDT is better than G1-ZnPc(COOH)8 in CNV closure and also have the advantage of fast metabolism leading to less side effect.

Study of self-made freeze-dried bilayered fibrin-binding amniotic membrane in ocular trabeculectomy in rabbits

Wan Li,Wen-Jian Che and Ming-Chang Zhang
AIM: To investigate the antifibrotic effect of freeze-dried bilayered fibrin-binding amniotic membrane on trabeculectomy in a rabbit model. METHODS: Twenty-four Japanese white rabbits were randomized into three groups: the experimental group (ocular trabeculectomy in combination with freeze-dried bilayered fibrin-binding amniotic membrane transplantation), the control group (ocular trabeculectomy in combination with natural bilayered fibrin-binding amniotic membrane) and the blank group (single trabeculectomy). Clinical observation, hematoxylin-eosin staining, Massion staining, real-time PCR and immunohistochemistry for α-SMA were performed on days 7, 14, 21 and 30 following surgery. RESULTS: Statistical differences were noted in survival analysis and intraocular pressure(IOP) among groups on days 7, 14, 21 and 30 following surgery. Histology, immunoh- istochemistry and real-time PCR further demonstrated that trabeculectomy in combination with freeze-dried bilayered fibrin-binding amniotic membrane resulted in good wound healing and no scar formation. CONCLUSION: Self-made freeze-dried bilayered fibrin- binding amniotic membrane may inhibit the formation of scarring in glaucoma after trabeculectomy.

Investigation of immunogenicity of cryopreserved limbal stem cells

Yan Zhang,Cui-Xia Li and Li Sun
AIM: To investigate changes in immunogenicity of cryopreserved limbal stem cells. METHODS: Cryopreserved limbal stem cells, fresh primary limbal stem cells and blank controls were inoculated subcutaneously in C57BL-6 mice and the percentage of CD25 cells in limbal explants was determined by flow cytometry at day 21 post inoculation. Morphological studies were performed by light and electron microscopy of limbal explant sections. RESULTS: The number of regional and systemic lymphocytes derived from cryopreserved limbal stem cells was lower than that from fresh primary limbal stem cells. CONCLUSION: Lymphocytes derived from cryopreserved limbal stem cells showed changes in immunogenicity, but the significance is unknown. The cryopreservation and thawing methods await further study.

Retinal stem cells transplantation combined with copolymer-1 immunization reduces interferon-gamma levels in an experimental model of glaucoma

Xia Zhou and Xiao-Bo Xia
AIM: To explore the effect of immunization with copolymer-1 (COP-1) and retinal stem cells (RSCs) transplantation on interferon-gamma (IFN-γ) levels in a rat experimental glaucoma model. METHODS: An experimental glaucoma was induced by argon laser photocoagulation of the episcleral veins and limbal plexus in the right eye of rats. Immediately following glaucoma induction, rats were immunized with COP-1. RSCs were cultured and transplanted intravitreally into the eyes of glaucoma model animals 1 week post-laser treatment. Six experimental groups were used: COP-1/RSC, PBS/RSC, COP-1/PBS, PBS/PBS, glaucoma model group, and a normal control group. The concentration of IFN-γ in aqueous humor (AH) and serum was measured by enzyme-linked immunosorbent assay (ELISA) in each of the six groups. Retinal ganglion cell (RGC) survival was assessed by quantifying apoptosis using Hoechst staining. RESULTS: Concentrations of IFN-γ in AH and serum of rats that had undergone glaucoma induction were higher than those of non-induced control rats. The concentrations of IFN-γ in AH and serum of the COP-1/RSCs treated group were determined to be 2371.9ng/L and 710.9ng/L, respectively, which were significantly lower than those in the other treated groups (P<0.05). In fact, IFN-γ levels in the dual treated group were reduced to background levels. The COP-1/RSC group had lower number of apoptotic RGCs than the other three experimental groups (P<0.05). CONCLUSION: The reduced levels of IFN-γ in AH and serum of the COP-1/RSC group may be related to synergistic effects between RSCs transplantation and COP-1 immune modulation. It is likely that the lower levels of IFN-γ prevented RGCs glaucomatous apoptosis.

Preventive effect of danhong huayu koufuye on diabetic retinopathy in rats

Bao-Qin Lin,Jiu-Yao Zhou,Yan Ma,Ying-Jun Deng,Chuan-Jie Zheng and Jun-Li Lin
AIM: To study the effects of danhong huayu koufuye (DHK) on fasting blood glucose (FBG) and diabetic retinopathy (DR) in streptozotocin (STZ)-induced type 1 diabetic rats to facilitate the rational usage of this drug. METHODS: Diabetic rats were induced by injection of a single dose of STZ intraperitoneally at 50mg/kg. Flash electroretinogram (FERG) and oscillatory potentials (OPs) were used to measure retinal function. The microvascular perfusion of ears was performed to study the microcirculation in rats. FBG, body-weight, and 24-h urine volume, water intake and diet intake were also assessed. RESULTS: DHK had no effect on FBG in normal rats. However, STZ + DHK group were significantly different from those of Model and moved toward those of normal control. It reversed the increase in diet intake(P≤0.05 vs model control) and the loss in body-weight(P≤0.05 vs model control) in diabetic rats. DHK decreased the FBG of diabetic rats by 25.6% (P≤0.05) and 37.9% (P ≤0.01) after 14 and 21 days administration as compared with the model control, respectively. Moreover, DHK significantly increased the FERG b-wave amplitude by 80% (P≤0.05 vs model control) and decreased the FERG b-wave latency by 15.3% (P≤0.01 vs model control) after 24 days administration. The OP1 and OP2 amplitudes in DHK group were 2.6 (P≤0.01) and 2.0 (P≤0.01) times of model group after 24 days of DHK treatment, respectively. At the same time, OP1 and OP2 latencies in DHK group reduced by 16.0% (P≤0.001) and 14.7% (P≤0.001) as compared with the model control, respectively. Furthermore, the microvascular perfusion of DHK group was 2.4 times of model group (P≤0.001) after 21 days administration. CONCLUSION: DHK had no effect on normal FBG. But it had antihyperglycemic activity, and had a preventive and therapeutic effect on DR in diabetic rats.

Control of peroxyntrite -induced production of inducible nitric oxide synthase isoforms and antagonism of cholecystokinin octapeptide-8 in retinal pigment epithelial cells in vivo

Li-Na Hao,Min Wang,Xu-Dong Zhang and Tao Yang
AIM: To explore if peroxyntrite （ONOO－) induced iNOS via Fas/ Fas/L pathway in diabetic rats and the effection of cholecystokinin octapeptide-8 (CCK-8) as therapeutic agent for decrease diabetic retinopathy. METHODS: Thirty-six rats were taken as control group, seventy two were given (streptozotocin) STZ (45mg/kg) and then divided into ONOO－group and CCK-8 group (peritoneal injection CCK-8). STZ-induced diabetic rats were treated with CCK-8 for 60 days. Western blotting analysis, DNA ladder, RT-PCR, immunohistochemistry and flow cytometry were used for determining the expression of nitrotyrosine (NT, the foot print of ONOO－); apoptosis and inducible nitric oxide synthase (iNOS) mRNA as well as Fas/Fasl signal transduction in RPE cells. RESULTS: Both RPE cells in ONOO－ and CCK-8 group developed apoptosis and expressed NT, iNOS mRNA and Fas/Fasl. But latter delayed the all changes in a time-dependent manner compared with control and ONOO－ group (P＜0.001). iNOS and Fas/Fasl were up-regulated and associated with an increase of expression of ONOO－in vivo. CONCLUSION: The study suggested that apoptosis of RPE was partly induced by ONOO－ may be the new way of oxidative damage to the RPE cells. CCK-8 decreased RPE cells apoptosis partly induced by ONOO－ and is a potential drug for therapy of diabetic retinopathy. The mechanism of CCK-8 dealing with RPE cells may be related to its direct inhibition of the formation of iNOS to produce ONOO－ and antagnism of damage of ONOO－ to RPE cells.

Side population cells from HXO-Rb44 retinoblastoma cell line have cancer-initiating property

Jun-Jun She,Peng-Ge Zhang,Xiang-Ming Che,Xuan Wang and Zi-Ming Wang
AIM: To ascertain whether side population(SP) cells in HXO-Rb44 retinoblastoma cell line have cancer stem cell-like property in vitro and in vivo . METHODS: We analyzed and sorted SP from HXO-Rb44 retinoblastoma cell line by Hoechst 33342 staining on flow cytometry. SP and NSP cells were determined their ability of proliferation and self-renewal by SP reanalysis, soft agar assay and tumor sphere assay in vitro. Clone formation was detected by seeding HXO-Rb44 and HXO-Rb44 -RFP cells into soft agar. The expression of ABCG2, MDRI, Bmi-1 and Oct-4 was determined by RT-PCR between SP and non-SP (NSP) cells. Moreover, they were injected into nude mice to determine their tumorigency in vivo. RESULTS: SP from HXO-Rb44 retinoblastoma cell line could grow clonally in soft agar assays and form tumor spheres from single cells in conditioned media. The expressions of ABCG2, MDRI, Bmi-1 and Oct-4 were significantly higher in SP than NSP cells. As few as SP cells resulted in tumor formation in 6 of 12 injected sites, however, the injection of NSP cells failed to form new tumor. CONCLUSION: SP cells isolated by Hoechst 33342 from the HXO-Rb44 retinoblastoma cell line had property of high tumorigency in vivo and in vitro. Therefore, SP might be a target while developing retinoblastoma therapies.

Proteome changes during bone mesenchymal stem cell differentiation into photoreceptor-like cells in vitro

Yu Hong and Guo-Xing Xu
Human bone marrow stem cell (BMSC) may be directed to differentiate into multiple cell types, including adipocyte, chondrocyte, osteocyte and photoreceptor, among others. At present, little is known about the features of the BMSC and the protein control mechanism underlying their differentiation into photoreceptor-like cells. In the present study, BMSCs are induced to differentiate into photoreceptor-like cells in an in vitro model simulating the in vivo microenvironment. Up to 32 proteins are identified and differentially expressed through two-dimensional difference gel electrophoresis and matrix-assisted laser desorption/ionization time-of-flight mass spectrometry to establish a differential protein database for photoreceptor-like cells from BMSC-induced differentiation. Western blot analysis further confirms the expression of some of the identified proteins. The present study proposes the total protein expression and possible molecular mechanism during the differentiation of BMSCs into photoreceptor cells.

Peroxynitrite-induced expression of inducible nitric oxide synthase and activated apoptosis via nuclear factor-kappa B pathway in retinal pigment epithelial cells and antagonism of cholecystokinin octapeptide-8 in vitro

Li-Na Hao,Xu-Dong Zhang,MinWang,Tao Yang and Shou-Zhi He
AIM: To explore that if peroxynitrite induced the expression of inducible nitric oxide synthase (iNOS)via nuclear factor-kappa B（NF-κB）pathway in retinal pigment epithelial (RPE) cells and the antagonism of cholecystokinin octapeptide-8 (Melatonin , CCK-8) in vitro . METHODS: RPE cells were obtained from eyes of C57BL/6 mouse and divided into control, peroxynitrite and CCK-8 groups. Control group was treated with saline, peroxynitrite group was treated with peroxynitrite, and CCK-8 group was treated with CCK-8 after added with peroxynitrite. All changes were observered at 6, 12 and 24 hours after treatment. Gene array analysis, Reverse Transcription Polymerase Chain Reaction (RT-PCR) were used to determine the expression of inducible nitric oxide synthase （iNOS）mRNA in RPE cells. Western blotting was used to test the apoptosis of RPE cells. Immunofluorescent staining was used to determine the NF-κB pathway signal transduction. RESULTS: Compared to the control group, the expression of iNOS mRNA was up-regulated in peroxynitrite group and down-regulated in CCK-8 group with gene array analysis. Apoptosis was increased in peroxynitrite group and decreased in CCK-8 group with western blotting. The NF-κB pathway signal transduction was more and more stronger in the peroxynitrite group. But in CCK-8 group, little stronger could be observed at 12 hours, then weak at 24 hours with immunofluorescent staining (P<0.001). CONCLUSION: This study suggested that apoptosis of RPE cells was partly induced by peroxynitrite, which may be the new way of oxidative damage to the RPE cells. The NF-κB signal transduction may affect and reinforce apoptosis mediated by peroxynitrite. CCK-8 decreased apoptosis of RPE cells induced by peroxynitrite and is a potential agent for therapy of retinopathy. The mechanism of CCK-8 dealing with RPE cells may be related to its direct inhibition of the formation of iNOS to produce peroxynitrite and antagnism of damage of peroxynitrite to the RPE cells.

Filtering bleb area and intraocular pressure following subconjunctival injection of CTGF antibody after glaucoma filtration surgery in rabbits

Jian-Ming Wang,Na Hui,Ya-Zhi Fan,Lei Xiong and Nai-Xue Sun
AIM: To study the role of connective tissue growth factor (CTGF) antibody in inhibiting bleb scarring after glaucoma filtration surgery (GFS) in rabbit model. METHODS: GFS was performed on both eyes in five rabbits. One eye of each rabbit was chosen randomly as antibody group and received subconjunctival injection of 0.1mL CTGF antibody (50mg/L) immediately after GFS applied and on the 5 th day after GFS. The other eye of each rabbit as control group was received subconjunctival injection of 0.1mL PBS at the same time as antibody group. On postoperative days 1, 3, 5, 7, 10, and 14, the appearance of filtrating blebs was observed under slit lamp, the area and the intraocular pressure (IOP) were measured with micrometer and applanation tonometer, respectively. RESULTS: On postoperative days 1, 3, 5, 7, 10, and 14, areas of filtrating blebs in antibody group were all larger comparing with the control group (P＜0.05) and IOPs of antibody group were lower than the control group(P＜0.05). CONCLUSION: Subconjunctival injection of CTGF antibody can maintain larger bleb area and lower IOP after GFS in rabbit.

Dynamic changes of ocular biometric parameters: a modified form-deprivation myopia model of young guinea pigs

Hai-Lan Zhao,Rui-Qin Wang,Miao-Qin Wu and Jin Jiang
AIM: To evaluate the dynamic ocular biometric changes of a modified form-deprivation myopia model in young guinea pigs. METHODS: The animals were randomly assigned to two groups: the monocularly deprived facemask group (MDF, with all the right eyes covered, n=24) and the normal control group(free of facemask, n=24). Each group was then equally divided into four subgroups which were followed up for 2, 4, 6 and 8 weeks, respectively. Parameters measured from every eye included refraction, corneal curvature, axial length and the dry weight of sclera at the posterior pole. RESULTS: All the facemasks remained in place during the follow-up. The covered eyes developed myopia with the vitreous chamber lengthening and the dry weight of posterior sclera reduced at each time point compared with the contralateral uncovered(P<0.05 at all time points). The changes had a linear correlation with the deprivation time (P<0.05). There were no significant differences in all the parameters between the uncovered eyes of MDF group and the normal control group (P>0.05 at all time points). CONCLUSION: Monocular form deprivation with the facemask is highly effective and non-invasive in inducing axial myopia in guinea pigs. The axial myopia is mainly caused by the increased vitreous chamber length and the weakened posterior sclera rigidity. The form-deprivation eye didn't interfere with the natural development of the contralateral eye.

Expression of MMP-2 and MMP-9 in retinoblastoma and their significance

Hua Long,Bo Zhou and Fa-Gang Jiang
AIM: To investigate the expression of matrix metallopr- oteinase-2 (MMP-2) and matrix metalloproteinase-9 (MMP-9) in retinoblastoma (Rb), and their relationships with tumor development stage. METHODS: Immunohistochemical technique was used to detect the expression of MMP-2 and MMP-9 in 41 cases of paraffin embedded Rb samples. Quantitative analysis of the expression of MMP-2 and MMP-9 was assessed by HMIAS-2000 Color Pathologic Analysis System. The differences of the expression of MMP-2 and MMP-9 in each clinical and pathological stage were analyzed statistically. RESULTS: In all the 41 Rb specimens, MMP-2 and MMP-9 expression was found in tumor cells. The expression of MMP-2 and MMP-9 was significantly higher in tumors with optic nerve invasion than in tumors without optic nerve invasion (P <0.05); the expression of MMP-2 and MMP-9 was significantly higher in tumors of extra-ocular stage than in tumors of glaucomatous stage or intra-ocular stage(P<0.05). CONCLUSION: MMP-2 and MMP-9 exist in retinoblastoma cells. The level of MMP-2 and MMP-9 is related to optic nerve invasion and clinical stage of Rb, which suggests the expression of MMP-2 and MMP-9 could be connected to the invasion and development of tumor cells. Further research is needed for deeper understanding of the biological behavior and better evaluation of the prognosis of Rb.

Potential involvement of nitric oxide synthase but not inducible nitric oxide synthase in the development of experimental corneal neovascularization

Yuan Chen,Gao-Qin Liu and Pei-Rong Lu
AIM: To investigate the effect of nitric oxide and its synthetase on experimental corneal neovascularization (CRNV). METHODS: CRNV was induced by alkali injury in mice, nitric oxide synthetase (NOS) was inhibited by NG-nitro-L-arginine (L-NAME) and inducible nitric oxide synthetase (iNOS) was inhibited by aminoguanidine hemisulfate salt (AG). The inhibitory effect was detected at day 2 and 4 after corneal alkali injury by reverse transcription polymerase chain reaction (RT-PCR). CRNV was compared between the control and the treated mice by microscopic observation and corneal whole mount CD31 immunostaining. RESULTS: The inhibition of L-NAME to NOS and AG to iNOS after corneal injury was confirmed by RT-PCR (P<0.05). Compared with control mice, L-NAME treated mice exhibited significantly decreased CRNV areas (P<0.05). In contrast, AG treatment failed to attenuate alkali induced CRNV (P>0.05). CONCLUSION: Our findings suggest that NOS but not iNOS plays a critical role in alkali injury induced CRNV.

Effect on multifocal electroretinogram in persistently elevated intraocular pressure by erigeron breviscapus extract

Xue-Jing Lu,Fu-Wen Zhang,Lin Cheng,Ai-Qin Liu and Jun-Guo Duan
AIM: To observe the effect on multifocal electroretinogram (mfERG) in persistently elevated intraocular pressure (IOP) by erigeron breviscapus extract (also named Dengzhanhua in Chinese) in rat models. METHODS: The rat models with persistently elevated IOP were established by the method of Akira. Then, erigeron breviscapus extract was given for one month to observe the effect on mfERG in persistently elevated IOP in rats. RESULTS: As elevated IOP went on, the mfERG changes were mainly in weaken of reaction density with progressive development. After intervention of erigeron breviscapus extract, the total peak latency of P1 wave had recovered to some extent and the difference was significant when compared with control group (P<0.05); the total response density and P1 wave response density in second circle had risen noticeably, which had significant differences than those of control group (P<0.05). CONCLUSION: Erigeron breviscapus extract can improve the impaired visual function of persistently elevated IOP in rats, suggesting that this extract is the effective part of erigeron breviscapus for optic neuroprotection.

Detection and comparison of matrix metalloproteinase in primary and recurrent pterygium fibroblasts

Mei-Xia An,Kai-Li Wu and Shao-Chun Lin
AIM: To detect and compare the levels of matrix metalloproteinases (MMPs) secreted by primary and recurrent human pterygium fibroblasts (HPFs). METHODS: Primary and recurrent HPFs as well as human conjunctival fibroblasts (HCF) were cultured in RPMI 1640 medium at the same conditions. The protein levels of MMP-1, MMP-3 and MMP-9 were determined by enzyme-linked immune sorbent assay (ELISA), respectively. RESULTS: 1) The protein level of MMP-1 in serum-free supernatant from cultured primary and recurrent HPFs was higher than that in normal HCFs (P<0.05); similarly, the protein level of MMP-1 in serum-free supernatant from cultured primary HPFs was higher than that in recurrent HCFs (P<0.05). 2) The protein level of MMP-3 in serum-free supernatant from cultured primary HPFs was higher than that in normal HCFs (P<0.05); meanwhile, the protein level of MMP-3 in serum-free supernatant from cultured recurrent HPFs was lower when compared with that in primary HPFs and normal HCFs (P<0.05). 3) MMP-9 was not detected in primary and recurrent HPFs in the conditioned medium. CONCLUSION: The protein levels of MMP-1 and MMP-3 in supernatant secreted by primary HPFs are different from recurrent HPFs. Different pathological mechanisms may exist between primary and recurrent pterygia.

Modulation of TGFβ2 and dopamine by PKC in retinal Müller cells of guinea pig myopic eye

Jun-Feng Mao,Shuang-Zhen Liu,Wen-Juan Qin and Qian Xiang
AIM: To investigate the effect of protein kinase C (PKC) on transforming growth factor-β2 (TGFβ2) and dopamine in retinal Müller cells of guinea pig myopic eye. METHODS: Myopia was induced by translucent goggles in guinea pig, whose retinal Müller cells were cultured using the enzyme-digesting method. Retinal Müller cells were divided into 5 groups: normal control, myopia, myopia plus GF109203X, myopia plus PMA, myopia plus DMSO. PKC activities were detected by the non-radioactive methods. TGFβ2 and tyrosine hydroxylase (TH) proteins were analyzed by Western Blotting in retinal Müller cells. Dopamine was determined by the high-performance liquid chromatography-electrochemical detection in suspensions. RESULTS: After 14 days deprived, the occluded eyes became myopic with ocular axle elongating. Müller cells of guinea pigs were obtained using enzyme digestion. Compared with normal control group, the increase in PKC activity and the up-regulation in TGFβ2 expression were found in retinal Müller cells of myopic eyes, with the decrease of TH and dopamine content (P<0.05). After PKC activated by PMA, TGFβ2 and TH content were up-regulated with the increase of dopamine content (P<0.05). While the PKC activities was inhibited by GF109203X, proteins of TGFβ2 and TH were down-regulated in the myopic eyes, with the decrease of dopamine content (P<0.05). CONCLUSION: TGFβ2 and dopamine are modulated by PKC in Müller cells of the myopic eyes in guinea pig.

Efficacy of intravitreal captopril on oxygen-induced retinopathy in mice

Yu Di,Yi-Ou Zhang,Yang Yang,Ai-Yuan Wang,Yan Lu and Xiao-Long Chen
AIM: To study the inhibitory effect of intravitreal captopril on oxygen-induced retinopathy (OIR) in mice. METHODS: Eighty postnatal day (P)7 C57BL/6J mice were randomly divided into treated group and control group with forty mice in each group. The mice were exposed to 75% ± 2% oxygen for 5 days (P7-P11) and then returned to room air for 5 days (P12-P17) to induce retinal neovascularization (RNV). Beginning on P12, the mice in treated group received daily intravitreal injections of captopril (3.0mL/kg), while those in control group received daily intravitreal injections of phosphate-buffered saline (PBS) (3.0mL/kg) through P17. After anesthetized at P17, one eye was chosen randomly as experimental eye and were enucleated. RNV was examined by Adenosine diphosphate-ase (ADPase) stained retina flat-mounts and was quantitated histologically by counting the neovascular endothelial cell nuclei anterior to inner limiting membrane (ILM). The expressions of matrix metalloproteinase-2 (MMP-2) and vascular endothelial growth factor (VEGF) were measured by immunohistochemical method. RESULTS: Comparing with control group, more regular distributions, better branch and reduced density of RNV were observed in eyes of treated group. The number of neovascular cell nuclei was less in treated group than that in control group (t=6.135, P<0.01). Stain of MMP-2 and VEGF was weaker in treated group than that in control group. CONCLUSION: The results indicate that captopril can significantly inhibit RNV in OIR mice.

αB-crystallin malondialdehyde, superoxide dismutase, and lutathione peroxidase changes in X-ray irradiated rat lens
AIM: To evaluate αB-crystallin malondialdehyde (MDA), superoxide dismutase (SOD) and glutathione peroxidase (GPx) changes in X-ray irradiated rat lens. METHODS: Eight-week-old Sprague-Dawley male rats received X-ray irradiation to the head with rest of the body protected. The exposure dose ranged from 2 to 25 Grays (Gy). The cataract status were examined by slit lamp and rated with “four-grade systems” post-irradiation. The lens MDA level, and the activities of SOD and GPx were measured in a short-term experiment post-irradiation, and αB-crystallin protein levels were quantified. RESULTS: The lenses of normal control and the X-ray irradiated groups with the dose up to 10 Gy remained transparent throughout the experiment. The lens first appeared tiny scatters, and even lamellar opacities in the posterior capsule 45 days post-irradiation with the dose of 15 Gy, and progressed slowly to the advance stage of cataract; while, for the higher dose (25 Gy), the opacity of lens appeared much earlier, and progressed more rapidly to mature stage of cataract within 1 month. At the end of the observation (90 days post-irradiation), almost all lenses became complete opacity with the higher dose (25 Gy). The degree of lens opacity was rated accordingly. The lens MDA level was increased, and SOD and GPx activities were decreased with a dose-dependent manner post-irradiation. The αB-crystallin protein level was decreased dose-dependently at the end point of observation. CONCLUSION: Oxidative events and αB-crystallin may play important roles in the pathogenesis of cataract in X-ray irradiated rat lens.

Experimental model of Fusarium solani keratitis in rats

Jiang-Li Zhu,Xin-Rui Gao,Hong-Ping Cui,Li-Li Lang,Qian Li and Xin Liao
AIM: To establish a repeatable rat model of Fusarium solani keratitis (F. solani keratitis) that mimicked fungal keratitis in humans. METHODS: Wistar rats’ corneas were scratched on the superficial stroma after scraping the unilateral corneal epithelia. Then, the corneal surface was inoculated with different inoculum dose of F. solani spore suspension. Doses ranged from 106 to 109 colony-forming unit per milliliter (CFU/mL). The treated corneas were covered by contact lenses that were made of Parafilm M membrane. Negative controls were inoculated with sterile phosphate-buffered saline (PBS). For statistical analysis, corneas were evaluated daily on a 12-point scale to check the state of corneal inflammation. Furthermore, the pathological characteristics of this model were investigated. RESULTS: The rat model of F. solani keratitis was established by the combination methods of corneal trauma and parafilm-made contact lens and inoculation of fungus spore suspension. 106 and 107CFU/mL of F. solani induced mild corneal infection, while 108CFU/mL of F. solani was sufficient to induce moderate infection that was consistent with human keratomycosis. Dose of 109CFU/mL of F. solani was excessive and led to perforated corneas. CONCLUSION: The rat model of F. solani keratitis, established by the combinational methods of corneal trauma, parafilm-made contact lens and the appropriate dose of inoculum, that imitates the developing processes of F. solani keratitis in human beings and provides a repeatable method of creating a rat model.

Protective effect of Lycium barbarum polysaccharide on retinal ganglion cells in vitro

Min Yang,Na Gao,Ying Zhao,Li-Xia Liu and Xue-Jing Lu
AIM: To observe the effect of Lycium barbarum polysaccharide (LBP) on rat retinal ganglion cells (RGCs) in vitro. METHODS: Retinal cells of neonatal Sprague-Dawley rats were collected 1 to 3 days after birth, and co-cultured with different concentrations of LBP for 24 hours. Absorbance values (OD) were recorded using MTT assay for calculating survival rates. RESULTS: All the test groups had protective effects on RGCs. The group with 10mg/mL concentration of LBP had the most significantly difference of OD value compared with that in control group (P<0.01). CONCLUSION: LBP can increase the survival rate and promote the growth of mixed cultured rat RGCs.

Inhibitory effect of biopolymer materials on scar formation following trabeculectomy

Qian Sha,Guang-Yu Jiao,Hai-Bin Cui,Wang Jie,Li-Bin Sun,Ming Chen and Song-Bin Fu
AIM: To investigate the inhibitory effects of amniotic membrane, polylactic acid membrane and chitosan membrane on scar formation following trabeculectomy. METHODS: A total of 24 New Zealand white rabbits (48 eyes) were randomly divided into 4 groups: amniotic membrane group, polylactic acid membrane group, chitosan membrane group, and control group, with 6 rabbits (12 eyes) in each group. The left eyes underwent routine trabeculectomy, and the right eyes were considered as controls. Amniotic membrane, polylactic acid membrane and chitosan membrane were respectively installed under sclera flap in three groups, but any treatment was not applied in control group. Intraocular pressure, conjunctival filtering bleb, and anterior chamber inflammation responses were monitored at day 1, 3, 7, 14, 28 and 56 post-operatively. Eyeball tissue underwent histopathological examination at day 56 post-operatively. RESULTS: Fibrocytes and inflammatory cells were reduced in amniotic membrane, polylactic acid membrane and chitosan membrane groups compared to that in control group. At day 1 post-operatively, intraocular pressure was decreased in three membrane groups compared to that in control group. At day 14 post-operatively, the intraocular pressure was decreased significantly, while it of three membrane groups was significantly lower than that of preoperative (P<0.01). There were no significant differences among three membrane groups (P>0.05). Filtering bleb of four groups was clearly observed at day 7 post-operatively, but there was no significant difference in pair-wise comparison. At day 28 and 56 post-operatively, filtering bleb in control group was significantly narrowed compared to that in three membrane groups (P<0.05), but there was no significant difference in pair-wise comparison of three membrane groups. CONCLUSION: All amniotic membrane, polylactic acid membrane and chitosan membrane can effectively inhibit scar formation following trabeculectomy, the effect of amniotic membrane is the best.

Effect of basic fibroblast growth factor on cat corneal endothelial cell proliferation

Wen-Juan Luo,Yang Zhou,Mei-Guang Liu and Chuan-Fu Wang
AIM: To investigate the function of basic fibroblast growth factor (bFGF) on cat corneal endothelial cells proliferation. METHODS: Cat corneal endothelial cells were primarily cultured, stimulated with bFGF for different period, the proliferation of cells was assayed by modified tertrozalium salt (MTT) method, and the morphologic changes were observed with inverted phase contrast microscope and transmission electron microscope. RESULTS: At 1, 3 and 5 days after bFGF was added to cat corneal endothelial cells, the result of MTT in 490nm showed significant difference than that in control group, and the difference was most significant in 10ng/mL group. CONCLUSION: bFGF can promote proliferation of cat corneal endothelial cells. 10ng/mL is the relatively most effective dose.

Survivin and p53 expression in primary and recurrent pterygium in Chinese patients

Li-Wei Zhang,Bai-Hua Chen,Xing-Hua Xi,Qian-Qian Han and Luo-Sheng Tang
AIM: To assess the expression of anti-apoptotic protein survivin and tumor suppressor p53 protein in primary and recurrent pterygium and to investigate the relationship between them. METHODS: Survivin was assessed immunohistochemically using rabbit polyclonal antibody and p53 using mouse monoclonal antibody in a study sample of 20 cases of primary pterygium, 10 cases of recurrent pterygium and 10 cases of normal conjunctiva. RESLULTS: In our study, 35% of primary (7 of 20) and 40% of recurrent (4 of 10) pterygium specimens were positive for survivin staining; 45% of primary (9 of 20) and 50% of recurrent (5 of 10) pterygium specimens were positive for p53 expression; and all normal conjunctiva showed no staining of either survivin or p53. The p53 and survivin immunoreactivity in primary and recurrent pterygium groups was greater than those in normal conjunctiva group (P<0.05). There were no differences in p53 and survivin immunoreactivity between groups of primary and recurrent pterygium (P>0.05). The expression of survivin clearly segregated with p53-positive pterygium as compared with p53-negative cases [8 of 14 cases (57.1%) vs 3 of 16 cases (15.2%)]. The Fisher's exact test analysis confirmed a highly statistically significant correlation between survivin and p53 expression (P<0.05). CONCLUSION: The survivin and p53 are overexpressed with correlation between them in primary and recurrent pterygium.

Expression of neuroglobin in ocular hypertension induced acute hypoxic-ischemic retinal injury in rats

Shao-Yang Shi,Xue-Mei Feng,You Li,Xun Li and Xiao-Long Chen
AIM: To investigate the expression of neuroglobin (Ngb) in the retina of rats with ocular hypertension induced acute retinal hypoxic-ischemic injury. METHODS: Seventy Wistar rats were divided into 7 groups randomly. The experimental model was induced by elevation of intraocular pressure via anterior chamber canula insertion in the left eyes and the fellow eyes were preserved as normal controls. The retinal tissues were taken at 1, 5, 10, 15, 20, 30 and 60 minutes after hypoxic-ischemia injury. Protein was extracted, and then analyzed by Western-blot method. SPSS was used for statistical analysis. RESULTS: The time-depended expressions of Ngb were observed. The level of Ngb increased rapidly at 1 minute after ischemia and reached to the peak at 5 minutes, which had significant difference from that of control group (P<0.05). It kept in high level during 5-15 minutes (P<0.05), then decreased after 20 minutes till 60 minutes. There were no significant differences between experimental and control group in the latter period (P＞0.05). CONCLUSION: The expression of Ngb in retinal tissue increased rapidly after hypoxic-ischemic injury in rats, suggesting that Ngb may play an important role in the process of acute retinal hypoxic-ischemic injury.

TGF-β1 in retinal ganglion cells in rats with chronic ocular hypertension: its expression and anti-apoptotic effect

Dian-Wen Gao,Yong-Jian Tao and Miao Yu
AIM: To investigate the anti-apoptotic effect of transforming growth factor beta-1 (TGF-β1) on chronic ocular hypertension. METHODS: The expression of TGF-β1 in retinal ganglion cells (RCGs) was measured using the immunohistochemiscal S-P method and real-time PCR in the normally control group, the ocular hypertension group (experimental group A), the ocular hypertension plus antibody intervention group (experimental group B) and the ocular hypertension plus antigen intervention group (experimental group C) at 1, 2, 3 and 4 weeks postoperatively. The count of apoptotic RCGs was measured using the TUNEL method. RESULTS: The expression of TGF-β1 was significantly higher in experimental group C than that in other three groups (P＜0.05). The expression was the lowest in experimental group B (4.17%). A statistically significant difference was noted between the four groups (P<0.01). The count of apoptotic RCGs was statistically significantly lower in experimental group C than that in the experimental groups A and B (P<0.01). A statistically significant difference was noted in the count of apoptotic RCGs between these three experimental groups (P<0.01). CONCLUSION: TGF-β1 can inhibit the apoptosis of RCGs in rats with chronic ocular hypertension.

Arg124Cys mutation of the TGFBI gene in a Chinese pedigree of Reis-Bücklers corneal dystrophy

Qiao-Na Yang,Yong-Wang Zhao,Li-Heng Guo,Nai-Hong Yan,Xu-Yang Liu and Su-Ping Cai
AIM: To analyze mutations in transforming growth factor beta-induced (TGFBI) gene in a Chinese pedigree with Reis-Bücklers corneal dystrophy (RBCD, also known as GCD3). METHODS: In a five-generation Chinese family, eight members were identified with RBCD and the rest were unaffected. All members of the family underwent complete ophthalmologic examinations. Exons of TGFBI were amplified by polymerase chain reaction, sequenced, and compared with a reference database. RESULTS: A single heterozygous C>T (R124C) point mutation was found in exon 4 of TGFBI in all the affected members of the pedigree, but not in the unaffected members. CONCLUSION: R124C which was a known mutation for lattice corneal dystrophy type I, segregated with the RBCD in this pedigree. This elucidated the correlation between genotype and phenotype in a Chinese family of RBCD.

Inhibition of latrunculin-A on dexamethasone-induced fibronectin production in cultured human trabecular meshwork cells

Yun Wang,Juan Tan,Ye-Hong Zhuo,Cui-Lan Wang,Xu-Yang Liu and Su-Ping Cai
AIM: To determine the effects of a low dose latrunculin (LAT)-A on dexamethasone (Dex)-induced upregulation of extracellular matrix proteins fibronectin (FN) in cultured human trabecular meshwork (HTM) cells. METHODS: HTM cells were cultured to confluent and incubated with 0.4μmol/L Dex and/or 0.05μmol/L LAT-A. FN expression in HTM cells was evaluated by Western blot and immunofluorescence microscopy. RESULTS: Dex up-regulated FN production in HTM cells, failed to do so when co-incubated with LAT-A. LAT-A decreased production of FN in cultured HTM cells. CONCLUSION: This study indicated that LAT-A may modulate the expression of fibronectin in trabecular meshwork to achieve treatment for steroids and other types of glaucoma. It has an important prospect as an intraocular pressure- lowering drug.

Erythropoietin receptor antibody inhibits oxidative stress induced retinal neovascularization in mice

Jin-Hui Wu,Yu Gao,An-Jing Ren,Ming Zhong and Lin Liu
AIM: To observe the effect of erythropoietin receptor antibody(EpoRA) on oxygen-induced retinal neovascu- larization. METHODS: C57BL / 6J mice, newly born 7 days, were exposed in high oxygen for 5 days and then placed in normal air for another 5 days, thus the animal models of retinal neovascularization were made. Experimental animals were allocated into 3 groups: normal, experimental and therapeutic. The normal group was fed in the normal environment. Into the vitreous cavity of mice in the therapeutic group were injected 2μL of EpoRA for 5 successive days. And the experimental group was injected the same amount of normal saline. Mice were sacrificed 17 days after birth and their eyeballs were removed for detection of malonaldehyde(MDA) content in the retina and by HE staining endothelial cells were counted the breaking through internal limiting membrane. RESULTS: In the experimental group, MDA content in the retina was 25.11±3.46μmol/g , which was obviously less than those in the normal group(5.34±1.79μmol/g, P<0.01) and those in the therapeutic group (12.04±1.91μmol/g). Pathological sections showed the nuclear number of the endothelial cells breaking through internal limiting membrane was 0.7±0.2 in normal group, and 46.2±6.5 in high oxygen induced experimental group. In the therapeutic group injected with EpoRA, it was lowered to 24.0±5.0(P＜0.01). CONCLUSION: EpoRA can effectively inhibit oxygen- induced neovascularization in retina of mouse by reducing oxidative damage.

Effect of calcium on the proliferation and differen-tiation of murine corneal epithelial cells in vitro

Xiao-Li Ma and Han-Qiang Liu
AIM: To investigate the effect of calcium on the proliferation and differentiation of murine corneal epithelial cells in vitro. METHODS: Mouse corneal epithelial cells were cultured in serum-free low-Ca2+ medium (KSFM) and KSFM supplemented with 0.9mmol/L Ca2+. Population doublings (PDs) were determined. The expression of corneal epithelial cell markers p63, keratin 19 (K19) and involucrin was investigated by RT-PCR analysis and semiquantitative analysis of Western blotting. RESULTS: Cells in KSFM were stably subcultured over 25 passages, however, none of the cell lines could pass P4 in KSFM with Ca2+. In KSFM, the cells was were homogeneous and small cells with typical cobblestone appearance; and expressed p63, K19 and involucrin. After medium was supplemented with calcium, cells became a heterogeneous mix of small and large cells. Furthermore, semiquantitative analysis of Western blotting showed that the expression of involucrin was increased significantly. CONCLUSION: Calcium has the effect of inhibiting pro- liferation and triggering differentiation on mouse corneal epithelial cells.

Toxicity of endogenous peroxynitrite and effects of puerarin on transplanted retinal pigment epithelial sheets in the subretinal space in mice
AIM: To evaluate the toxicity of endogeneous peroxynitrite on transplanted retinal pigment epithelial (RPE) sheets and the effect of puerarin on their survival in the C57BL/6 mice after RPE sheets have been transplanted into SD rats' subretinal space . METHODS: C57BL/6 mice eyes were used to culture RPE cells. Ninety-six SD rats were involved in the experiment. They were divided into control（block control） , streptozotocin(STZ, negative control), untransplanted RPE (positive control) and transplanted RPE groups respectively. Diabetes was induced in SD rats by intra-peritoneal STZ injection in the latter three groups. Saline was injected into the subretinal space of 24 SD rats in the untransplanted RPE group and primary RPE sheets were injected into the subretinal space of 24 SD rats in the transplanted RPE group. Puerarin (45mg/kg) was administrated into both untransplanted RPE and transplanted RPE groups of diabetic rats through intra- peritoneal injection route after RPE sheets transplantation. At 20，40，60 days after surgery，Western blotting analysis, DNA ladder and RT-PCR were used for determining the differences in expression of nitrotyrosine (NT, the foot print of peroxynitrite ), apoptosis and iNOS mRNA in the control, STZ, untransplanted RPE and transplanted RPE groups respectively. HE staining was used for determining the RPE survival in the subretinal space of the transplanted RPE group. RESULTS: Apoptosis and expression of NT and iNOS mRNA were observed in STZ, untransplanted RPE and transplanted RPE groups, but were delayed in untransplanted RPE and transplanted RPE groups in a time-dependent manner compared with control and STZ groups (P＜0.01）. There were no differences between the two groups (P>0.01). NT, DNA ladder, iNOS mRNA were down-regulated, which were associated with the decrease of expression of peroxynitrite. Numerous pigmented cells emerged and increased in number in the subretinal space during the 60-day observation period after transplantation. On day 20, heavily pigmented cells were visible at the transplant site; On day 40, monolayer and multilayered transplant was visible in the subretinal space; On day 60, heavily pigmented monolayer and multilayered transplants with round apical profile were present along Bruch's membrane. CONCLUSION: Puerarin increased the 60-day survival of C57BL/6 mice RPE xenografts in the SD rats' subretinal space, which may be related to its direct inhibition of apoptosis of RPE cells and antagnism of damage of peroxynitrite to RPE cells.

Mechanisms of inhibition of elemene on human lens epithelial cell proliferation in vitro

Yan-Hong Hu,Xiu-Rong Huang,Ming-Xin Qi and Bu-Yuan Hou
AIM: To study the effects of elemene (Ele) on proliferation and cell cycle of human lens epithelial cells B3 (HLE-B3) and the mechanisms of its signal transduction. METHODS: Recombinant human basic fibroblast growth factor (rhbFGF) was used to induce proliferation of HLE-B3 cells, which were incubated with 80mg/L Ele for 24 hours. The inhibitory effects of Ele on the proliferation of HLE-B3 cells were evaluated by MTT method. The effect of Ele on HLE-B3 cell cycle was analyzed by flow cytometry(FCM). The expressions of protein kinase A (PKA) and protein kinase G (PKG) of HLE-B3 were also analyzed by FCM. RESULTS: Ele altered the cell cycle of HLE-B3 and effectively inhibited HLE-B3 cell proliferation induced by rhbFGF. Ele up-regulated PKA and down-regulated the expression of PKG in HLE-B3 cell. CONCLUSION: Ele inhibits HLE-B3 proliferation, making it an attractive potential agent in regimens to treat after- cataracts.

Effect of aminoguanidine on caspase-3 expression in rat retina after ischemia-reperfusion injury

Yang Yang,Jing-Zhu Duan,Dong-Mei Gui,Hong-Wei Yang and Dian-Wen Gao
AIM: To investigate the effect of aminoguanidine(AG) on the expression of caspase-3 in rat retina after ischemia- reperfusion injury. METHODS: The rats were anesthetized with 30mg/kg sodium pentobarbital introperitoneal(ip) injections. After topical application of 10g/L dicaine，the anterior chamber was punctured with a 5-gauge needle connected to a bottle containing normal saline. Intraocular pressure was raised to 100 mmHg by elevating the saline container. The infusion needle was removed from the anterior chamber 60 minutes later. Reperfusion of the retinal vasculature was confirmed by fundus examination. AG 100mg/kg was ip injected in drug group. The rats were then euthanatized at 6, 24, and 72 hours after reperfusion, and their eyes were enucleated for immunohistochemistry. RESULTS: No specific staining was detected by using the caspase-3 antibody in the retina of control group. In ischemia group, the protein of caspase-3 was over-expressed at 6 hours and relieved at 24 hours and 72 hours, while with drug treatment, the expression of protein of caspase-3 was decreased at each time point. CONCLUSION: AG provides retinal protection against ischemia-reperfusion injury in rat retina, probably through an inducible NOS-dependent mechanism.

Bis(7)-tacrine protects retinal ganglion cells against excitotoxicity via NMDA receptor inhibition
AIM: To investigate whether bis(7)-tacrine, a multifun- ctional drug, inhibits N-methyl-D-aspartate (NMDA) -activated current in retinal ganglion cells(RGC) and provides neuroprotection against retinal cell damage. METHODS: Purified RGC cultures were obtained from retinas of 1-3 days old Sprague-Dawley(SD) rats, following a two-step immunopanning procedure. After 7 days of cultivation, the inhibition of NMDA-activated current by bis(7)-tacrine was measured by using patch-clamp recording techniques. In animal experiments, RGCs were damaged after intravitreal injection of NMDA (5μL, 40nmol) in adult rats. Bis(7)-tacrine(0.05, 0.1, 0.2mg/kg) or memantine(20mg/kg) was intraperitoneal administered to the rats fifteen minutes before intravitreally injection of NMDA. RGC damage was analyzed by histologic techniques, TUNEL and retrograde labeling techniques. RESULTS: Whole-cell patch-clamp recordings demonstrated that NMDA (30μmol/L) resulted in approximately -50 pA inward currents that were blocked by bis(7)-tacrine(1μmol/L). Histological examination and retrograde labeling analysis revealed that bis(7)-tacrine induced a significant neuroprotective effect against NMDA-induced cell damage 7 days after NMDA injection. TUNEL staining showed that pretreatment with bis(7)-tacrine was effective in ameliorating NMDA-induced apoptotic cell loss in the retinal ganglion cell layer 18 hours after injection. CONCLUSION: Bis(7)-tacrine possesses remarkable neur- oprotective activities against retinal excitotoxicity through inhibition of NMDA receptors.

Expressions of cellular retinoic acid binding proteins I and retinoic acid receptor-β in the guinea pig eyes with experimental myopia

Jia Huang,Xiao-Mei Qu and Ren-Yuan Chu
AIM: All-trans retinoic acid (RA) is the only extrinsic biochemical candidate known to date that could act as a growth controller，the aim of this study was to investigate the expression cellular retinoic acid binding proteins I (CRABP-I) and retinoic acid receptor-β (RAR-β) in retina of the guinea pig eyes with experimental myopia. METHODS: Ninety guinea pigs aged 14 days were equally and randomly divided into three groups: form deprivation (FD), -5D lens, and control. The diffusers for FD were white translucent hemispheres, and -5D lenses were used to introduce hyperopic defocus. Refraction was measured with streak retinoscopy after cycloplegia, and axial length was calculated with Cinescan A/B ultrasonography. Retina harvested at different time points were used to measure RA level with HPLC and expressions of cellular retinoic acid binding proteins I (CRABP-I) and RA receptor-β (RAR-β) were assayed with Western blot and Real-time PCR. SPSS13.0 software was used for statistical analysis. RESULTS: Up-regulations of CRABP-I and RAR-β in ocular tissues correlated with changes in the refractive status and growth rate of the guinea pig eye (P<0.05). 14 days of monocular form-deprivation led to -5.14D myopia and a 0.281mm axial elongation; 14 days of monocular defocus produced -3.64D myopia and a 0.163 mm axial elongation. The level of retinal RA started to elevate in 7 days (P<0.05) after visual manipulation in both FD and -5D lens groups and became more prominent by 14 days (P <0.01) . The expressions of CRABP-I and RAR-β increased by 14 days after visual manipulation (P<0.05), the mRNA level of RAR-β, however, increased by 7 days after visual manipulation (P<0.05), which suggested that changes of expressions of CRABP-I and RAR-β might lag behind the change of RA. CONCLUSION: The levels of CRABP-I and RAR-β were elevated in retina of the guinea pig eye with experimental myopia. During the progression of experimental myopia, the retinal RA level increased rapidly, and there might be a positive feedback between the increase of RA and up-regulation of RAR-β.

Role of unc5b in retinal neovascularization in mice with oxygen-induced retinopathy

Dan Liu,Xiao-Bo Xia,Xue-Liang Xu,Xiao-Feng Tian and Lei Shang
AIM: To explore the role of unc5b in retinal neovascularization in murine oxygen-induced retinopathy (OIR). METHODS: On postnatal 7(P7), C57BL/6J mice were exposed to 75%±2% oxygen for 5 days. On postnatal 12(P12), the mice were brought back to the room air (21% oxygen) to induce retinal neovascularization. Western blot analysis was performed to examine the temporal expression of unc5b in murine retinas. Double staining for unc5b and isolectin B4 were employed to determine the location of unc5b in murine retinas. The effect of unc5b on retinal neovascularization was evaluated by intravitreal injection of unc5b-FC in mice with OIR. Retinal neovascularization was measured by counting neovascular cell nuclei above the internal limiting membrane and by angiography of flat-mounted retinas perfused with fluorescein dextran. RESULTS: Compared to age-matched normal mice, the expression of unc5b was significantly increased in retinas of OIR mice on P17 and P21. Unc5b was apparently expressed in retinal vessels of OIR while being negative in normal retinal vessels. Retinal neovascularization in eyes injected with unc5b-FC was significantly reduced. CONCLUSION: Unc5b-FC can effectively inhibit retinal neovascularization induced by OIR. It may serve as a powerful and novel therapy for ischemia-induced retinal disease.

Troglitazone induced apoptosis of human pterygium fibroblasts through a mitochondrial-dependent pathway

Xiao-Xi Yang,Jian Chen,Qing Zhou,Xian-Yin Guo,Pan Xiao,Jing Wu and Jin-Tang Xu
AIM: To study the effect of troglitazone on primary culture human pterygium fibroblasts (HPF). METHODS: Cell viability loss and apoptosis were quantified by cell counting kit-8, AnnexinV-FITC/PI double staining, caspases activity test and western blotting. Flow cytometry was used to detect mitochondrial membrane potential. RESULTS: Peroxisome proliferator-activated receptor γ (PPAR-γ) was positively expressed in pterygium specimens (n=5). Troglitazone showed dose-dependent inhibition of cell survival, induced phospholipids redistribution, activated caspase-3, -9, and altered mitochondrial potential. Western blot assay demonstrated the increase of Bax/Bcl-2 protein ratio. CONCLUSION: Troglitazone induced apoptosis of HPF through a mitochondrial-dependent pathway.

Effect of hypoxia on the proliferation of murine cornea limbal epithelial progenitor cells in vitro

Xiao-Li Ma and Han-Qiang Liu
AIM: To investigate the effect of hypoxia on the proliferation of mouse corneal epithelial cells in vitro. METHODS:Mouse corneal epithelial cells(MCEs) were cultured in normoxia (210mL/L O2 and 50mL/L CO2) and hypoxia (20mL/L O2 and 50mL/L CO2), respectively. Colony forming efficiency (CFE) and cell proliferation were determined. The expression of corneal epithelial progenitor cell marker p63 and K19 was investigated by immunostaining. RESULTS: Normoxic colonies were smaller compared with colonies formed in hypoxia. CFE was (12.50±1.50)% in hypoxic cultures, which was similar compared with normoxia cultures [(11.13±1.86)%, P >0.05)]. Cell proliferation was enhanced in hypoxia. Progenitor markers p63 and K19 were expressed in most cells under both normoxic and hypoxic conditions. CONCLUSION: Murine limbal epithelial progenitor cells can be efficiently expanded in hypoxic conditions.

Topical dihydroartemisinin inhibits suture-induced neovascularization in rat corneas through ERK1/2 and p38 pathways

Yan-Yan Zhong,Hai-Feng Zhang,Jia-Xi Zhong,Lang Bai and Xiao-He Lu
AIM: To determine if topical instillation of dihydroarte- misinin (DHA) inhibits corneal neovascularization (NV) in rats and to investigate the role of the extracellular regulated kinases (ERK) 1/2 and p38 pathways in this process. METHODS: Suture-induced corneal NV was produced in rats and the eyes were topically treated with different concentrations of DHA (20mg/L, 10mg/L or 5mg/L) or normal saline 4 times a day for 7 days. The corneal NV was quantified as the proportion of NV area to the whole cornea. Western blot was used to determine the expressions of vascular endothelial growth factor (VEGF) and the phosphorylation status of VEGF receptor-2, ERK1/2 and p38 in the corneas. Immunofluorescent staining was used to determine the expressions of phospho-ERK1/2 and phospho-p38 in the corneal tissues from the eyes treated with 20 mg/L DHA (DHA group) or normal saline (control group). RESULTS: The proportion of corneal NV area in the eyes treated with normal saline or DHA at dosages of 20mg/L, 10mg/L or 5mg/L was (23.74±3.00)%, (15.73±2.88)%, (19.53±2.42)%, and (23.38±2.79)%, respectively. In the eyes treated with 20mg/L or 10mg/L DHA, the corneal NV area was significantly reduced when compared to that in eyes with normal saline (P<0.05). Western blot analyses revealed that 20mg/L DHA significantly inhibited the expressions of VEGF and phospho-VEGFR-2. Both 20mg/L and 10mg/L DHA inhibited the expressions of phospho-ERK1/2 and phospho- p38. Immunofluorescent staining further demonstrated that 20mg/L DHA lowered the expression levels of phospho- ERK1/2 and phospho-p38 in the corneas with suture-induced NV. CONCLUSION: Suture-induced NV in rat corneas was significantly inhibited by topical treatment with 20mg/L and 10mg/L DHA. The results suggest that the effects could be partially dependent on the DHA-mediated inhibitions of the ERK1/2 and p38 pathways.

Expression of connexin 43 and E-cadherin in choroidal melanoma
AIM: To investigate the expression of connexin 43 and epithelial cadherin (E-cadherin) in choroidal melanoma, to explore the clinical and pathological implications of expression of these proteins, and to determine their relations with malignant features． METHODS: The expression of connexin 43 and E-cadherin in choroidal melanoma were detected by immunohist- ochemistry and correlated with clinicopathological features. RESULTS: Positive rates of connexin 43 in choroidal melanomas and benign pigmented nevus tissues were 75% and 40% respectively with significant differences between the two groups (χ2=5.607, P=0.009). Positive rates of E-cadherin in choroidal melanomas and benign pigmented nevus tissues were 40％ and 75% respectively with significant differences between the two groups (χ2=5.214, P=0.010). Significant overexpression of connexin 43 and reduction of E-cadherin expression was associated with the invasion to the sclera, and there were respectively significant differences between without and with scleral invasion groups (χ2=2.880, P=0.040; χ2=2.778, P=0.046). Overexpression of connexin 43 were correlated with tumor cell types and the expression of connexin 43 and E-cadherin may be correlated with each other. CONCLUSION: The increased expression of connexin 43 and the decreased expression of E-cadherin may be involved in the process of invasion of choroidal melanoma. The overepression of connexin 43 and reduction of E-cadherin may contribute to the development of choroidal melanoma．

Effects of minocycline on expression of bcl-2, bax in early retinal neuropathy of diabetes in rats

Hai-Dong Lian,Bing Ren and Xiao-Wei Gao
AIM: To study the effect of the minocycline (MNC) on expression of bcl-2, bax in retinal nerve cells of rat with diabetes. METHODS: Male SD rats were randomly divided into negative control group, model control group and MNC treated group. Diabetes model was established by intraperitoneal injection of 60 mg/kg streptozotocin (STZ). The protein expressions of bcl-2 and bax in retina were detected by immunohistochemistry method. RESULTS: Compared with the negative control group, bax immunoreactive neurons in retina were increased significantly (P <0.01) in model control group. However, bax immun- oreactive neurons in retina in MNC treated group were significantly decreased (P<0.01). Compared with the model control group, bcl-2 immunoreactive neurons in retina were increased significantly(P <0.01) in MNC treated group. CONCLUSION: MNC can obviously decreased expression of bax and increased expression of bcl-2 in retina with DR. It is one of path of inhibiting impairment on retinal nerve cells with DR.

Effects of COX-2 inhibitor NS-398 on IL-10 expression in rat fungal keratitis

Na Li,Cheng-Ye Che,Li-Ting Hu,Jing Lin,Qing Wang and Gui-Qiu Zhao
? AIM: To investigate the expression of interleukin-10 (IL-10) and the effect of NS-398(COX-2 inhibitor) on the expression of IL-10 in fungal keratitis in rats, and analyze its effects on anti-fungus immunity. ? METHODS: Ninety Wister rats were randomly divided into 3 groups. Group A was blank control group (10 eyes). Group B was fungal keratitis group (40 eyes). Group C was fungal keratitis group treated with NS-398 (40 eyes). PAS staining, 100g/L potassium hydroxide (KOH) smear and fungal culture confirmed the successful establishment of fungal keratitis model. After the central epithelium was scraped, Fusarium solani colonies were applied and contact lens was put on the right cornea of group B and C, and plane contact lens was put on the left cornea of control eyes. Phosphate buffered saline (PBS) eyedrops were given for group B and NS-398 eyedrops for group C. The expression of IL-10 on corneas of group B and C on the 1st day, 3rd days, 7th days, and 14th days were detected by immunohistochemistry and semi- quantitative reverse transcription- polymerase chain reaction (RT-PCR). ? RESULTS: Histopathologic examination showed neutrophil infiltration and severe tissue necrosis in ulcer cornea. PAS staining confirmed the existence of hyphae and spores in the superficial layer of stroma. In the blank and control groups almost no expression of IL-10 was detected at any observing points. In group B the expression of IL-10 increased at first and decreased thereafter. Its expression also showed significant difference at any observing points (P＜0.01). Compared with group B, the expression of IL-10 in group C showed no difference on the 1stday, decrease on the 3rd day, but a significant increase on the 7th day and 14th day. ? CONCLUSION: IL-10 takes part in the occurrence and development of fungal keratitis. NS-398 can upgrade the expression of IL-10 in fungal keratitis in the later period of the ulcer. Meanwhile, pathologic observation showed a slightly corneal opacity. IL-10 may play an important role in the process of cornea anti-damage repair.

Rac1 activates HIF-1 in laser induced choroidal neovascularization
AIM: To study the effect of Rac1 on the induction of HIF-1α in choroidal neovascularization (CNV) in mice. METHODS: One hundred C57BL/6J mice were laser photocoagulated to induce CNV, fifty mice of that were selected randomly for intravitreal injection of Rac1 inhibitor NSC23766 solution (1μL). After laser photocoagulation, fundus fluorescein angiography (FFA) was performed to verify the growth of CNV, Immunohistochemistry and Western blot were used to detect HIF-1α and Rac1 in posterior segment of eye globes. RESULTS: FFA verified that incidence of CNV was significantly reduced in the eyes with NSC23766 injection comparing with that of eyes without NSC23766 injection (P<0.01). Immunohistochemistry detected that HIF-1α and Rac1 mainly expressing in the new fibrovascular tissue. Western blot showed that HIF-1α and Rac1 was highly increased in tissue explants of retinal pigment epithelium （RPE） and choroid without NSC23766 injection. But for tissue explants of RPE and choroid with NSC23766 injection, both the expression of HIF-1α and Rac1 were inhibited. CONCLUSION: Rac1 is crucial to activate HIF-1 regulating the growth of CNV, and its inhibition may have potential therapeutic value.

Effect of CD4+CD25+ regulatory T cells in the development of anterior chamber-associated immune deviation

Shu-Xing Ji,Xiao-Lei Yin and Pei-Zeng Yang
AIM: To investigate whether CD4+CD25+ regulatory T (Treg) cells play a role in the development of anterior chamber-associated immune deviation (ACAID). METHODS: The dynamic changes in the frequency of CD4+CD25+ T cells, CD4+CD25+ FoxP3+ T cells and CD4+CD25+ PD-1+ T cells from spleens of mice with ACAID were analyzed by flow cytometry. Foxp3 mRNA expression in purified CD4+CD25+ T cells was analyzed using real-time PCR. The suppressive effect of purified CD4+CD25+ T cells on the proliferation of CD4+CD25– T cells was evaluated by [3H] thymidine incorporation. A blocking experiment was performed to further address the role of CD4+CD25+ T cells in ACAID. The expression of IL-10 in purified CD4+CD25+ T cells was evaluated by ELISA. RESULTS: Increased frequencies of CD4+CD25+ T cells, CD4+CD25+ FoxP3+ T cells and CD4+CD25+ PD-1+ T cells were observed in ACAID. The CD4+CD25+ T cells from mice with ACAID showed enhanced suppressive effect on the proliferation of CD4+CD25– T cells. Treatment of BALB/c mice with anti-CD25 antibody after injection of OVA into the anterior chamber significantly inhibited the induction of ACAID. Furthermore, purified CD4+CD25+ T cells from ACAID mice secreted IL-10. CONCLUSION: Our results demonstrate that Treg cells are induced in the mice undergoing ACAID. These Treg cells may play a role in the development of ACAID.

Expression of FLT4 in hypoxia-induced neovascular models in vitro and in vivo

Jiao-Lian Liu,Xiao-Bo Xia and Hui-Zhuo Xu
AIM: To investigate the expression of FLT4 in retina with oxygen induced retinopathy (OIR) and in brain endothelial cell lines (bEnd3) under hypoxia conditions in mice. METHODS: Fifty-two one-week-old C57BL/6J mice were divided into control group and hypoxia group. The mice of hypoxia group were exposed to 75% oxygen for 5 days and then returned to the room air to induce retinal neovascularization. Mice in control group were raised in the environment of room air at the same time. The expressions of FLT4 mRNA and protein were checked with RT-PCR and Western Blot analysis at postnatal day 14, 17 and 21 ( P14, P17 and P21) respectively. 125mmol/L CoCl2 were added to the culture medium of bEnd3 cell, proteins were extracted in 12, 24, 48 and 72 hours and FLT4 levels were examined by Western Blot analysis. RESULTS: The mRNA and protein level of FLT4 expressed in P14 and P17 OIR mice retina statistically up-regulated as compared with those in control group, but there was no statistical difference between OIR group and control group at P21. FLT4 levels increased significantly in 12, 24 and 48 hours hypoxia intervened bEnd3 cells, its levels in 72 hours increased mildly but showed no significance. CONCLUSION: FLT4 levels increase in OIR mice retinas and bEnd3 cells in hypoxia. It may play an important role in endothelial cells proliferation in hypoxia and retinal neovascularization in OIR mice.

Effect of CO2 laser sclerectomy with iridectomy on ocular hypertension in rabbits

Zhi-Xiao Xue,Ying-Xin Li,Yan-Shan Xu and Jiu-Min Yang
AIM: To evaluate the efficiency and safety of an optimized CO2 Laser glaucoma surgery system for laser sclerectomy with iridectomy. METHODS: Rabbit trials were performed to evaluate the efficiency and safety. RESULTS: IOP was significantly decreased in laser group compared with trabeculectomy group(P<0.05) from 7th postoperative day to 60th day. Compared with trabeculectomy group, histopathology studies confirmed fewer complications and better effects were found in laser group. CONCLUSION: CO2 laser sclerectomy with iridectomy is effective and safe in terms of IOP lowering.

Effects of amniotic membrane transplantation on cytokines expression in chemically burned rat corneas

Hong-Wei Gu,Dan-Mei Bian,Nan Hu and Jun-Fang Zhang
AIM: To investigate the effect of amniotic membrane transplantation (AMT) on the expressions of inflammatory-related, angiogenic-related and growth-related cytokines in rat corneas after chemical injury. METHODS: Alkali wounds were inflicted on the central corneas of rats by applying a round filter paper soaked in 1mol/L NaOH for 40 seconds. One week after alkali burn, 12 rats were randomly divided into 2 groups: the AMT group and the control group, and AMT was performed on the rats in the AMT group. Corneal opacity and neovascularization were observed by slit-lamp microscopy. The protein levels of interleukin (IL)-2, interferon (IFN)-γ, IL-10 and transforming growth factor (TGF)-β were determined by enzyme-linked immunosorbent assay 2 weeks after AMT. The mRNA levels of matrix metalloproteinase-2 (MMP-2), vascular endothelial growth factor (VEGF), epidermal growth factor (EGF) and basic fibroblast growth factor (bFGF) were evaluated by real-time quantitative PCR. RESULTS: In the AMT group, the corneal opacity was improved (P=0.011) and the area of corneal neovascularization was significantly decreased (P=0.005) compared with the control group. The amount of IL-2 and IFN-γ secreted by Th1 cells were decreased after AMT, whereas the amount of IL-10 and TGF-β secreted by Th2 cells were increased (P<0.05). The level of MMP-2 was significantly down-regulated (P=0.013) at the mRNA level in the AMT group, while the expression of EGF was significantly higher (P=0.022) compared with controls. CONCLUTION: AMT may suppress corneal neovascularization after chemical injury by modulating the expressions of soluble factors.

Comparison of FGFR1 expression on lens epithelial cells between adults and fetuses

Yu-Fu Liu,Hong-Wei Liu and Shu-Ling Peng
AIM: To study the differences of fibroblast growth factor receptor 1 (FGFR1) gene on human lens epithelial cells (HLECs) of adults and fetuses. METHODS: Indirect in situ RT-PCR was adopted for detection of FGFR1 gene. The cDNA of the mRNA in the paraffin sections of fetus and adult HLEC was synthesized by reverse transcription reaction. After PCR amplification, in situ hybridization test was performed with synthesized oligonucleotide probe and relative quantification was carried out using image analysis. RESULTS: HLECs of adults and fetuses expressed FGFR1 gene, the expression level was higher in fetuses than in adults. The difference between them had significance (P<0.05). CONCLUSIONS: FGFR1 exist in HLEC and the expression is age-related, which could be one of causes of the high occurrence of post operational after-cataract in children.

Effect of erythropoietin on the expression of HIF-1 and iNOS in retina in chronic ocular hypertension rats

Dong-Mei Gui,Yang Yang,Xun Li and Dian-Wen Gao
AIM: To research the effect of erythropoietin (EPO) to the HIF-1\iNOS signal transduction path in retina in chronic ocular hypertension rat. METHODS: One hundred and twenty Wistar rats were divided into 12 groups randomly. Two episcleral veins were coagulated unilaterally in rats with electric coagulator to establish the glaucoma model. PT-PCR and Western Blot analysis were used to examine the expression of Caspase-9 genes in retina. And the changes of ERG-b wave before and after were detected using EPO. RESULTS: In EPO drug treatment group, the amplitude of ERG-b wave of retina restored remarkably. There was significant difference between two groups (P＜0.05). The expressions of HIF-1\iNOS mRNA and protein in EPO drug treatment group were weakened remarkably. It was statistically different compared with the non-drug treatment group. CONCLUSION: One of protect mechanisms of EPO to injured retina caused by chronic intraocular hypertension is through HIF-1\iNOS signal conduct path.

Effects of AMD3100 subconjunctival injection on alkali burn induced corneal neovascularization in mice

Liang-Hong Peng,Wei Shen,Wang Yong,Lu Lu and Lin Liu
AIM: To investigate the therapeutic effects of local and systemic administration of AMD3100 for alkali burn induced corneal neovascularization (CNV) in mice. METHODS: CNV was induced in vivo by alkaline burn of cornea in C57BL/6 mice. AMD3100 was administrated topically by subconjunctival injection or systemically by intraperitoneal injection for 7 days; balanced salt solution was administrated topically or systemically as a control respectively. Inflammatory index was evaluated by slit-lamp biomicroscopy and inflammatory cells infiltrated to cornea tissue were detected by histologic analysis at multiple time points. CNV was compared between the local and systemic treated mice 2 weeks after alkali burn, as quantified by CD34 immunostaining. Fluorescence-Activated Cell Sorter Analysis was used to investigate the mobilizing effects of EPC in mice after subconjunctival injected or intraperitoneal injected AMD3100. Immunohistochemistry was used to detect the expression of endothelial progenitor cells (EPC) marker proteins VEGFR2 and CD34. RESULTS: Three days after alkali burn, infiltration of inflammatory cells was found in corneal tissue. At the first 7 days of local injection group, the number of inflammatory cells was significantly lower than that in systemic injection group. CNV could be seen at the 7th day, and at the 14th day reached the peak, then started to decrease. The number of CNV in the subconjunctival injection group was 7.57±1.26 per 0.034mm2, compared to a number of 14.87±2.21 per 0.034mm2 in the control group (P<0.05). On the contrary, the number of CNV in the intraperitoneal injection group was a little higher than that in the control group, 16.34±1.53 per 0.034mm2 vs 13.26±1.87 per 0.034mm2. The research also showed that intraperitoneally, but not subconjunctivally injected AMD3100 could mobilize EPC. On the other hand, subconjunctival, but not intraperitoneally injected AMD3100 could reduce the expression of EPC marker proteins. CONCLUSION: In mice locally administrated AMD3100 can reduce the number of alkali burn induced CNV. The number of inflammatory cells and inflammatory responses in corneal tissue.

Expression and significance of factors related to angiogenesis in choroidal melanoma

Qiang Xu,Gui-Qiu Zhao,Jie Zhao,Hong Lin,Ying-Ying Mou,Qing Wang and Wei-Rong Sun
AIM: To investigate expression of factors related to angiogenesis: HIF-1α, iNOS, COX-2 and VEGF in choroidal melanoma and its clinical significance. METHODS: Fifty samples of choroidal melanoma and 15 samples of melanocytic nevi of the eyelid identified by pathology were collected. Immunohistochemistry SP method was used to examine the expression of HIF-1α, iNOS, COX-2 and VEGF in these samples. The comparison among groups was done by SPSS 13.0 software. RESULTS: The positive expression rates of HIF-1α, iNOS, COX-2 and VEGF in choroidal melanoma group were significantly higher than those in eyelid nevi group (χ2=6.5542, 7.7224, 8.5828, 15.1749). The positive expression rate of VEGF was associated with the tumor size (χ2=10.9194), but was not associated with pathological type (χ2=2.0712) and the situation of scleral invasion (χ2=5.4289). The positive expression rate of HIF-1α was associated with the tumor size (χ2=7.1216) and pathological type (χ2=9.0889), but was not associated with the situation of scleral invasion (χ2=3.3586). The positive expression rate of iNOS was associated with the tumor size (χ2=9.5503), but was not associated with pathological type (χ2=1.9450) and the situation of scleral invasion (χ2=2.3810). The positive expression rate of COX-2 was associated with the tumor size (χ2=7.2970), but was not associated with pathological type (χ2=1.8421) and the situation of scleral invasion (χ2=0.4018). The expression of HIF-1α, iNOS and COX-2 were significantly associated with the expression of VEGF (r=0.9429, 1, 0.9857). The expression of COX-2 was significantly associated with the expression of iNOS (r=0.9857). The expression of HIF-1α was significantly associated with the expression of COX-2 (r=0.9857). The expression of HIF-1α was significantly associated with the expression of iNOS (r=0. 9429). CONCLUSION: The expression of HIF-1α, iNOS and COX-2 protein in choroidal melanoma were higher and may relate to angiogenesis and stimulate tumor growth. Determination of HIF-1α, iNOS and COX-2 may be helpful for the diagnosis and therapy of this tumor.

IOP-lowering effects for the application of human umbilical vein in non-penetrating deep sclerostomy in rabbits

Yang Yang,Yu Di,Dong-Mei Gui,Zhi-Li Liu,Xin Liu and Dian-Wen Gao
AIM: To estimate the effects of human umbilical vein (HUV) implanted under the sclera of glaucoma model on intraocular pressure (IOP) lowering and to investigate its related mechanisms METHODS: A total of 20 human umbilical veins (HUV) were collected from healthy fetus umbilical core. After the establishment of glaucoma model in rabbits, human freeze-dried umbilical vein was implanted under the sclera during NPDS, while for control group, sclerostomy was performed without implant. The formation of the filtration bleb and IOP were detected every 24 hours before surgery and on day 3, 7, 10 and 14 after surgery. Handheld pen-type Tono-penⅡtonometer was used to measure IOP after topical anesthesia treatment. Each measurement has three duplicates. The incision recovery, filtration, conjunctiva congestion and anterior chamber inflammation were observed everyday after surgery. RESULTS: IOP was decreased dramatically with less inflammation than traditional sclerostomies with the application of HUV. The significant differences of IOP between the NPDS with and without HUV implant groups were shown up from 10 days after surgery. The average IOP in NPDS without HUV implant was 14.25mmHg, while for NPDS with HUV implant group, it was 12.30mmHg. This structure of filtration bleb, which allowed the aqueous humor to leave the eye, was formed for any type of surgery. However, 1-2 weeks later, filtration bleb was still existed in the group of sclerostomy with HUV implant and more stable than that of the surgery without HUV implant. Histological observations were performed on day 3, 7 and 14 after surgery. For the eyes under sclerostomy with HUV implant, HUV lumina was shown up on 3 days after surgery with few fibroblast cells near the sclera. On 7 days after surgery, HUV lumina was stably maintained but with obvious fibroblast cells and inflammatory cell. On 14 days after surgery, HUV lumina was still clearly observed but with scarring formation, which suggests that the IOP lowering effects might result from an effective drainage structure formation. CONCLUSION: HUV might be an alternative material to make the drainage pathway for non-penetrating deep sclerostomy.

Effect of Bak Foong Pills on the expression of β-amyloid in rat retina with optic nerve transection

Tan-Tai Zhao,Yun-Qin Li,Luo-Sheng Tang,Yue-Hua Li,Fang Fan and Xiao-Jian Guo
AIM: To investigate the effect of Bak Foong Pills (BFP) on the expression of β-amyloid (Aβ) in rats retina with optic nerve transection, and its roles and possible mechanisms in protecting optic nerve damage. METHODS: Seventy-two healthy, Sprague-Dawley, adult rats were randomly assigned to three groups: negative control group (control group), optic nerve transection group (model group) and BFP treatment group (BFP group, 100μg/mL) followed by establishing optic nerve transection model. The expression of Aβ was measured at 48 hours by Western-blotting. Moreover, the expressions of Bcl-2, Bax and Caspase-3 mRNA were evaluated at 48 hours by reverse transcriptase polymerase chain reaction (RT-PCR). RESULTS: There were significant differences among the control, model and BFP groups in the expression of Aβ (all P<0.01). Aβ expression was significantly higher in the model and BFP groups than that in the control group (P<0.01), with a more significant reduction in the BFP group than that in the model group (P<0.01). Moreover, there were also significant differences among the three groups in the expressions of Bcl-2/Bax (Bcl-2: anti-apoptotic; Bax: proapoptotic) and Caspase-3 mRNA (proapoptotic) (all P<0.01). Bcl-2/Bax ratio was significantly lower and Caspase-3 mRNA expression was significantly higher in the model and BFP groups than those in the control group (P<0.01), with a significant growing of Bcl-2/Bax and reduction of Caspase-3 in the BFP group than those in the model group (P<0.01). CONCLUSION: BFP can down-regulate Aβ expression in retina and may inhibit apoptosis and protect optic nerve by enhancing Bcl-2/Bax ratio and inhibiting Caspase-3 pathway.

Relationship between angiogenesis and lymphangiogenesis in recurrent pterygium
AIM: To examine the relationship between angiogenesis and lymphangigenesis in recurrent pterygia. METHODS: Tissues from 34 excised recurrent pterygia (including 12 Grade 1, 10 Grade 2, and 12 Grade 3) were involved in the study and tissues from 7 nasal epibulbar conjunctivae segments were used as controls. Sections from each pterygium were immunostained with CD₃₁ and LYVE-1 monoclonal antibodies to evaluate lymphatic microvessel density (LMVD) and blood microvessel density (BMVD), and the relationship between LMVD and BMVD in the pterygium was examined. RESULTS: There was a large number of CD₃₁⁽⁺⁾LYVE-1^(-) blood vessels but only a few CD₃₁⁽⁺⁾LYVE-1⁽⁺⁾ lymphatic vessels in grades 1 and 2 pterygium. However, lymphatic vessels were dramatically increased in grade 3 pterygium. LMVD correlated closely with BMVD in all pterygia, including grades 1, 2 and 3 peterygium patients (all P values <0.01). Although both the density of blood and lymphatic vessels increased in recurrent pterygia, lymphatic vessels developed much faster than blood vessels, especially in grade 3 pterygia. CONCLUSION: There is a significant but not parallel relationship between angiogenesis and lymphangiogenesis in recurrent pterygium. The outgrowth of blood and lymphatic vessels provide evidence that immunological mechanism may play a role in the development and recurrence of pterygium.

Distribution of bone morphogenetic protein receptors in human scleral fibroblasts cultured in vitro and human sclera

Zhen-Ya Gao,Li-Jun Huo,Dong-Mei Cui,Xiao Yang,Wen-Juan Wan and Jun-Wen Zeng
AIM: To investigate the distribution of bone morphogenetic protein receptors (BMPRs) in human scleral fibroblsasts (HSFs) and in human sclera. METHODS: Primary HSFs were cultured in vitro. The mRNA levels of BMP-2 and BMPRs in HSFs were assayed by reverse transcription-polymerase chain reaction (RT-PCR). The protein distributions of BMP-2 and BMPRs in HSFs were further detected by immunocytofluorescence and western blot. Their protein expression was also detected in frozen human posterior scleral sections by immunohistofluorescence. RESULTS: BMP-2 and BMPRs were expressed in both HSFs and human sclera not only at mRNA level but also at protein level. The expressions of BMPRIA and BMPRII were higher than that of BMPRIB in the cytoplasm and cell membrane of HSFs in vitro. Western blot further verified the results of immunocytofluorescence. In human sclera, BMP2, BMPR IB and BMPR II were found to be expressed in the cytomatrix of HSF, and weak signal was detected about BMPRIA. CONCLUSION: BMP-2 and all three subtypes of BMPRs were found in HSFs and may play a role in scleral remodeling.

Effect of Qingguangan on the expressions of MMP-2 and MMP-9 in filtering bleb after trabeculectomy in rabbits

Wen-Juan Li,Qing-Hua Peng,Han-Yu Tan and Yan Liu
AIM: To explore the effect of Qingguangan on the expressions of MMP-2 and MMP-9 in filtering bleb scarring area after trabeculectomy in rabbit model. METHODS: Thirty-two New Zealand rabbits were randomized into four groups: control group, experimental group, MMC group (ocular trabeculectomy in combination with MMC), and Qingguangan group. Trabeculectomy was performed on both eyes in each group except control group. Qingguangan group was mouth-fed with Qingguangan (solution). On postoperative day 14, the appearances of MMP-2 and MMP-9 on filtrating blebs were observed by immunohistochemistry. RESULTS: Statistical differences of the expressions of MMP-2 and MMP-9 were noted among groups on day 14 following surgery. Histology immunohistochemistry showed significant differences on the expressions of MMP-2 and MMP-9 between each group (P<0.05). CONCLUSION: Qingguangan can promote the expressions of MMP-2 and MMP-9.

Retinoic acid metabolic change in retina and choroid of the guinea pig with lens-induced myopia

Jun-Feng Mao,Shuang-Zhen Liu and Xiu-Qiong Dou
AIM: To investigate the role of retinoic acid (RA) and retinaldehyde dehydrogenase-2 (RALDH₂) of retina and choroid in the guinea pig lens-induced myopic eyes. METHODS: Totally 45 guinea pigs, at age of three weeks, were randomly assigned into three groups: the normal control, the lens-induced group and the recovering group. Out of focus was induced by the -6.00D concave lens on the left eye, and lasted for 15 days. All animals underwent biometric measurement (corneal radius of curvature, refraction and axial length). Subsequently, RA content in the retina and RPE/choriod complex was detected by reversed-phase high-performance liquid chromatography. RALDH₂ protein in the retina and RPE/choriod complex was evaluated by the immunohistochemical staining and Western blotting. RESULTS: After wearing -6.00D lens for 15 days, axial length of the lens-induced eye extends and myopia was formed, with RA contents increasing in both the neural retina and RPE/choroid complex. Comparing with the lens-induced group, myopic degree significantly relieved, and its RA contents in both the neural retina and RPE/choroid complex decreased in the recovering group. In the normal control, RALDH2 protein was expressed positively in the retinal nerve fiber layer (RNFL), inner plexiform layer (IPL) and lateral border of outer nuclear layer (ONL). Retinal RALDH₂ protein increased in the lens-induced group, and was also positive in the outer plexiform layer (OPL). In the recovering group, retinal RALDH₂ protein attenuated the expression in the OPL turns to negative. RALDH₂ protein was not expressed in the choroid of any group. CONCLUSION: RA of retina and chorid participates in the regulation of the lens-induced myopia in guinea pigs, which may be related with retinal RALDH2 protein.

PI3K/AKT/mTOR signaling pathway inhibitors in proliferation of retinal pigment epithelial cells

Na Cai,Shun-Dong Dai,Ning-Ning Liu,Li-Min Liu,Ning Zhao and Lei Chen
AIM: To determine whether the PI3K/AKT/mTOR pathway is activated in proliferative vitreoretinopathy (PVR) in homo-sapiens. METHODS: The retina of controls and patients with PVR were collected and their levels of PI3K, phospho-AKT, phospho-mTOR, phospho-p70S6k and phospho-4EBP-1 were determined by Western blot. The cultured human retinal pigment epithelial cell line D407 was treated with a specific mTOR inhibitor, rapamycin (RAPA) or a PI3K inhibitor, LY294002, of various concentrations and durations. Cell morphology was observed by phase contrast microscopy and the proliferation and apoptosis of treated cells were determined by MTT assay and flow cytometry. RESULTS: Levels of PI3K, phospho-AKT, phospho-mTOR, phospho-P70S6K and phospho-4EBP1 was increased in the retina in PVR (P<0.05). In D407 cells, both RAPA and LY294002 significantly inhibited cell proliferation and cell cycle progression, and promoted apoptosis (P <0.05); morphologically, the cells became smaller. Both RAPA and LY294002 reduced levels of phospho-AKT, phospho-mTOR, phospho-p70S6k and phospho-4EBP1 expression (P <0.05). RAPA, but not LY294002, had no significant effect on PI3K expression. CONCLUSION: PI3K/AKT/mTOR signaling pathway is highly activated in the retinal pigment epithelial cells of PVR. The inhibitors of PI3K/AKT/mTOR signaling pathway, RAPA and LY294002, could inhibited the PI3K/AKT/mTOR signaling pathway by reducing the levels of phosphorylation of mTOR pathway components.

Lymphocyte infiltration and activation in iris-ciliary body and anterior chamber of mice in corneal allograft rejection

Fu-Hua Wang,Min Chen,Ting Liu,Xin-Jie Zang,Hua-Qing Gong and Wei-Yun Shi
AIM: To investigate the infiltration and activation of lymphocyte in iris-ciliary body and anterior chamber after allogenic penetrating keratoplasty (PK), for further revealing the role of iris-ciliary body in corneal allograft immune rejection. METHODS: In the mice models of PK, BALB/C mice received orthotopic isografts (n =35) or C57BL/6 donor allografts (n =25). Grafts were examined daily for 3 weeks by slit-lamp microscopy and scored for opacity. The infiltration of CD4+ T lymphocyte in iris-ciliary body and anterior chamber was examined by immunohistology and the mRNA of CD80 and CD86 in both cornea graft and iris-ciliary body by RT-PCR was analyzed in allograft recipient at days 3, 6, 10 and the day when graft rejection occurred. Isograft recipients were examined as control at the corresponding time points. Transmission electron microscope was used to study the ultrastructure, especially cell infiltration, of iris-cilary body and corneal graft at day 3, 7 and the day when rejection occurred after allogenic PK. RESULTS: Rejection was observed in all the allograft recipients followed more than 10 days, at a median time of 15 days (range 12-18 days), but not in any of isografts. CD4+ T cells were first detected at day 6 after transplantation in limbus and Ciliary body, and then in the stroma of recipient, iris, anterior chamber and corneal allograft with an increased number until graft rejection occurred. CD80 and CD86 mRNA were detected under RT-PCR examination in both graft and iris-ciliary body of allograft recipient, but not in any of isograft recipient. Three days after operation, lymphocytes and monocytes macrophages were visible in iris blood vessels and the anterior chamber, and vascular endothelial cell proliferation and activation were significant under transmission electron microscopy examination. At day 7, corneal endothelial cells became thinner. Lymphocytes and mononuclear macrophages were found with great number in the anterior chamber and adhered to the corneal endothelium. Blood vessels in iris increased and were filled with lymphocytes. And lymphocytes were detected to migrate through endothelial cell gap out of vessels. When allograft rejection occurred, macrophages attached to endothelial cells with large number of lymphocytes and macrophages infiltrating in iris. CONCLUSION: Lymphocyte infiltration and activation occurred in iris-ciliary body after allogenic PK, and the lymphocytes could migrate from iris blood vessel to the anterior chamber, which might play an important role in corneal allograft immune rejection.

The expression and distribution of α-Gal gene in various species ocular surface tissue
AIM: To examine the α-Gal gene expression and distribution in the different species/genus and developing phase animal ocular surface tissue.METHODS: α-Gal binding assay were carried out on various animal eye sections. Photograph, slit-lamp observation on various eye showed normal corneal transparence.RESULTS: A strong α-Gal expression in invertebrates and some vertebrates ocular tissue, but no α-Gal binding in birds, fish and mammal. α-Gal expression change in the development of mice ocular surface tissue (except sclera) and display genus dependency in the different murine ocular surface tissue.CONCLUSION: This study identified specific α-Gal epitopes binding area in the ocular surface of several species and may solve the problem that naive ocular surface may be used as natural α-Gal gene knockout model/high risk immunologic rejection model or ocular surface scaffold material.

Effects of preservation time on proliferative potential of human limbal stem/progenitor cells
AIM: To determine the proliferative potential and the maintenance of stem cell activity in stored human limbal tissues, and correlate this with the preservation time, cell viability and the expression of stem cell markers.METHODS: Thirty limbal rims were split into 4 parts and stored in corneal preservation medium at 4℃ for 0, 1, 4, or 7 days. The limbal stem cell and mitotic markers P63, CK19, proliferating cell nuclear antigen (PCNA), and Ki67 were determined by immunohistochemical staining. The proliferative potential of limbal epithelial cells was assessed by cell viability, the ability of generating stratified epithelium, and colony forming assay.RESULTS: The stored tissues maintained limbal stratified structure to 7 days and exhibited comparable expression level of stem cell and mitotic markers. The proportion of viable cells decreased with the prolonged preservation time, while colony forming efficiency decreased from the 1^st day and disappeared at the 4^th day. When inoculated on amniotic membrane, the cells preserved for 1 day formed a stratified epithelium, while the cells from 4 days’ preservation formed a discontinuous layer.CONCLUSION: The colony forming efficiency of limbal epithelial stem/progenitor cells decreased rapidly with the increasing preservation time, while the expression level of markers and capacity of forming epithelial monolayer on amniotic membrane decreased gradually. The limbal epithelial stem cells lost their function earlier than the lost expression level of stem cell markers. This may help us to better choose the appropriate preservation grafts for future limbal stem cell transplantation.

Homemade lyophilized cross linking amniotic sustained-release drug membrane with anti-scarring role after filtering surgery in rabbit eyes

Wan Li,Wen-Jian Chen,Wei Liu,Liang Liang and Ming-Chang Zhang
AIM: To investigate the antifibrotic effect of the freeze-dried bilayered fibrin-binding amniotic membrane as a drug delivery system on glaucoma surgery in rabbit model. The aim of this study was to prepare a novel local delivery system for the sustained and controllable release of 5-Fu.METHODS: Twenty-four Japanese white rabbits were randomized into three groups: the experimental group (ocular trabeculectomy in combination with 5-Fu loaded freeze-dried bilayered fibrin-binding amniotic membrane transplantation), the control group (ocular trabeculectomy in combination with 5-Fu) and the blank group (single trabeculectomy). HE staining, massion staining and immunohistochemistry for α-SMA were performed on days 7, 14, 21 and 30 following surgery. The concentration of 5-Fu in rabbit aqueous humor was examined by high performance liquid chromatography (HPLC) 3 days after the surgery. RESULTS: Statistical differences were noted in intraocular pressure among groups on day 7, 14, 21 and 30 following surgery. Histology further demonstrated that trabeculectomy in combination with freeze-dried bilayered fibrin-binding amniotic membrane yielded well wound healing and no scar formation and was beneficial for long term effect.CONCLUSION: HPLC showed a good slow-release effect with freeze-dried bilayered fibrin-binding amniotic membrane.

Adenoviral 15-lipoxygenase-1 gene transfer inhibits hypoxia-induced proliferation of retinal microvascular endothelial cells in vitro

Ying Yan,Tao He,Ying Shen,Xiao Chen,Bo Diao,Zhi Li,Qing Liu and Yi-Qiao Xing
AIM: To investigate whether 15-Lipoxygenase-1 (15-LOX-1) plays an important role in the regulation of angiogenesis, inhibiting hypoxia-induced proliferation of retinal microvascular endothelial cells (RMVECs) and the underlying mechanism.METHODS: Primary RMVECs were isolated from the retinas of C57/BL6J mice and identified by an evaluation for FITC-marked CD31. The hypoxia models were established with the Bio-bag and evaluated with a blood-gas analyzer. Experiments were performed using RMVECs treated with and without transfer Ad-15-LOX-1 or Ad-vector both under hypoxia and normoxia condition at 12, 24, 48, 72 hours. The efficacy of the gene transfer was assessed by immunofluorescence staining. Cells proliferation was evaluated by the CCK-8 method. RNA and protein expressions of 15-LOX-1, VEGF-A, VEGFR-2, eNOs and PPAR-r were analyzed by real-time reverse transcription polymerase chain reaction (RT-PCR) and Western blot.RESULTS: Routine evaluation for FITC-marked CD31 showed that cells were pure. The results of blood-gas analysis showed that when the cultures were exposed to hypoxia for more than 2 hours, the Po2 was 4.5 to 5.4 Kpa. We verified RMVECs could be infected with Ad-15-LOX-1 or Ad-vector via Fluorescence microscopy. CCK-8 analysis revealed that the proliferativecapacities of RMVECs in hypoxic group were significantlyhigher at each time point than they were in normoxic group (P<0.05). In a hypoxic condition, the proliferativecapacities of RMVECs in 15-LOX-1 group were significantly inhibited (P<0.05). Real-time RT-PCR analysis revealed that the expressions of VEGF-A, VEGF-R2 and eNOs mRNA increased in hypoxia group compared with normoxia group (P<0.01). However, the expressions of 15-LOX-1, PPAR-r mRNA decreased in hypoxia group compared with normoxia group (P<0.01). It also showed that in a hypoxic condition, the expressions of VEGF-A, VEGF-R2 and eNOs mRNA decreased significantly in 15-LOX-1 group compared with hypoxia group (P<0.01). However, 15-LOX-1 and PPAR-r mRNA increased significantly in 15-LOX-1 group compared with hypoxia group (P<0.01). There was no significant difference of the mRNA expressions between vector group and hypoxia group (P>0.05). Western blot analysis revealed that the expressions of relative proteins were also ranked in that order.CONCLUSION: Our results suggested that 15-LOX-1 and PPAR-r might act as a negative regulator of retinal angiogenesis. And the effect of 15-LOX-1 overexpression is an anti-angiogenic factor in hypoxia-induced retinal neovascularization (RNV). Overexpression 15-LOX-1 on RMVECs of hypoxia-induced RNV blocked signaling cascades by inhibiting hypoxia-induced increases in VEGF family. PPAR-r effect on VEGFR2 could be an additional mechanism whereby 15-LOX-1 inhibited the hypoxia-induced RNV.

Regulation of Eaf2 in mouse lens cells apoptosis induced by ultraviolet radiation

Fan Xiao,Jin-Song Zhang,Jiang-Yue Zhao and Di Wu
AIM: To investigate the regulation of Eaf2 protein in mouse lens cells apoptosis induced by ultraviolet (UV) radiation.METHODS: An eye of Eaf2 gene knockout mice or normal control mice was exposed to UV radiation, and the other one was non-exposed. All of lenses were analyzed by TUNEL and caspase 3 activity assays to determine the difference of the apoptosis induced by UV radiation. In addition, exposed and non-exposed lenses were analyzed by quantified p53 expression and real-time reverse transcription-polymerase chain reaction (RT-PCR) of Bax, Bid, Apaf-1, Puma and Noxa, to compare Eaf2 gene knockout mice and normal control mice.RESULTS: UV radiation caused apoptosis of lens cells in normal control mice and Eaf2 knockout mice. Activity of caspase 3 was significantly higher in normal control mice than Eaf2 knockout mice. Expression of p53 protein was significantly higher in lenses exposed to UV radiation than nonexposed lenses, but was similar between Eaf2 gene knockout mice and normal control mice in the same UV condition. After exposing to UV radiation, the analysis of real-time RT-PCR demonstrated that mRNA levels of Puma and Noxa were significantly higher in lenses of normal control mice than Eaf2 gene knockout mice, and that mRNA levels of Bax, Bid and Apaf-1 were not significantly different between gene knockout mice and normal control mice.CONCLUSION: Eaf2 increases lens cells apoptosis induced by ultraviolet radiation. And Eaf2 up-regulates expression of the Puma and the Noxa to act on lens cells apoptosis after UV radiation.

Interference of Y-27632 on the signal transduction of transforming growth factor beta type 1 in ocular Tenon capsule fibroblasts

Xiao-Hui Zhang,Nai-Xue Sun,Zhao-Hui Feng,Chao Wang,Yi Zhang and Jian-Ming Wang
AIM: To investigate the interfering effect of Y-27632, a ROCK-I selective inhibitor, on the signal transduction pathway of transforming growth factor-β1 (TGF-β1) in ocular Tenon capsule fibroblasts (OTFS) in vitro. METHODS: After OTFS from passages 4 to 6 in vitro were induced by TGF-β1 and then treated by Y-27632, the changes of the OTFS cell cycles were analyzed via flow cytometry, and the proteins expression of the α-smooth muscular actin (α-SMA), connective tissue growth factor (CTGF), collagen I were calculated by Western blot. After OTFS treated by the different concentrations of Y-27632, the expression levels of the α-SMA, CTGF and collagen I mRNA were assayed by RT-PCR. RESULTS: Y-27632 had no markedly effect on the OTFS cell cycles. After treated by TGF-β1, OTFS in G1 period significantly increased. The cell cycles distribution by both TGF-β1 and Y-27632 had no remarkable difference from that in control group. Y-27632 significantly inhibited the proteins expressions of both α-SMA and CTGF, while to some extent inhibited that of collagen I. TGF-β1 significantly promoted the proteins expressions of α-SMA, CTGF and collagen I. After OTFS treated by both TGF-β1 and Y-27632, of α-SMA, the protein expression was similar with that in control group (P=0.066>0.05), but the protein expression of CTGF or collagen I, respectively, was significantly different from that in control group (P=0.000<0.01). The differences of expressions of the α-SMA, CTGF and collagen I mRNA in 30, 150, 750μmol/L Y-27632 group were statistically significant, compared with those in control group, respectively (α-SMA, P=0.002, 0.000, 0.000; CTGF, P=0.014, 0.002, 0.001; collagen I, P=0.003, 0.002, 0.000). CONCLUSION: Blocking the Rho/ROCK signaling pathway by using of Y-27632 could inhibit the cellular proliferation and the expression of both CTGF and α-SMA whatever OTFS induced by TGF-β1 or not. Y-27632 suppressed the expression of collagen I mRNA without induction.

Nucleotide oligomerization domain 2 contributes to the innate immune response in THCE cells stimulated by Aspergillus fumigatus conidia
AIM: To investigate the expression of nucleotide oligomerization domain 2 (NOD2) in the immortalized human corneal epithelial cell line (THCE), and its role in the innate immune response triggered by inactive Aspergillus fumigatus (Af) conidia. METHODS: The normal THCE cells were investigated as controls. After incubation with inactive Af conidia for 0.5, 2, 4, 6, and 8 hours, THCE cells were harvested, mRNA expression of NOD2 and receptor interacting protein 2 (RIP2) was detected by RT-PCR. Intracellular proteins including NOD2, NF-κB and proinflammatory cytokines such as TNF-α, IL-8, IL-6 in the cell supernatant were analyzed by ELISA. RESULTS: Our data indicate that NOD2 expressed in the normal THCE cells. After triggered by the inactive Af conidia, the expression of NOD2, RIP2 mRNA and the secretion of NOD2, NF-κB, TNF-α, IL-8, IL-6 both increased in a time-depended manner, and reached the peak point at 4, 6, 6, 4, 6, 6, 4 hours, respectively. And after pretreated with NOD2 neutralizing antibody, the expression of RIP2, NF-κB, TNF-α, IL-8 both decreased dramatically at the peak point, while the secretion of IL-6 changed little. CONCLUSION: The results of this study suggest that NOD2 exists and expresses in the THCE cells, and contributes to the innate immune responses triggered by inactive Af conidia by induction of proinflammatory cytokines such as TNF-α and IL-8 through the NF-κB pathway.

Evaluation of novel decellularizing corneal stroma for cornea tissue engineering applications
AIM: To develop a new decellularization method depended upon the natural corneal structure and to harvest an ideal scaffold with good biocompatibilities for corneal reconstruction. METHODS: The acellular cornea matrix (ACM) were prepared from de-epithelium fresh porcine corneas (DFPCs) by incubation with 100% fresh human sera and additional electrophoresis at 4℃. Human corneal epithelial cells (HCEs) were used for the cytotoxicity tests of ACM. ACM were implanted into the Enhanced Green Fluorecence Protein (eGFP) transgenic mouse anterior chamber for evaluation of histocompatibility. RESULTS: HE and GSIB4 results showed fresh porcine cornea matrix with 100% human sera and electrophoresis could entirely decellularize stromal cell without reducing its transparency. ACM had no cytotoxic effect ex vivo. Animal test showed there was no rejection for one month after surgery. CONCLUSION: These results provide a decellularizing approach for the study of corneal tissue engineering and had the broader implications for the field of biological tissue engineering in other engineered organ or tissue matrix.

Effect of recombinant human platelet-derived growth factor B on cat corneal endothelial cell viability mediated by adeno-associated virus
AIM: To transduce recombinant human platelet-derived growth factor B(PDGF-B) gene adeno-associated virus(AAV) to in vitro cultured cat corneal endothelial cell (CEC) and observe the effect of the expressed PDGF-BB protein on the viability of cat CEC. METHODS: Cat cornea endothelium was torn under microscope and rapidly cultivated in DMEM to form single layer CEC and the passage 2 endothelial cells were used in this study. The recombinant human PDGF-B gene AAV was constructed and transduced into cat CEC directly. Three groups were as following: blank control group, AAV control group and recombinant AAV group. At 24 hours, 48 hours, and 5 days after transduction, total RNA was extracted from the CEC by Trizol and the expression of PDGF-B gene was detected by fluorescence quantitative polymerase chain reaction. Viability of the transduced CEC was detected at 48 hours after transduction by MTT assay. Cell morphology was observed under inverted phase contrast microscope. RESULTS: With the torn endothelium culture technique, we rapidly got single layer cat CEC. At 24 hours, 48 hours and 5 days after transduction, fluorescence quantitative polymerase chain reaction showed there was no significant difference of the expressed PDGF-B gene mRNA between blank control group and AAV control group (P>0.05). In contrast, there were significant differences between two control groups and recombinant AAV group (P<0.05). MTT assay showed that in recombinant AAV group, the expressed PDGF-BB protein could promote the viability of cat CEC. Morphology observation showed at 48 hours after transduction, cells in CEC-AAV-PDGF-B group proliferated into bigger scales in regular triangle to hexagon shape with distinct boundary, while the number of cells was significantly less in the two control groups. CONCLUSION: The recombinant AAV-PDGF-B expresses biological active PDGF-BB protein in cat CECs, which promotes the viability and proliferation of cells.

Transplantation of tissue-engineered human corneal epithelium in limbal stem cell deficiency rabbit models
AIM: To evaluate the biological functions of tissue-engineered human corneal epithelium (TE-HCEP) by corneal transplantation in limbal stem cell deficiency (LSCD) rabbit models. METHODS: TE-HCEPs were reconstructed with DiI-labeled untransfected HCEP cells and denuded amniotic membrane (dAM) in air-liquid interface culture, and their morphology and structure were characterized by hematoxylin-eosin (HE) staining of paraffin-sections, immunohistochemistry and electron microscopy. LSCD models were established by mechanical and alcohol treatment of the left eyes of New Zealand white rabbits, and their eyes were transplanted with TE-HCEPs with dAM surface outside by lamellar keratoplasty (LKP). Corneal transparency, neovascularization, thickness, and epithelial integrality of both traumatic and post transplantation eyes were checked once a week by slit-lamp corneal microscopy, a corneal pachymeter, and periodic acid-Schiff (PAS) staining. At day 120 post surgery, the rabbits in each group were sacrificed and their corneas were examined by DiI label observation, HE staining, immunohistochemistry and electron microscopy. RESULTS: After cultured for 5 days on dAM, HCEP cells, maintaining keratin 3 expression, reconstructed a 6-7 layer TE-HCEP with normal morphology and structure. The traumatic rabbit corneas, entirely opaque, conjunctivalized and with invaded blood vessels, were used as LSCD models for TE-HCEP transplantation. After transplantation, obvious edema was not found in TE-HCEP-transplanted corneas which became more and more transparent, the invaded blood vessels reduced gradually throughout the monitoring period. The corneas decreased to normal thickness on day 25, while those of dAM eyes were over 575μm in thickness during the monitoring period. A 4-5 layer of epithelium consisting of TE-HCEP originated cells attached tightly to the anterior surface of stroma was reconstructed 120 days after TE-HCEP transplantation, which was similar to the normal control eye in morphology and structure. In contrast, intense corneal edema, turbid, invaded blood vessels were found in dAM eyes, and no multilayer epithelium was found but only a few scattered conjunctiva-like cells appeared. CONCLUSION: The TE-HCEP, with similar morphology and structure to those of innate HCEP, could reconstruct a multilayer corneal epithelium with normal functions in restoring corneal transparency and thickness of LSCD rabbits after transplantation. It may be a promising HCEP equivalent for clinical therapy of corneal epithelial disorders.

LMWH inhibits anterior chamber inflammation after extra capsular lens extraction through down regulation of bFGF content in aqueous humor

Jian-Ming Wang,Lei Xiong,Quan-Chen Xiong and Ya-Zhi Fan
AIM: To observe the changes of basic fibroblast growth factor (bFGF) content in anterior chamber before and after extra capsular lens extraction for investigating the mechanism of low molecular weight heparin (LMWH) inhibiting anterior chamber inflammation. METHODS: Eighty-four rabbits were randomly divided into control and experimental group, 42 rabbits in each group. Extra capsular lens extraction was done on unilateral eye in each rabbit. LMWH was perfused into anterior chamber by the concentration of 50U/mL at the end of operation in experimental group. The degrees of corneal edema, aqueous flare and fibrin were evaluated with slit lamp microscope on postoperative day 1, 3, 6, 15, 30, 45 and 60, respectively. Six eyes of each group were at each time point. Contents of bFGF in aqueous humor were determined by ELISA after animals were killed. Another six eyes were used for determining the base line level of bFGF in aqueous humor. RESULTS: The degrees of corneal edema, aqueous flare and fibrin in experimental group were significantly lighter than those in control group (P<0.01) on postoperative day 1, 3 and 6, respectively. No difference was showed between the two groups at other point time. Contents of bFGF in aqueous humor increased at the same time. bFGF content reached peak on postoperative day 1 in experimental group, while on postoperative day 6 in control group. Contents of bFGF in the two groups declined slowly after reaching peak. The bFGF content in control group were significantly higher than that in experimental group 1-30 days after surgery (P<0.05). No significant differences were shown between the two groups on postoperative day 45 and 60, respectively. CONCLUSION: Perfusion with LMWH by the concentration of 50U/mL can significantly reduce anterior chamber inflammation after extra capsular lens extraction in rabbits, which may be related to down regulation of bFGF content in aqueous humor.

Molecular mechanism of the inhibition effect of Celecoxib on corneal collagen degradation in three dimensions

Wen-Song Zhang,Ji-Long Hao,Shuang Wang,Miao-Miao Bi,Hong Zhang and Hong-Yan Zhou
AIM: To clarify the molecular mechanism of Celecoxib on corneal collagen degradation and corneal ulcer. METHODS: Rabbit corneal fibroblasts were harvested and suspended in serum-free MEM. Type I collagen, DMEM, collagen reconstitution buffer and corneal fibroblast suspension were mixed on ice. The resultant mixture solidify in an incubator, after which test reagents and plasminogen was overlaid and the cultures were returned to the incubator. The supernatants from collagen gel incubations were collected and the amount of hydroxyproline in the hydrolysate was measured. Immunoblot analysis of MMP1, 3 and TIMP1, 2 was performed. MMP2, 9 was detected by the method of Gelatin zymography. Cytotoxicity Assay was measured. RESULTS: Celecoxib inhibited corneal collagen degradation in a dose and time manner; Celecoxib inhibited the IL-1? induced increases in proMMP1, 2, 3, 9 and active MMP1, 2, 3, 9 in a concentration-depended manner. Celecoxib can also inhibit the IL-1? induced increases in the TIMP1, 2. CONCLUSION: Celecoxib can inhibit corneal collagen degradation induced by IL-1β, this effect is the consequence of the reduction of MMP1, 2, 3, 9 and TIMP1, 2. The results of the present study provide new insight into Celecoxib in corneal ulcer treatment.

Effect of VEGF-targeted antisense gene therapy on retinoblastoma cell line SO-RB50 in vitro and in vivo
AIM: To evaluate the possibility of generation 4 polyamidoamine (G4PAMAM) dendrimers acting as the delivery system of vascular endothelial growth factor (VEGF) antisense oligodeoxynucleotides (VEGFASODN), and to investigate the anti-tumor effect of G4PAMAM/VEGFASODN complex on the cultured cells and the mouse tumor xenograft model. METHODS: The transfection efficiency was assessed by Flow cytometry (FCM). Thiazolyl tetrazolium (MTT) assay was performed to determine the relative growth rate (RGR) of the cells after transfection. Then a mouse tumor xenograft model of human retinoblastoma was established. Different interventions were given to the mice by intratumoral injection and the tumor growth was monitored. The expression of VEGF mRNA was detected by reverse transcription PCR (RT-PCR), the expression of VEGF protein was determined by western blot analysis, and the microvessel density (MVD) was measured by immunohistochemistry (IHC) staining. RESULTS: G4PAMAM/VEGFASODN exhibited a high transfection rate in vitro, and the transfection rates of different doses of G4PAMAM/VEGFASODN groups increased with higher doses. This effect was accompanied by a dose-depended reduction in cell viability. The tumor growth in the tumor-bearing athymic mice was significantly inhibited in the G4PAMAM/VEGFASODN group. The expressions of VEGF mRNA and protein were obviously inhibited in the G4PAMAM/VEGFASODN group (P＜0.05), and the MVD of the G4PAMAM/VEGFASODN group was lower than that of the other groups(P＜0.05). CONCLUSION: VEGFASODN can be delivered into the cultured and transplanted retinoblastoma cells efficiently by G4PAMAM, suppress the expressions of VEGF mRNA and protein, and reduce the MVD of tumor tissues. The G4PAMAM/VEGFASODN complex has antitumor properties in vitro and in vivo.

Comparison of the effects of bevacizumab and ranibizumab injection on corneal angiogenesis in an alkali burn induced model
AIM: To investigate the effects of bevacizumab and ranibizumab on corneal neovascularization in an alkali burn-induced model of corneal angiogenesis. METHODS: Fifteen Wistar albino rats were divided randomly into 3 groups after chemical cauterization of the cornea. The first group received a single dose of 0.1mL saline solution as a control group whereas second and third groups received a single dose of 2.5mg bevacizumab or 1mg ranibizumab by subconjunctival injection, respectively. After three weeks, the rat corneas were evaluated by biomicroscopy and corneal photographs were taken. The percentage of neovascularization area, length of the longest new vessel, corneal edema and corneal opacity scores were assessed. RESULTS: The analysis of digital photographs showed that the percentage of neovascularization area to the total corneal area, the length of the longest new vessel, corneal edema and opacity scores were significantly lower in both study groups compared to the control group (P<0.05). Additionally, the percentage of corneal neovascularization area, the length of the longest new vessel and corneal opacity score were less with bevacizumab than ranibizumab. CONCLUSION: Subconjunctival bevacizumab and ranibizumab treatments may be effective methods in reducing corneal neovascularization. Furthermore, bevacizumab is more effective than ranibizumab in the inhibition of corneal neovascularization.

Inhibitory effect of CCR3 signal on alkali-induced corneal neovascularization

Wen-Juan Zhou,Gao-Qin Liu,Long-Biao Li,Xue-Guang Zhang and Pei-Rong Lu
AIM: To investigate the effect of CC chemokine receptor 3 (CCR3) signal on corneal neovascularization (CRNV) induced by alkali burn and to explore its mechanism. METHODS: Specific pathogen-free male BALB/C mice (aged 6-8 weeks) were randomly divided into CCR3-antagonist treated group (experimental group) and control group. CRNV was induced by alkali burn in mice. The time kinetic CCR3 expression in injured corneas was examined by reverse transcription polymerase chain reaction (RT-PCR). CCR3-antagonist (SB-328437 at different concentration of 125μg/mL, 250μg/mL, and 500μg/mL) was locally administrated after alkali injury. The formation of CRNV was assessed by CD31 corneal whole mount staining at two weeks after injury. Monocyte chemotactic protein 1 (MCP-1), monocyte chemotactic protein 3 (MCP-3) expressions in the early phase after injury were quantified and compared by RT-PCR. Macrophage intracorneal accumulation in the early phase after injury was evaluated and compared by immunohistochemistry. RESULTS: Alkali injury induced the time kinetic intracorneal CCR3 expression. 500μg/mL of CCR3-antagonist treatment in the early phase but not the late phase resulted in significant impaired CRNV as compared to control group (P<0.05). CCR3-antagonist treatment in the early phase significantly reduced the intracorneal MCP-1 and MCP-3 enhancement compare to control group at day 2 and day 4 (P<0.05). Moreover, the number of intracorneal macrophage infiltration in the experimental group was reduced than those in control group at day 4 (P<0.05). CONCLUSION: CCR3 signal is involved in alkali-induced CRNV. CCR3-antagonist can inhibit alkali-induced CRNV by reducing the intracorneal MCP-1 and MCP-3 mRNA expression and the intracorneal macrophage infiltration.

External sclerostomy with the femtosecond laser versus a surgical knife in rabbits
AIM: To experimentally compare the external sclerostomy produced using a femtosecond laser with that made by a surgical knife and to evaluate the healing patterns, efficacy and technical advantages of femtosecond laser sclerostomy. METHODS: In a prospective randomized, controlled, masked-observer study, 10 pigmented rabbits underwent external sclerostomy with a femtosecond laser in the right eye; 10 additional rabbits underwent sclerostomy with a surgical superblade in the right eye. Clinical characteristics, which included bleb morphology and intraocular pressure, were recorded for 1 month after surgery. Six additional rabbits underwent external femtosecond laser sclerostomy in the right eye and mechanical sclerostomy in the left eye and were killed at day 14 after surgery. Histologic staining, immunohistochemistry and scanning electron microscopy were subsequently performed to assess the morphology of the filtering fistula. The titanium-sapphire femtosecond laboratory laser was operating at a repetition rate of 1 kHz, 0.4 mJ pulse energy, a central wavelength of 800nm and a pulse duration of 50 femtoseconds. Mann-Whitney and Kaplan-Meier tests were used for statistical analysis. RESULTS: Successful complete sclerostomy was achieved in each laser-treated eye which was hit only once by the laser. The laser treated time was approximately 15s-16s. In the laser-treated group (n=16), 2 eyes (12%) developed mild hyphema at the site of entry and 8 eyes (50%) showed transient edema in the corneal periphery adjacent to the laser impact zone. The differences between the groups in duration of function blebs and pressure reduction were statistically significant (P=0.025 and 0.016, respectively). The success rate of the laser-treated group was significantly higher than the knife group (P=0.005). Histologically, the subconjunctival connective tissue was loosely arranged with partially patent sclerostomy in the laser-treated eyes at postoperative day 14. This contrasted with the completely scarred sclerostomy tract in the knife group. The mean numbers of fibroblasts and new vessels as well as the amount of new collagen deposition at bleb site were significantly decreased in the laser group (P=0.045, 0.013 and 0.036, respectively). CONCLUSION: The current study demonstrates that external femtosecond laser sclerostomy may offer a safe and effective alternative for the minimally invasive surgical management of glaucoma.

Effect of brain-derived neurotrophic factor on c-jun expression in the rd mouse retina

Rui Chen,Xiao-Bei Yin,Chun-Xia Peng and Gen-Lin Li
AIM: To determine the location of c-jun protein, dynamic changes in c-jun mRNA and protein expression, and ultrastructure characteristics in the rd mouse retina, following a single dose of brain-derived neurotrophic factor (BDNF) in a short period of time. METHODS: A single intravitreal injection of BDNF at two dosages (25μg/L or 50μg/L) was given to the right eye of the rd mouse at age 2 and 3 weeks respectively. Two weeks after injection, the location of c-jun protein in the retina was observed by immunofluorescence detection, c-jun mRNA and protein expression in retinas were detected by quantitative real time polymerase chain reaction (RT-PCR) and western immunoblotting analysis, ultrastructure characteristics of retinas were detected by transmission electron microscope (TEM) observation. RESULTS: c-jun protein was expressed in the inner nuclear layer (INL) of retina. BDNF at two dosages (25μg/L and 50μg/L) increased c-jun mRNA expression at PN-4 weeks respectively (P1=0.019, P2= 0.021). 50μg/L BDNF increased c-jun protein expression at PN-4 weeks (P =0.000). The retinal ultrastructure was improved. CONCLUSION: The effects of BDNF exerts on the c-jun expression in the retina are dose-dependent and time-dependent, which may mediate photoreceptor rescue indirectly in the pathological process of retinitis pigmentosa (RP) at early stage.

Effects of salvianolic acid B on in vitro growth inhibition and apoptosis induction of retinoblastoma cells

Xing-An Liu
AIM: To observe the effects of salvianolic acid B (SalB) on in vitro growth inhibition and apoptosis induction of retinoblastoma HXO-RB44 cells. METHODS: The effects of SalB on the HXO-RB44 cells proliferation in vitro were observed by MTT colorimetric method. The morphological changes of apoptosis before and after the treatment of SalB were observed by Hoechst 33258 fluorescent staining method. Apoptosis rate and cell cycle changes of HXO-RB44 cells were detected by flow cytometer at 48 hours after treated by SalB. The expression changes of Caspase-3 protein in HXO-RB44 cells were detected by Western Blot. RESULTS: SalB significantly inhibited the growth of HXO-RB44 cells, while the inhibition was in a concentration-and time-dependent manner. The results of fluorescent staining method indicated that HXO-RB44 cells showed significant phenomenon of apoptosis including karyorrhexis, fragmentation and the formation of apoptotic bodies, etc. after 24, 48 and 72 hours co-culturing of SalB and HXO-RB44 cells. The results of flow cytometer showed that the apoptosis rate and the proportion of cells in S phase were gradually increased at 48 hours and 72 hours after treated by different concentrations of SalB. Western Blot strip showed that the expression of Caspase-3 protein in HXO-RB44 cells was gradually increased with the increase of the concentration of SalB. CONCLUSION: SalB can significantly affect on HXO-RB44 cells growth inhibition and apoptosis induction which may be achieved through the up-regulation of Caspase-3 expression and the induction of cell cycle arrest.

Experimental Tibetan monkey domestication and its application for intraocular pressure measurement
AIM: To train Tibetan monkey (Macaca thibetana) for intraocular pressure (IOP) measurement in conscious state and obtain normal IOP in conscious Tibetan Macaque. METHODS: The training was based on award-conditioned behavior. Food stimulation and human-animal interaction were used in this training. RESULTS: Trained Tibetan monkeys calmly accepted IOP measurement by the TonoVet? rebound tonometer without sedation or anesthesia and their IOP values were similar to other primates. CONCLUSION: Human-cultivated Thibetan monkeys are tamable, and can be used for biomedical research such as ophthalmic research without anesthesia.

In vitro reconstruction and characterization of tissue-engineered human corneal epithelium with seeder cells from an untransfected human corneal epithelial cell line

Bin Xu,Ting-Jun Fan,Hong-Shou Yang,Ai Sun,Jun Zhao,Xi-Ya Ma and Xiu-Zhong Hu
AIM: To demonstrate the morphology and structure of in vitro reconstructed tissue-engineered human corneal epithelium (TE-HCEP) with seeder cells from an untransfected HCEP cell line. METHODS: The TE-HCEPs were reconstructed in vitro with seeder cells from an untransfected HCEP cell line, and scaffold carriers of denuded amniotic membrane (dAM) in air-liquid interface culture for 3, 5, 7 and 9 days, respectively. The specimens were examined with hematoxylin-eosin (HE) staining of paraffin-section, immunocytochemical staining, scanning and transmission electron microscopy. RESULTS: During in vitro reconstruction of TE-HCEP, HCEP cells formed a 3-4, 6-7 and 8-10 layers of an HCEP-like structure on dAMs in air-liquid interface culture for 3, 5 and 7 days, respectively. But the cells deceased to 5-6 layers and the structure of straified epithelium became loose at day 9. And the cells maintained positive expression of marker proteins (keratin 3 and keratin 12), cell-junction proteins (zonula occludens-1, E-cadherin, connexin 43 and integrin β1) and membrane transport protein of Na+-K+ ATPase. The HCEP cells in TE-HCEP were rich in microvilli on apical surface and established numerous cell-cell and cell-dAM junctions at day 5. CONCLUSION: The morphology and structure of the reconstructed TE-HCEP were similar to those of HCEP in vivo. The HCEP cells in the reconstructed TE-HCEP maintained the properties of HCEP cells, including abilities of forming intercellular and cell-extracellular matrix junctions and abilities of performing membrane transportation. The untransfected HCEP cells and dAMs could promisingly be used in reconstruction HCEP equivalent for clinical corneal epithelium transplantation.

Establishment of an untransfected human corneal stromal cell line and its biocompatibility to acellular porcine corneal stroma
AIM: To establish an untransfected human corneal stromal (HCS) cell line and characterize its biocompatibility to acellular porcine corneal stroma (aPCS). METHODS: Primary culture was initiated with a pure population of HCS cells in DMEM/F12 media (pH 7.2) containing 20% fetal bovine serum and various necessary growth factors. The established cell line was characterized by growth property, chromosome analysis, tumorigenicity assay, expression of marker proteins and functional proteins. Furthermore, the biocompatibility of HCS cells with aPCS was examined through histological and immunocytochemistry analyses and with light, electron microscopies. RESULTS: HCS cells proliferated to confluence 2 weeks later in primary culture and have been subcultured to passage 140 so far. A continuous untransfected HCS cell line with a population doubling time of 41.44 hours at passage 80 has been determined. Results of chromosome analysis, morphology, combined with the results of expression of marker protein and functional proteins suggested that the cells retained HCS cell properties. Furthermore, HCS cells have no tumorigenicity, and with excellent biocompatibility to aPCS. CONCLUSION: An untransfected and non-tumorigenic HCS cell line has been established, and the cells maintained positive expression of marker proteins and functional proteins. The cell line, with excellent biocompatibility to aPCS, might be used for in vitro reconstruction of tissue-engineered HCS.

Expressions of survivin and vascular endothelial growth factor in a Murine model of proliferative retinopathy

Na Cai,Ning-Ning Liu,Ning Zhao,Chao Wan,Yue-Dong Hu,Yun Zhou and Lei Chen
AIM: To examine the expression of survivin and vascular endothelial growth factor(VEGF) during the development of retinal neovascularization (NV) in a mouse model. METHODS: A well-characterized murine model of retinal NV was used to study the expression of survivin and VEGF. NV of the retina was induced in mice by exposure to 75% O2 from postnatal day P7 to P12, followed by return to room air from P12 to P17. Expression of survivin and VEGF protein was analyzed by Immunohistochemistry. In addition, mouse model of proliferative retinopathy was analyzed by retinal fluorescein angiography and quantification analysis. RESULTS: The normal mice had both superfiekal and deep vascular layers that extended from the optic nerve to the periphery. In intraocular pressure(IOP) mice were characterized by represent a typical pattern of pathological retinal NV. There are less or little nuclei of new vessels vascular endothelial cell breaking through the inner retinal than in retinopathy of prematurity (ROP) mice, large clusters of blood vessels were adherent to the internal limiting membrane(ILM) (0.27±0.20 vs 23.38±1.027, t=9.454, P<0.001). During the angiogenic period from P13 to P17, survivin and VEGF protein expression increased in experimental retinas compared with control samples(2.56±0.46 vs 3.34±0.40, t=17.43, P<0.01: 2.18±0.75 vs 4.34±0.25, t=19.61, P<0.01). Protein levels of VEGF and survivn has significantly positive correlation (P<0.05, r=0.411). CONCLUSION: Correlation was made at the protein levels of survivin expression compared with that of VEGF in a murine model of retinal NV, which suggests a temporal role for survivin and VEGF in new vessel formation in response to hypoxic stimulation.

Early expression of surfactant proteins D in Fusarium solani infected rat cornea
AIM: To investigate the early expression of surfactant proteins D(SP-D) in Fusarium solani infected rat cornea. METHODS: Wistar rats were divided into group A, B and C randomly. The right eyes were chosen as the experiment one. Group A was control group. Group B was not inoculated with Fusarium solani. Group C was taken as fusarium solani keratitis model. Five rats in group B and C were executed randomly at 6, 12, 24, 48 and 96 hours respectively after the experimental model being established. The expression of SP-D was assessed through immunohistochemistry and reverse transcription polymerase chain reaction(RT-PCR). RESULTS: RT-PCR detected that the SP-D mRNA expression was low in the corneal of normal rats and group B. The expression of fungal infected cornea increased gradually and reached the peak at 24 hours in group C. The synchronous expression of group B and C were in significant difference (P<0.01). Immunohistochemisty discovered the protein of SP-D expression was increased gradually from 12 hours and reached the peak at 48 hours in group C. The synchronous expression of group B and C were also in significant difference (P<0.01). CONCLUSION: There exists SP-D in rat corneal tissue and the expression is significantly increased at the early period of fusarium solani infected cornea. SP-D may play a role in the early innate immunity response of the corneal resistance to Fusarium solani infection.

TGFBI and CHST6 gene analysis in Chinese stromal corneal dystrophies
AIM: To investigate whether mutations in TGFBI gene or CHST6 gene correlated with stromal corneal dystrophies (CD) in 8 Chinese probands. METHODS: Eight unrelated patients with stromal corneal dystrophies were recruited in this study; all affected members were assessed by completely ophthalmologic examinations. Genomic DNA was extracted from peripheral leukocytes, 17 exons of TGFBI gene and the exon of CHST6 gene were amplified by polymerase chain reaction (PCR), sequenced directly and compared with the reference database. RESULTS: Three heterozygous mutations in TGFBI gene were identified in six patients: c. 370C>T (p.Arg124Cys) was found in exon 4 of TGFBI gene in three members, c. 371G>A (p.Arg124His) was found in one patient; c. 1663C>T (p.Arg555Trp) was found in exon 12 in other two members. In addition，four polymorphisms with the nucleotide changes rs1442, rs1054124, rs4669, and rs35151677 were found in TGFBI gene. Mutations were not identified in the rest of 2 affected individuals in TGFBI gene or CHST6 gene. CONCLUSION: Within these patients, R124C, R124H and R555W mutations were co-segregated with the disease phenotypes and were specific mutations for lattice corneal dystrophy type I (LCD I), Avellino corneal dystrophy (ACD, GCDⅡ), granular corneal dystrophy type I (GCD I), respectively. Our study highlights the prevalence of codon 124 and codon 555 mutations in the TGFBI gene among the Chinese stromal corneal dystrophies patients.

Transforming growth factor-β neutralizing antibodies inhibit subretinal fibrosis in a mouse model

Han Zhang and Zhe-Li Liu
AIM: To determine the involvement of the transforming growth factor (TGF)-β with the development of experimental subretinal fibrosis in a mouse model. METHODS: Subretinal fibrosis was induced by subretinal injection of macrophage-rich peritoneal exudate cells (PECs) and the local expression of TGF-β isoforms was assessed by quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) and enzyme-linked immunosorbent assay (ELISA) at various time points. In addition, we investigated the effect of TFG-β-neutralizing antibodies (TGF-β NAb) on subretinal fibrosis development. RESULTS: TGF-β1 and TGF-β2 mRNA level was significantly elevated at day 2 after subretinal fibrosis induction and increased further to 5 and 6.5-fold respectively at day 5, reaching the peak. TGF-β3 mRNA was not detected in the present study. The result of ELSIA showed that active TGF-β1 and TGF-β2 levels were upregulated to 10-fold approximately, while total TGF-β1 and TGF-β2 levels were even upregulated more than 10-fold and more than 20-fold respectively in subretinal fibrosis mice in comparison with na?ve mice at day 5. TGF-β NAb resulted in a reduced subretinal fibrosis areas by 65% compared to animals from control group at day 7. CONCLUSION: Our results indicate that TGF-β signaling may contribute to the pathogenesis of subretinal fibrogenesis and TGF-β inhibition may provide an effective, novel treatment of advanced and late-stage neovascular age-related macular degeneration.

Mutually inductive interactions between the lens and retina require ALK3 functions during mouse embryonic development

Qi Zhao,Jiang-Yue Zhao,Di Wu,Xiang-Chuan Lu,Jin-Song Zhang and Zhi-Yu Zhang
AIM: To investigate the mutually inductive interactions that occur between the lens and retinal tissue during the development of the vertebrate eye. METHODS: Cre-positive mice were mated with Cre-negative mice to generate 50% Cre-positive (conditional knockout, CKO) and 50% Cre-negative offspring (wild type, WT). The embryos were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned to a thickness of 4μm. The sections were processed for hematoxylin and eosin staining. The primary antibody used for immunofluorescence detection was sc-9305 bone morphogenetic proteins (bmp7) (Santa Cruz, US). The secondary antibody was IF-0314 aG0IgG/FITC (Santa Cruz) in combination with the primary antibody. Bright-field and fluorescent images were taken. RESULTS: Changes in the lens and retina were associated with specific alterations to the expression of type IA BMP receptor [BMPR-IA (ALK3)], which have already been implicated in eye growth. BMPR-IA was required for lens and retinal growth, but was not essential for the formation of lens. We observed that the expression of Bmp7 in the embryonic retina was reduced in the ALK3 lens of CKO mice. This phenomenon became increasingly visible in accordance with embryo development. This apparent alteration was present at stage E15.5. CONCLUSION: ALK3 is essential for lens and retinal growth. Mutually inductive interactions between the lens and retina are present in the developing mouse eye.

Age-related maculopathy susceptibility 2 participates in the phagocytosis functions of the retinal pigment epithelium

Yi-Ting Xu,Ye Wang,Peng Chen and Hai-Feng Xu
AIM: Age-related macular degeneration (AMD) is a multifactorial disease and a prevalent cause of visual impairment in developed countries. Many studies suggest that age-related maculopathy susceptibility 2 (ARMS2) is a second major susceptibility gene for AMD. At present, there is no functional information on this gene. Therefore, the purpose of the present study was to detect the expression of ARMS2 in retinal pigment epithelium (RPE) cells and to investigate the effect of ARMS2 on the phagocytosis function of RPE cells. METHODS: Immunofluorescence and reverse transcriptase PCR were used to demonstrate the presence and location of ARMS2 in ARPE-19 (human retinal pigment epithelial cell line, ATCC, catalog No.CRL-2302) cells. siRNA was used to knock down ARMS2 mRNA, and the effects of the knockdown on the phagocytosis function of the ARPE-19 cells were evaluated via Fluorescence Activated Cell Sorting (FACS). RESULTS: ARMS2 was present in ARPE-19 cells, localized in the cytosol of the perinuclear region. The expression of ARMS2 mRNA (messenger RNA) in ARPE-19 cells transfected with ARMS2-siRNA (small interfering RNA, 0.73±0.08) was decreased compared with normal cells (1.00±0.00) or with cells transfected with scrambled siRNA (0.95±0.13) (P＜0.05). After incubation of RPE cells with a latex beads medium for 12, 18, or 24 hours, the fluorescence intensities were 38.04±1.02, 68.92±0.92, and 78.00±0.12 in the ARMS2-siRNA-transfected groups, respectively, and 77.98±5.43, 94.87±0.60, and 98.30±0.11 in the scrambled siRNA-transfected groups, respectively. The fluorescent intensities of the same time points in the two groups were compared using Student’s t-test, and the p values were all less than 0.001 at the three different time points. CONCLUSION: There is endogenous expression of ARMS2 in ARPE-19 cells. ARMS2 plays a role in the phagocytosis function of RPE cells, and this role may be one of the mechanisms that participates in the development of AMD.

Effects of 7-methylxanthine on form-deprivation myopia in pigmented rabbits
AIM: To determine the effect of 7-methylxanthine (7-MX) on the posterior sclera of form-deprivation myopia (FDM) in pigmented rabbits. METHODS: Sixteen pigmented rabbits were monocularly deprived (MD) by suturing the right eyelids after natural eye opening (ten-day old) for a period of 30 days. Two groups of pigmented rabbits were fed either 7-MX (30 mg per kg body weight; n=8) or vehicle control (saline equal volume with 7-MX; n=8). Ocular refractions, axial lengths and body weights were measured at the start and the end of the experiment 30 days later. Electron microscopy was used to measure and determine the collagen fibril diameters in the posterior pole of sclera. RESULTS: In vehicle control MD pigmented rabbits, 30 days of MD produced -1.10D±0.78D of myopia and the axial length increased 0.51mm±0.09mm. In MD pigmented rabbits fed with 7-MX, 30 days of MD induced only -0.21D±0.11D of myopia and the axial length increased 0.07mm±0.10mm. There was significant change in axial length of vehicle control MD pigmented rabbits (13.11mm±0.19mm versus 12.60mm±0.06mm; P=0.03). The changes in refraction and axial length of two MD groups’ contralateral eyes during the 30 days were not significantly different (2.75D±0.27D versus 2.75D±0.35D, P>0.05; 12.60mm±0.06mm versus 12.45mm±0.14mm, P>0.05). The weights of the two groups pigmented rabbits had no significant changes (187g±22.1g versus 189g±19.3g, P>0.05). The diameter of scleral collagen fibers increased in both eyes of 7-MX treated pigmented rabbits. There was significant difference in collagen fibril diameters of inner layer (111.34nm±28.30nm versus 94.80nm±27.52nm, P=0.002) and outer layer (167.92nm±55.82 nm versus 144.04 nm±47.02nm, P=0.016) in the posterior sclera between the myopic eyes of vehicle control MD group and contralateral eyes of 7-MX treated MD group. CONCLUSION: 7-MX appears to prevent FDM in pigmented rabbits by remodeling the posterior sclera.

Activation of the ERK 1/2 and STAT3 signaling pathways is required for 661W cell survival following oxidant injury

Shu-Qian Dong,Hui-Zhuo Xu,Xiao-Bo Xia,Sha Wang,Li-Xin Zhang and Shuang-Zhen Liu
AIM: To evaluate the influence of hydrogen peroxide (H₂O₂) on mouse photoreceptor-derived 661W cell survival and to determine the effect of PD98059, an inhibitor for MEK1 (the direct upstream activator of ERK1/2), and S3I201, a STAT3- specific inhibitor on 661W cell survival after H₂O₂exposure. METHODS: The mouse photoreceptor-derived 661W cells were cultured. 661W cells were treated for 12 hours with different concentrations (0, 0.25, 0.50, 0.75, 1mmol/L) of H₂O₂ and cell viability was determined by 3-(4, 5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide )(MTT) assay. 661W cells were treated with different concentrations H₂O₂ (0, 5, 10, 50, 500, 1000 μmol/L) for 15 minutes or 1mmol/L H₂O₂ for different time points (0,5,10,15,30 minutes), and p-Tyr705-STAT3, STAT3, Phospho-p44/42 MAPK (Thr202/Tyr204), ERK1/2 were surveyed by immunoblot analysis. After treatment with 50μmol/L PD98059, or S3I201 for 1 hour, the inhibition efficiency of cell signal pathways was analyzed by immunoblot analysis and the effects of inhibitors on cell viability were determined by MTT. RESULTS: After treating with different concentrations of H₂O₂for 12 hours, the cell viability of 661W cells decreased in concentration-dependent manner (P<0.05). Moreover, H₂O₂ induced phosphorylation of ERK1/2 and STAT3 in 661W cells (P<0.05). After pretreatment with 50μmol/L PD98059 or S3I201 for 1 hour, H2O2-induced phosphorylation of ERK1/2 or STAT3 was suppressed separately (P<0.05). Using PD98059 or S3I201 to inhibit ERK1/2 or STAT3 signal pathway, the cell viability of 661W cells decreased significantly (P<0.05). CONCLUSION: We demonstrated that the exposure of 661W cells to H₂O₂ increased the activation of ERK1/2 and STAT3 signal pathways. Activation of these pathways is required for 661W cell survival following oxidant injury.

Antifungal efficacy of natamycin in experimental fusarium solani keratitis

Xian-Hui Dong,Wei-Juan Gao and Xiao-Ping He
AIM: To evaluate the efficacy of topical administration Natamycin, which is produced by China, in an experimental rabbit model of Fusarium solani keratitis, to provide experimental basis for the application of clinical safety. METHODS: Fusarium solani was induced in the right eye of 30 New Zealand rabbits. Forty-eight hours after inoculation, the animals were divided into 3 different treatment groups, 10 rabbit eyes of each group: Group 1 (Natamycin) treated with topical Natamycin, group 2 (Natacyn) treated with topical Natacyn, group 3 (control) treated with topical saline solution. The eyes of each group was examined clinically with slit lamp using ulcer scoring system on day 4, 10, 15, and 21 for status of healing, corneal vascularisation, iritis, hypopyon and macular nebula. The findings were recorded on day 10 and day 21. RESULTS: Ulcer score on day 10, day 15, day 21: The score of Natamycin group are 1.45±0.16, 1.08±0.11, 0.70±0.40. The score of Natacyn group are 1.35±0.12, 1.10±0.12, 0.65±0.35. the score of control group are 1.30±0.08, 3.63±0.28, 3.80±0.16. Natamycin group and Natacyn group were different from control group (P<0.01). There is no difference between Natamycin group and Natacyn group. Status of healing on day 10 and day 21: The cure rate of the Natamycin group is 90% on day 10, and 100% on day 21. The cure rate of the Natacyn group is 80% on day 10, and 100% on day 21.Natamycin group and Natacyn group were different from control group (P<0.01) There is no difference between Natamycin group and Natacyn group. Corneal vascularisation, iritis, hypopyon and macular nebula on day 10 and day 21: in Natamycin group, the number of the eyes which have Corner vascularisation, iritis, hypopyon and macular nebula are 2,0,0,2. In Natacyn group, the number of the eyes which have Corner vascularisation, iritis, hypopyon and macular nebula are 1,0,0,2. In control group, the number of the eyes which have Corner vascularisation, iritis, hypopyon and macular nebula are 9,9,8,9.Natamycin group and Natacyn group were different from control group (P<0.01). There is no difference between Natamycin group and Natacyn group. CONCLUSION: Natamycin was found to be effective in fungal keratitis, similar to Natacyn, and it can stop the corner vascularisation, iritis, hypopyon and macular nebula to happen. Natamyin manufactured in China is effective against fungal keratitis, with esay availability and low toxicity in its use.

Experimental study on the treatment of rabbit corneal melting after alkali burn with Collagen cross-linking

Xiao-Wei Gao,Xu-Dong Zhao,Wen-Jing Li,Xin Zhou and Ying Liu
AIM: To evaluate the effect of Collagen cross-linking on the prevention of melting in rabbit corneas after alkali burn. METHODS: Twenty New Zealand white rabbits were randomly divided into model control group and collagen cross-linking treatment group. The second group of rabbits received collagen cross linked treatment. Both groups were applied with antibiotic eye drops to prevent infection. The corneas were evaluated for melting, opacity, pathological and immunohistochemistry, record the changes when 28 days after the animals were killed. RESULTS: In the control group, 6 out of 8 rabbits showed corneal melting after injury (14±4) days, while two corneal perforated. In collagen cross-linking treatment group, one rabbit showed corneal melting after injury 23 days, without corneal perforation; corneal dissolution rate between the two groups was significantly different (P <0.05). Pathological examination suggested that in the treatment group, mild corneal edema, mild damage to collagen fibers, inflammatory cell infiltration was significantly less than the control group. Immunohistochemistry showed that corneal collagen fibers arranged in neat rows in the control group. CONCLUSION: Collagen cross-linking treatment not only can prevent and delay the corneal melting after alkali burn, but also can reduce the destruction of corneal collagen fibers and infiltration of inflammatory cells in the corneal tissue.

Protective effect of saturated hydrogen saline against blue light-induced retinal damage in rats

Mei Feng,Xing-Hua Wang,Xiao-Bo Yang,Qing Xiao and Fa-Gang Jiang
AIM: To explore the effect of saturated hydrogen saline on blue light-induced retinal damage in rats. METHODS: The retinal damage of rats was induced by blue light exposure for 6 hours and examined 8 hours, 16 hours and 24 hours after the exposure. One hundred female Sprague-Dawley rats were randomly divided into four groups. Group 1 included 30 rats received light exposure without any other treatment. Group 2 included 30 rats received light exposure with intraperitoneal injection of normal saline. Group 3 included 30 rats received light exposure with intraperitoneal injection of saturated hydrogen saline. And Group 4 included the other 10 rats which did not receive any treatment. The amount of intraperitoneal injection of saturated hydrogen saline and normal saline was calculated in the ratio of 1ml/100g of rat weight. Specimens were collected and processed by H-E staining, ultrastructure observation, biochemical measurement. Morphological changes were observed by light microscope and transmission electron microscope (TEM) and the retinal outer nuclear layer (ONL) thickness was measured by IPP 6.0, while the malondialdehyde (MDA) was measured by colorimetric determination at 532 nm. RESULTS: Although the structure of retina in Group 1 and Group 2 was injured heavily, the injury in Group 3 was mild. The differences between Group 1 and Group 2 were not significant. Compared with the rats in Group 1 and Group 2, the ones in Group 3 had more clearly demarcated retina structure and more ordered cells by light microscope and TEM observation. The ONL thicknesses (400 times) of four groups at each time point except between Group 1 and Group 2 were significantly different (P<0.05). The thicknesses of the ONL in Group 1 at three time points were 30.41±4.04μm, 26.11±2.82μm and 20.63±1.06μm, in Group 2 were 31.62±4.54μm, 25.08±3.63μm and 19.07±3.86μm, in Group 3 were 29.75±3.62μm, 28.83±1.97μm and 27.61±1.83μm. In Group 4 the mean of the thickness was 37.35±1.37μm. As time went by, the damage grew more severely. At 24h point, the differences were most significant. Compared with Group 4, the thickness was 46.23% thinner in Group 1, 50.29% thinner in Group 2 and 28.04% thinner in Group 3. The stack structures of membranous disc in Group 3 were injured slightly, but in Group 1 and Group 2 the damage was more obvious by TEM. Compared with Group 4 at each time point, the content of MDA in Group 1 was higher (P<0.05). The content of MDA in Group 3 was significantly lower than those of Group 1 (P<0.05) and Group 2 (P<0.05). Between the Group 1 and Group 2, the MDA concentration at each time point was no significant difference (P>0.05). CONCLUSION: Saturated hydrogen saline could protect the retina from light-induced damage by attenuating oxidative stress.

In vitro transdifferentiation of corneal epithelial-like cells from human skin-derived precursor cells

Sarawut Saichanma,Ahnond Bunyaratvej and Monnipha Sila-asna
The damage of human corneal cells encounter with the problem of availability of corneal cells for replacement. Limitation of the source of corneal cells has been realized. An attempt of development of corneal epithelial-like cells from the human skin-derived precursor (hSKPs) has been made in this study. Combination of three essential growth factors: epidermal growth factor (EGF), keratinocyte growth factor (KGF) and hepatocyte growth factor (HGF) could demonstrate successfully induction of hSKPs to differentiation into corneal cells. The induced cells expressed the appearance of markers of corneal epithelial cells as shown by the presence of keratin 3 (K3) by antibody label and Western blot assay. The K3 gene expression of induced hSKPs cells as shown by reverse transcription-polymerase chain reaction (RT-PCR) technology was also demonstrated. The presence of these markers at both gene and protein levels could lead to our conclusion that the directional transdifferentiation of hSKPs cells into corneal epithelial cells was successfully done under this cell induction protocol. The finding shows a newly available stem cell source can be obtained from easily available skin. Cells from autologous human skin might be used for corneal disorder treatment in future clinical application.

A comparing study of quantitative staining techniques for retinal neovascularization in a mouse model of oxygen-induced retinopathy

Xiao-Ling Liang,Jie Li,Fang Chen,Xiao-Yan Ding,Xiu-Xia Yang and Liao-Xu Long
AIM: To explore an efficient, practical and objective quantitative method to evaluate the retinal neovascularization in mouse model of oxygen induced retinopathy (OIR). METHODS: Thirty C57BL/6J mice were explored in OIR model procedure. Eyes were removed for different staining methods including: (1) HE staining; (2) immunohistochemistry with Griffonia Simplicifolia Lectin(GSL);(3) Immunofluore- scence with FITC labeled CD31 antibody; (4) Two-step immunofluorescence with purified-CD31 antibody; (5) FITC-Dextran perfusion combined with two-step purified- CD31immunofluorescence. Images of the retinal vasculature were analyzed by imaging software. RESULTS: GSL immunohistochemistry could clearly demonstrate the deep and superficial capillary beds. FITC labeled CD31 Immunofluorescence was blurring with high fluorescence background which was hard to distinguish retinal neovascularization in some area. Excellent detail of neovas- cularization and preexistent retinal vessels was provided in two-step Purified-CD31 immunofluorescence group. CONCLUSION: GSL immunohistochemistry can clearly demonstrate neovascularization tufts in deep and superficial capillary beds. Immunofluorescence of specific antigen CD31 on vascular endothelium can selectively label the neovascularization of mouse retina. When combined with computer analysis software, it is an effective and objective quantitative method to evaluate the retinal neovascularization in OIR mouse model.

Inhibited experimental corneal neovascularization by neutralizing anti-SDF-1α antibody

Gao-Qin Liu,Pei-Rong Lu,Long-Biao Li and Xue-Guang Zhang
AIM: To explore the effect of SDF-1α on the development of experimental corneal neovascularization (CRNV). METHODS: CRNV was induced by alkali injury in mice. The expression of SDF-1α and CXCR4 in burned corneas was examined by Flow Cytometry. Neutralizing anti-mouse SDF-1α antibody was locally administrated after alkali injury and the formation of CRNV 2 weeks after injury was assessed by Immunohistochemistry. The expression of VEGF and C-Kit in burned corneas was detected by RT-PCR. RESULTS: The number of CRNV peaks at 2 weeks after alkali injury. Compared to control group, SDF-1α neutralizing antibody treatment significantly decreased the number of CRNV. RT-PCR confirmed that SDF-1α neutralizing antibody treatment resulted in decreased intracorneal VEGF and C-Kit expression. CONCLUSION: SDF-1α neutralizing antibody treated mice exhibited impaired experimental CRNV through down regulated VEGF and C-Kit expression.

The roles of surfactant protein D during Aspergillus fumigatus infection in human corneal epithelial cells
AIM: To investigate roles of surfactant protein D (SP-D) and relative cytokines in human corneal epithelial(HCE) cells exposed to aspergillus fumigatus (AF) antigens. METHODS: HCE cells cultured in vitro with AF antigens and sampled at 0, 0.5, 1 hour, 2, 4, 6 and 8 hours. The expression of SP-D mRNA was evaluated by semiquantitative reverse transcription-polymerase chain reaction (RT-PCR).The expression of SP-D protein was shown by ELISA and immunocytochemistry SP methods. The expression of NF-κB and relative downstream cytokines such as TNF-α, IL-1β, IL-8 and IL-10 in supernatant fluid were measured by ELISA. RESULTS: SP-D mRNA and protein were detected in untreated HCE cells. The expression of SP-D and the relative downstream cytokines rose after being stimulated with AF antigens. SP-D mRNA began to rise at 0.5 hour and the most significantly peak was in 2 hours. The protein of SP-D in supernatant fluid had the same trend with mRNA. Immunocytochemistry of SP-D showed positive expression and gradually increased to 6 hours, and then the expression began to decline. NF-κB was activated after treated by AF antigens and the changes had correlation with SP-D. TNF-α, IL-1β, IL-8 and IL-10 began to rise after given AF antigens 1 hour and were 1.82, 1.43, 1.12 and 1.28 times higher than the untreated HCE cells separately. The expression of TNF-α and IL-1β reached the peak at 2 hours, separately 2.80 and 2.86 times than the untreated. The expression of IL-8 and IL-10 gradually increased with a time-dependent manner. CONCLUSION: HCE cells exists SP-D and it may play a significant role in pathogenesis of keratomycosis. AF may induce human corneal epithelial cells to express inflammatory cytokines via SP-D and NF-κB pathway. SP-D possibly mediates the recognition to AF mycelium.

The study of human PDGF-B gene transferred to cat corneal endothelial cells

Wen-Juan Luo,Xiao-Ji Wang,Xiao-Ming Xing and Chuan-Fu Wang
AIM: To demonstrate that human platelet-derived growth factor-B (PDGF-B) cDNA could be expressed in primary cultured cat corneal endothelia cells by using gene transfer techniques; to explore a useful tool for the further studies of the molecular mechanisms of corneal endothelium failure and provide a potential effective genetic therapy for the blind patients. METHODS: Human PDGF-B cDNA was isolated from human placent by RT-PCR and inserted into pcDNA4 vector to construct recombinant eukaryotic expression plasmid pcDNA4-PDGF-B. The full length was confirmed by the DNA sequencing analysis. By tearing endothelium technique we obtained pure single layer of cat corneal endothelial cells. The pcDNA4-PDGF-B eukaryotic expression vector was transferred into cat corneal endothelial cells by EffecteneTM lipofectine. The transfection efficiency of EffecteneTM lipofectine in pcDNA4-B was detected with pcDNA4-GFP. 5 days later, RT-PCR was used to check the PDGF-B expression. Cell viability was tested by modified tertrozalium salt (MTT) method. Cell morphology was observed under inverted phase contrast microscope. RESULTS: The human PDGF-B cDNA was isolated successfully from healthy parturien placent tissue and the sequence was confirmed by computer automatic sequence and PCR analysis. Pure single layer cat corneal endothelial cells were successfully cultured by tearing endothelium technique. EffecteneTM lipofectine transfection technique could be effectively used to transfer pcDNA4-PDGF-B into cat corneal endothelial cells in vitro, the transfection efficiency was 30%. RT-PCR result showed that human PDGF-B gene was highly expressed in transfected cat corneal endothelial cells. The expressed PDGF-BB protein promoted the viability of cat corneal endothelial cells. CONCLUSION: Human platelet-derived growth factor-B (PDGF-B) cDNA could be highly expressed in cultured cat corneal endothelial cells by gene transfection techniques. Expressed PDGF-BB protein significantly promoted the viability of cat corneal endothelial cells, thus provided a potential effective method for corneal endothelium blindness genetic therapy.

Auto-cortex of crystalline lens-induced iris neovascularization

Lin Liu,Yong-Ping Li,Bo Zhang and Wen-Xin Zhang
AIM：To investigate auto-cortex of crystalline lens induced iris neovascularization (INV). METHODS: Thirty-six eyes of 36 guinea-pigs were included and divided into three groups randomly in this cohort study. Group A: the right lens nucleus was extracted and the remaining cortical lens material was aspirated thoroughly. Group B: the lens was removed and 30μL precipitated lens cortex was injected into the anterior chamber again. Group C: aspirated the lens cortex of the left eyes and inject them into the right anterior chambers about 10μL. Clinical changes were followed by slit-lamp examination and photograph. The eye balls were enucleated at the day of 2, 4, 7, 11, 13, 17 after operation. HE was used to detect the pathological changes. RESULTS：Group A：INV had not been observed until the end of empirical study. The stromal layer contained thick wall vessels, without expansion. Group B: All eyes developed INV. Postoperative (po) 7 days; the eyes developed intense and extensive INV. The vessels of iris expanded remarkably and neovascularization was observed erupting from it’s lateral wall and stretching towards the anterior surface. Po11 days, INV regressed gradually after lens cortex had been absorbed. Group C: Po four（4） days, new blood vessels liking red line were presented on the anterior surface of the iris and they were not obvious. CONCLUSION: Anterior chamber inside lens coriaceous can induce iris new blood vessels.

Complete mitochondrial DNA sequence analysis in two southern Chinese pedigrees with Leber hereditary optic neuropathy revealed secondary mutations along with the primary mutation

Lei Shu,Yong-Ming Zhang,Xiao-Xiao Huang,Chun-Yue Chen and Xian-Ning Zhang
AIM: To investigate mitochondrial factors associated with Leber hereditary optic neuropathy (LHON) through complete sequencing and analysis of the mitochondrial genome of Chinese patients with this disease. METHODS: Two unrelated southern Chinese families with LHON and 10 matched healthy controls were recruited, and their entire mitochondrial DNA (mtDNA) was amplified and sequenced with the universal M13 primer. Then DNA sequence analysis and variation identification were perfomed by DNAssist and Chromas 2 software and compared with authoritative databases such as Mitomap. RESULTS: Mutational analysis of mtDNA in these two Chinese pedigrees revealed one common LHON-associated mutation, G11778A (Arg→His), in the MT-ND4 gene. In addition, there were two secondary mutations in Pedigree 1: C3497T (Ala→Val), and C3571T (Leu→Phe) in the MT-ND1 gene, which have not been reported; and two secondary mutations occurred in Pedigree 2: A10398G (Thr→Ala) in the MT-ND3 gene, and T14502C (Ile→Val) in the MT-ND6 gene. Three polymorphisms, A73G, G94A and A263G in the mtDNA control region, were also found. CONCLUSION: Our study confirmed that the known MT-ND4*G11778A mutation is the most significant cause of LHON. The C3497T and C3571T mutations in Pedigree 1 were also both at hot-spots of MT-ND1; they may affect the respiratory chain in coordination with the primary mutation G11778A. In Pedigree 2, the two secondary mutations A10398G of MT-ND3 and T14502C of MT-ND6 may influence mitochondrial respiratory complex I, leading to the mitochondrial respiratory chain dysfunction which results in optic atrophy together with G11778A. Therefore, not only the common primary LHON mutation is responsible for the visual atrophy, but other secondary mtDNA mutations should also be considered when giving genetic counseling.

Comparison of the therapeutic effects of extracts from Spirulina platensis and amnion membrane on inflammation-associated corneal neovascularization

Ling-Ling Yang,Qing-Jun Zhou,Yao Wang,Yan Gao and Yi-Qiang Wang
AIM: To compare the therapeutic effects of polysaccharide extract from Spirulina platensis (PSP) and extract from amnion membrane (AME) on alkali burn-induced corneal neovascularization (CorNV). METHODS: PSP and AME were extracted from dry powder of Spirulina platensis and human aminion membrane respectively. Murine CorNV was induced by applying 1N sodiumhydroxide (NaOH) solution directly on the mice corneas. PSP and AME extracts were administered topically on the corneas 4 times daily for 7 days. The therapy effects of PSP and AME extracts were evaluated daily using slit-lamp. At the end of the therapy, corneas were harvested for H&E staining, masson trichrome staining, immunohistochemical study, and semi-quantification reverse transcriptive PCR (RT-PCR) was utilized for measurement of inflammation-related molecules. RESULTS: Topical application of PSP extract had significant therapeutic effects on CorNV that could be shown in various assays of the corneas. Compared with AME extract, PSP extract treatment was more effective in suppressing CorNV in terms of vessel length and levels of cluster of differentiation 31 (CD31) proteins or the angiogenesis related genes like vascular endothelial growth factor (VEGF), matrix metalloproteinase-2 (MMP2) and matrix metalloproteinase-9 (MMP9). PSP also inhibited inflammation more markedly by more effectively inhibiting mononuclear and polymorphonuclear cells infiltration into the corneal stroma and reducing levels of stromal cell-derived factor-1 (SDF1), tumor necrosis factor-alpha (TNFα) and macrophage inflammatory protein-3 (MIP3a). In additon, corneas of PSP group had a more regular and compact architecture of collagen with thinner corneal thickness than in the AME group. CONCLUSION: Polysaccharide extract from Spirulina platensis inhibited alkali burn-induced inflammation and CorNV more effectively than AME extract at the studied doses, thus may be used for the therapy of corneal diseases involving neovascularization and inflammation.

Construction of eukaryotic plasmid expressing human TGFBI and its influence on human corneal epithelial cells
AIM: To detect the expression of transforming growth factor beta-induced gene (TGFBI) protein in human corneal tissue and overexpress it in the human corneal epithelial cells in order to discuss the function of TGFBI in the pathogenesis of corneal dystrophy. METHODS: Immunohistochemistry(IHC) was used to detect the expression of TGFBI in the human cornea tissue. TGFBI cDNA was obtained by reverse transcription-PCR from human corneal total RNA extracted from cornea transplant donor and cloned into pCMV-N-HA vector. The recombinant pCMV-N-HA-TGFBI plasmid transfected human corneal epithelial cells. Forty-eight hours later, mRNA and proteins were harvested from cells for real-time PCR analysis and western blot assay respectively. RESULTS: IHC indicated TGFBI mainly exist below the human corneal epithelium layer. Transfection of recombinant pCMV-N-HA-TGFBI into human corneal epithelial cells resulted in effective expression of TGFBI, as shown by increased mRNA level detected by real-time PCR as well as increased protein level detected by Western blot. Meanwhile the result of real-time PCR and Western blot shown the expression of MMP1，MMP3 (matrix metalloproteinases MMP) increased while the expressin of TIMP1 (tissue inhibitors of matrix metalloproteinases TIMP) decreased. CONCLUSION: TGFBI mainly exists below the corneal epithelial layer, recombinant eukaryotic expression vector harboring human TGFBI cDNA was obtained and efficiently overexpressed in human corneal epithelial cells. Meanwhile the TGFBI overexpression in human corneal epithelial cells result in MMP1, MMP3 increasing and TIMP1 decreasing. The result might be helpful for studying the function and role of TGFBI in pathogenesis of corneal dystrophy.

Study on the optical property and biocompatibility of a tissue engineering cornea
AIM: To study the optical property and biocompatibility of a tissue engineering cornea. METHODS: The cross-linker of N-(3-Dimethylaminoropyl)-N’ethylcarbodiimide hydrochloride (EDC)/ N-Hydroxysuccinimide (NHS) was mixed with Type I collagen at 10% (weight/volume). The final solution was molded to the shape of a corneal contact lens. The collagen concentrations of 10%, 12.5%, 15%, 17.5% and 20% artificial corneas were tested by UV/vis-spectroscopy for their transparency compared with normal rat cornea. 10-0 sutures were knotted on the edges of substitute to measure the corneal buttons’s mechanical properties. Normal rat corneal tissue primary culture on the collagen scaffold was observed in 4 weeks. Histopathologic examinations were performed after 4 weeks of in vitro culturing. RESULTS: The collagen scaffold appearance was similar to that of soft contact lens. With the increase of collagen concentration, the transparency of artificial corneal buttons was diminished, but the toughness of the scaffold was enhanced. The scaffold transparency in the 10% concentration collagen group resembled normal rat cornea. To knot and embed the scaffold under the microscope, 20% concentration collagen group was more effective during implantation than lower concentrations of collagen group. In the first 3 weeks, corneal cell proliferation was highly active. The shapes of cells that grew on the substitute had no significant difference when compared with the cells before they were moved to the scaffold. However, on the fortieth day, most cells detached from the scaffold and died. Histopathologic examination of the primary culture scaffold revealed well grown corneal cells tightly attached to the scaffold in the former culturing. CONCLUSION: Collagen scaffold can be molded to the shape of soft contact corneal lens with NHS/EDC. The biological stability and biocompatibility of collagen from animal species may be used as material in preparing to engineer artificial corneal scaffold.

Influences of levodopa on expression of N-methyl-D-aspartate receptor-1-subunit in the visual cortex of monocular deprivation rats

Xiao-Nan Sun and Jin-Song Zhang
AIM: Many studies have demonstrated N-methyl-D-aspartate receptor-1-subunit (NMDAR1) is associated with amblyopia. The effectiveness of levodopa in improving the visual function of the children with amblyopia has also been proved. But the mechanism is undefined. Our study was to explore the possible mechanism. METHODS: Sixty 14-day-old healthy SD rats were randomly divided into 4 groups, including normal group, monocular deprivation group, levodopa group and normal saline group, 15 rats each. We sutured all the rats’ unilateral eyelids except normal group to establish the monocular deprivation animal model and raise them in normal sunlight till 45-day-old. NMDAR1 was detected in the visual cortex with immunohistochemistry methods, Western Blot and Real time PCR. LD and NS groups were gavaged with levodopa(40mg/kg) and normal saline for 28 days respectively. NMDAR1 was also detected with the methods above. RESULTS: NMDAR1 in the visual cortex of MD group was less than that of normal group. NMDAR1 in the visual cortex of LD group was more than that of NS group. CONCLUSION: NMDAR1 is associated with the plasticity of visual development. Levodopa may influence the expression of NMDAR1 and improve visual function, and its target may lie in the visual cortex.

Clinical significance of serum biochemistry changes in mice with targeted disruption of βB2-crystallin gene

Fen-Fen Xiang,Bei Cui,Qian Gao,Jian-Rong Zhang,Lin Liu and Wen-Jie Li
AIM: To explore the pathogenesis, influencing factors, ways of medical intervention and evaluation indicators of cataract by observing changes in serum biochemical indices in mice with targeted disruption of βB2-crystallin. METHODS: Nine 6-week-old male mice with targeted knockout of βB2-crystallin were used as the study group, and nine age- and sex-matched normal wild-type mice as the control group. The genetype of the modeled mice was identified by PCR technique. Tropicamide and phenylephrine eye drops were used as the cycloplegic agents to observe changes in lens opacity with a slit-lamp. The lens was then removed and blood was collected for biochemical evaluation in the serum. RESULTS: Two genotypes were successfully identified by PCR technique. Slit-lamp observation showed that the lens cortex was opaque and GSH level in the lens cortex was remarkably decreased in mice with βB2-crystallin deficiency compared with the control group (P<0.01). Serum Na+, Cl-, Ca2+, Mg2+ and Fe2+ levels, ALT and AST activities, and TP, ALP, Cr, TC, GLU content were decreased significantly compared with the control group (P<0.05). There was no difference in LDH, P, Cu2+, K+ levels between the two groups (P>0.05). CONCLUSION: Compared with the wild-type mice, serum biochemical indices underwent significant changes in mice with targeted disruption of βB2-crystallin gene, especially with abnormal distribution of Na+&Ca2+, which induced the formation of cataract.

Comparison of design of intraocular lens versus the material for PCO prevention

Sarbani Hazra,Himangshu Palui and Geeta K Vemuganti
AIM: To evaluate the influence of different intraocular lens(IOL) designs made of PMMA on posterior capsular opacification(PCO) and compare with foldable designs. METHODS: Phacoemulsification and IOL implantation was done in one eye of 24 New Zealand White rabbits, with IOL of two different designs (Square edged or round edge) and two different materials(PMMA or HEMA). After three months, the animals were sacrificed and enucleated. Evaluation of PCO included posterior view, migration of anterior capsular epithelial cells to the posterior capsule following epithelial-mesenchymal transition were assessed by staining the histological sections of posterior capsule by hematoxylin-eosin(HE) and Periodic acid- Schiff (PAS). The IOLs were extracted and stained with HE to evaluate the presence of adherent cells on the lens surface. RESULTS: PCO was highest with round edged rigid lens. There was no significant difference in the PCO between the square edged PMMA and square edged foldable lens. CONCLUSION: It is the design of the IOL not the material that offers protection on PCO formation.

Effects of estrogen replacement therapy on apoptosis and vascular endothelial growth factor expression in ocular surface epithelial cells: An experimental study
AIM: To investigate the effects of estrogen replacement therapy (ERT) on apoptosis and vascular endothelial growth factor (VEGF) expression in ocular surface in an experimental rat model. METHODS: Forty female, Wistar rats were randomized in 4 groups in the study. Subcutaneous ERT (17β-estradiol, 10μg/kg/day) was administered to the first group without ovariectomy and to the second group with ovariectomy for three months. Third group had only ovariectomy and fourth group had sham operation. All rats were sacrificed in estrous cycles determined by vaginal smear test and their right eyes were enucleated at the end of the third month. Enucleated eyes were analyzed by immunohistochemical method for expressions of caspase-3, bcl-2, VEGF and TUNEL assay. RESULTS: Caspase-3 expression of conjunctival epithelium was significantly higher in group 3 than group 1 (P=0.005), and group 2 (P=0.007). TUNEL score of conjunctival epithelium was significantly higher in group 3 than group1 (P=0.006). TUNEL score of corneal epithelium was significantly higher in group 3 than group 2 (P=0.012), and group 4 (P=0.002). There was no significant difference between groups in that bcl-2 and VEGF expressions. CONCLUSION: We determined increased apoptosis in ocular surface epithelial cells in ovariectomized rats. ERT and endogen estrogen decreased the apoptosis, and did not result in difference in VEGF expression between the groups. Estrogen may be beneficial for the treatment of apoptosis-mediated ocular surface disorders such as dry eye. Further studies are needed on this subject for a better understanding of the role of estrogen and to provide a new insight for treatment and prevention of apoptosis-mediated ocular surface disorders.

A novel Norrie disease pseudoglioma gene mutation, c.-1_2delAAT, responsible for Norrie disease in a Chinese family

Xin-Yu Zhang,Wei-Ying Jiang,Lu-Ming Chen and Su-Qin Chen — 2013/12/22 0:00:00
AIM:To investigate the genetic findings and phenotypic characteristics of a Chinese family with Norrie disease (ND).METHODS:Molecular genetic analysis and clinical examinations were performed on a Chinese family with ND. Mutations in the Norrie disease pseudoglioma (NDP) gene were detected by direct sequencing. Haplotypes were constructed and compared with the phenotypes in the family. Evolutionary comparisons and mutant open reading frame (ORF) prediction were also undertaken.RESULTS:Two family members with ocular manifestations were diagnosed with ND. No signs of sensorineural hearing loss were observed in either patient, while one of them showed signs of mild mental retardation. A novel heterozygous mutation in the NDP gene, c.-1_2delAAT, was detected in both patients. The mutation and the mutation bearing haplotype co-segregated with the ND phenotype in males and was transmitted from their mothers and/or grandmothers (II:2). The male without ND did not harbor the mutation. The mutation occurred at the highly conserved nucleotides. ORF finder predicted that the mutation would lead to the production of a truncated protein that lacks the first 11 N-terminal amino acids.CONCLUSION:A novel mutation, c.-1_2delAAT in the NDP gene, was identified in a Chinese family with ND. This mutation caused ND without obvious sensorineural hearing loss. Mental disorder was found in one but not the other patients. The clinical heterogeneity in the family indicated that other genetic variants and epigenetic factors may also play a role in the disease presentation.

Protective effect of basic fibroblast growth factor on laser induced retinopathy

Unal Kartal,Emel Koptagel,H. Eray Bulut and Haydar Erdogan — 2013/12/22 0:00:00
AIM:To investigate the side effects of the commonly used laser treatment along with testing the neuroprotective effect of bFGF on a potential retinal impairment.METHODS: To do this, 30 chinchilla pigmented adult male rabbits were divided into the control and experimental groups. The control and experimental groups underwent both laser application and bFGF treatment. The retinal tissue impairment and its renewal rate were tested under the light and electron microscopical levels.RESULTS:The focal laser application on rabbit eyes caused morphological alterations both in the application region and in the neighbouring areas. In the damaged areas, the outer nuclear layer of the neural retina was almost disappeared, retina pigment epithelium was interrupted, the retina pigment epithelium migrated intraretinally, and the damaged region along with neighbouring areas seemed to be not separated. bFGF application just after the laser photocoagulation, revealed better results in application areas.CONCLUSION:It could be suggested that the bFGF application following laser photocoagulation might have protective, repairing and wound healing effects on the retina.

Effects of transforming growth factor β2 and connective tissue growth factor on induction of epithelial mesenchymal transition and extracellular matrix synthesis in human lens epithelial cells

Cheng Pei,Bo Ma,Qian-Yan Kang,Li Qin and Li-JunCui — 2013/12/22 0:00:00
AIM:To investigate the effects of transforming growth factorβ2 (TGF-β2) and connective tissue growth factor (CTGF) on transdifferentiation of human lens epithelial cells (HLECs) cultured in vitro and synthesis of extracellular matrix (ECM).METHODS:HLECs were treated with TGF-β2 (0, 0.5, 1.0, 5, 10μg/L) and CTGF (0, 15, 30, 60, 100μg/L) for different times (0, 24, 48, 72h) in vitro and the expression of α-smooth muscle actin (α-SMA), the main component of the extracellular matrix type I collagen (Col-1) and fibronectin (Fn) were measured by using real-time polymerase chain reaction (PCR) and western-blot.RESULTS: TGF-β2 and CTGF significantly increased expression of α-SMA mRNA and protein (P<0.05, P<0.001), Fn mRNA and protein (P<0.001), Col-1 mRNA and protein (P<0.001). TGF-β2 could induce HLECs expression of CTGF mRNA and protein in dose-dependent manner (P<0.05, P<0.001). TGF-β2 and CTGF could induce HLECs to express α-SMA, Fn and Col-1 in time-dependent manner. Each time of TGF-β2 and CTGF induced HELCs expression of α-SMA, Fn, Col-1 mRNA and protein was significant increase compared with control (P<0.05, P<0.001).CONCLUSION: TGF-β2 and CTGF could induce HLECs epithelial mesenchymal transition and ECM synthesis.

Using bovine pituitary extract to increase proliferation of keratocytes and maintain their phenotype in vitro

Zhong-Zhong Xu,Zhi-Jie Li,Lian-Xin Du,Jing Li and Li-Ya Wang — 2013/12/22 0:00:00
AIM: To investigate the effects of bovine pituitary extract on the proliferation of keratocytes and maintaining the keratocyte phenotype in vitro.METHODS: Single keratocytes were isolated by enzyme digestion for in vitro culture. Three groups were designed according to the different culture media:a bovine pituitary extract (BPE) group, a fetal bovine serum (FBS) group and the control group. The phenotypes and proliferation of cultured cells were evaluated by morphology, immunofluorescent staining and mRNA expression of CD34, Lumican, VSX1, α-SMA and proliferating cell nuclear antigen (PCNA). In the BPE group, cells underwent serial subcultivation, and their phenotypes were identified by immunofluorescent staining. To analyze the proliferation of keratocytesin differentconcentrations of BPE, six differentconcentrations were designed to ascertain the most appropriate amount.RESULTS: In the BPE group, the cells spread out and presented dendritic morphology, and their dendrites connected to one another to form networks. On the third passage, most cells maintained their phenotype. In the FBS group, the cells exhibited a dendritic appearance in early cultured stages, but their morphology subsequently changed into a fibroblast-like shape. The number of dendritic cells in BPE group was more than FBS and control groups. Immunofluorescent staining and real-time polymerase chain reaction (PCR) confirmed that few keratocytes underwent fibroblastic transformation in the BPE and control groups, and that proliferation was higher in the BPE group than in the control group. Although the proliferation was higher in the FBS group, many keratocytes underwent fibroblastic transformation.Theanalysis of cell morphology and mRNA expressions of CD34, PCNA and VSX1 in six group showed that different concentrations of BPE affected the proliferation obviously but didn’t affect the keratocyte phenotype, and the concentration of 40μg/mL was the most appropriate one.CONCLUSION: BPE can improve the proliferation of keratocytes and maintain their phenotype in vitro. Many keratocytes can be harvested rapidly and provide seeds for the construction of corneal stroma.

Local anesthetic lidocaine induces apoptosis in human corneal stromal cells in vitro

Xin Zhou,Yi-Han Li,Hao-Ze Yu,Rui-Xin Wang and Ting-Jun Fan — 2013/12/22 0:00:00
AIM: To demonstrate the apoptosis-inducing effect of lidocaine on human corneal stromal (HCS) cells in vitro, and provide experimental basis for safety anesthetic usage in clinic of ophthalmology.METHODS: In vitro cultured HCS cells were treated with lidocaine at different doses and times, and their morphology was monitored successively with inverted phase contrast microscopy. The membrane permeability of them was detected by acridine orange/ethidium bromide (AO/EB) double staining. The DNA fragmentation of them was examined by agarose gel electrophoresis, and their ultrastructure was observed by transmission electron microscopy (TEM), respectively.RESULTS: Exposure to lidocaine at doses from 0.3125g/L to 20g/L induced morphological changes of HCS cells such as cytoplasmic vacuolation, cellular shrinkage, and turning round, and elevated membrane permeability of these cells in AO/EB staining. The change of morphology and membrane permeability was dose- and time-dependent, while lidocaine at dose below 0.15625g/L could not induce these changes. Furthermore, lidocaine induced DNA fragmentation and ultrastructural changes such as cytoplasmic vacuolation, structural disorganization, chromatin condensation, and apoptotic body appearance of the cells.CONCLUSION: Lidocaine has significant cytotoxicity on human corneal stromal cells in vitro in a dose- and time-dependent manner by inducing apoptosis of these cells. The established experimental model and findings based on this model here help provide new insight into the apoptosis-inducing effect of local anesthetics in eye clinic.

Acetylcholinesterase function in apoptotic retina pigment epithelial cells induced by H2O2

Li Cai,Hong-Fei Liao,Xue-Jun Zhang,Yi Shao,Man Xu and Jing-Lin Yi — 2013/12/22 0:00:00
AIM:To investigate the acetylcholinesterase (AChE) expression involved in retina pigment epithelial (RPE) apoptosis induced by higher concentrations H2O2.METHODS:The human retinal pigment epithelium cell line ARPE-19 was from ATCC (Rockville, MD). Cultured ARPE-19 cells were treated with H2O2 at 0, 250, 500, 1 000, 2 000μmol/L and cell viability was measured with MTT assay. AChE expression and DNA fragments were analyzed by immunocytochemistry, TUNEL and PARP-1 Western blotting.RESULTS:Immunofluorescence detected AChE exist in the normal human retinal tissue. When H2O2 >500μmol/L, AChE expression showed an increase after 2h, and this concentration was selected for the present study. RPE cell was induced with 1 000μmol/L H2O2 for 2h, compared to the control group, cell activity decline detected by MTT, AChE and PARP-1 protein expression was significantly increased detected by Western blotting. AChE immunofluorescence staining was positive in RPE cell after H2O2 incubate 2h. In addition, pretreatment with 100μmol/L epigallocatechin gallate (EGCG), cell viability increased from 31.20%±3.90% to 70.23%±12.96%.CONCLUSION:AChE is weakly expressed in normal human RPE cells. Stimulation with H2O2 caused the stable increase of AChE expression in RPE cells, which may indicate that AChE may be an important role in AMD.

Comparison of two methods used to culture and purify rat retinal Müller cells

Wei-Tao Song,Xue-Yong Zhang,Si-Qi Xiong,Dan Wen,Jian Jiang and Xiao-Bo Xia — 2013/12/22 0:00:00
AIM: To study two methods for culturing and purifying Sprague-Dawley (SD) rat retinal Müller cells and determine which one is better.METHODS: The passage culture method of Müller cells was respectively carried out by complete pancreatic enzyme digestion method and repeated incomplete pancreatic enzyme digestion method. After culturing retinal cells for one month through these two methods, fluorescence-activated cell sorter (FACS), RT-PCR, and immunohistochemistry technology were performed to examine the enrichment and purity of Müller glial cells, and carried out two-sample approximate t test using SSPS 13.0 to further compare the Müller cell positive rate in both methods.CONCLUSION:Compared with the complete pancreatic enzyme digestion method, this novel method was more efficient and a higher purity of Müller cells could be obtained using this approach.

Short term apoptotic activity of intravitreal bevacizumab on rabbit retina

Fatih Mehmet Türkcü,Mehmet Numan Alp,Gül Türkcü,Sezer Kulaçoğlu and Gülcan Kural — 2013/12/22 0:00:00
AIM: To evaluate the safety and the short term apoptotic activity of intravitreal bevacizumab in rabbit eyes by histopathological analysis.METHODS:Twenty-eight eyes of 14 rabbits were divided into three groups:8 rabbits in group 1 and 3 rabbits in each of group 2 and group 3. Intravitreal bevacizumab (1.25mg/0.05mL) was applied to the right eyes of each subject in group 1 and group 2 (11 eyes) and the same volume of saline was applied to the left eyes of each subject in group 1 and group 3 (11 eyes). The left eyes in group 2 and the right eyes in group 3 were left untreated and used as control. Enucleated eyes were used for histopathologic analyses.RESULTS:After immunohistochemical staining with caspase-3 and p53, there was no histological evidence of toxicity to the retina and the optic nerve in any of the sections that were analyzed in all three groups. In addition, vascular endothelial cells located at the retina and the optic nerve tissues in all groups showed a similar staining pattern with caspase-3 and p53.CONCLUSION:Our study showed that intravitreal bevacizumab with the dose of 1.25mg/0.05mL caused no histological signs of toxicity or apoptotic activity on the rabbit retina.

Safety of intravitreal triamcinolone acetonide:an electrophysiologic and histopathological study in rabbits

Laila Hassan M. El-Shazly,Amal Ahmad El-Gohary and Ghada Ghanem El-Hossary — 2013/12/22 0:00:00
AIM: To evaluate the retinal safety of various doses of intravitreal triamcinolone acetonide (TA) in rabbits.Methods: Thirty New Zealand albino rabbits were divided into five groups (six animals each). In group 1 (control group), each animal received a single intravitreal injection of 0.1mL phosphate buffered saline. In groups 2, 3, 4 and 5, each rabbit received a single intravitreal injection of 4, 8, 16 and 32mg of TA, respectively. Each dose was contained in 0.1mL phosphate buffered saline. Clinical ocular examinations were performed before the injection and on the 1st, 3rd, 10th and 17th post-injection days. A standard dark adapted electroretinogram (ERG) was obtained before injection and on the 3rd, 10th and 17th post-injection days. After 17d, animals were sacrificed and their eyes prepared for pathological examination.RESULTS:By monitoring ERG as a functional index for the retina, intravitreal injection of 4mg TA showed no significant ERG changes. At doses of 8, 16 and 32, hyper-abnormal responses in a- and b- waves of ERG were detected on the 3rd post-injection day. These changes gradually returned back to normal limits after 17d. Histopathological examination of the retina of all animals showed no pathological changes.CONCLUSION: High doses of intravitreal TA seemed to have enhancing effects on the retinal function with gradual return to normal limits with no pathological changes detected in examined eyes.

Morphological and immunocytochemical analysis of human retinal glia subtypes in vitro

Shao-Fen Lin,Yu-Xiang Mao,Bin Li,Wei Sun and Shi-Bo Tang — 2013/10/21 0:00:00
AIM:To examine the morphological characteristics and antigen expression patterns of cultured human retinal glia to define novel subtypes.METHODS:Morphologic characteristics and marker expression were examined during cultivation using hematoxylin and eosin (HE) and immunostaining for glial fibrillary acidic protein (GFAP) and vimentin.RESULTS: A subtype of human retinal glia distinct from radial glia (Müller cells) was successfully isolated by digesting the retina first in diastase vera (pancreatin) and then in clostridiopeptidase, followed by culture on fibronectin substrate in human endothelial cell medium (supplemented with 10% fetal bovine serum, growth factors, and heparin sodium). Adherence was detected at 72h and cell-cell coupling at 9-10d after seeding. These cells were extensively and strongly immunopositive for GFAP and vimentin, consistent with glial expression patterns in the human retina, but were morphologically and immunohistochemically distinct from previously reported cultured retinal glia, including GFAP-positive and glutamine synthetase (GS)-positive Müller cells.CONCLUSION:A unique human retinal glial cell type can be isolated using diastase vera and clostridiopeptidase and then maintained in vitro. Further studies are required to characterize the physiological and pathological functions of these cells.

Differentiation of human amniotic epithelial cells into corneal epithelial-like cells in vitro

2013/10/21 0:00:00
AIM:To explore the feasibility that human amniotic epithelial cells (hAECs) have the potential to differentiate into corneal epithelial-like cells under the microenvironment replicated by spontaneously immortalized human corneal epithelial cells (S-ihCECs).METHODS: hAECs were isolated by enzyme digestion, and flow cytometry was used to analysis the expression of CD29/90/166/73/34 and HLA-DR. Recovered and cultured S-ihCECs, immunocytochemistry was used to detect the expression of CK3/12. The proliferation of S-ihCECs handled by different concentrations of mitomycin was detected by CCK-8. The proliferation of hAECs cultured by S-ihCECs culture media collected at different time was analyzed by CCK-8. After filtered out the optimal conditions, we collected S-ihCECs culture media for 5 days, then prepared conditioned medium to incubate hAECs, inverted phase contrast microscope and scanning electron microscope were used to observe the change of morphology in hAECs. Quantitative real-time reverse transcription-polymerase chain reaction (QRT-PCR) was carried out to evaluate the expression of Oct-4, NANOG, PAX6, and CK12 in the differentiation period. Immunocytochemistry and western bloting were used to detect the expression of CK3/12.RESULTS: The culture media collected every 12h, from 20μg/mL mitomycin pretreatment S-ihCECs could significantly promote the proliferation of hAECs. In the period of differentiation, the morphology of differentiated hAECs was obviously different compared with the control group, and the distinctive CK3/12 for corneal epithelial cells was detected.

Streptozotocin induced diabetic retinopathy in rat and the expression of vascular endothelial growth factor and its receptor

Chen-Yuan Gong,Bin Lu,Qian-Wen Hu and Li-Li Ji — 2013/10/21 0:00:00
AIM:To establish the rat model of streptozotocin (STZ)-induced diabetic retinopathy (DR), which is the most common cause of visual loss and blindness in patients with diabetes, and observe the gene expression of vascular endothelial growth factor (VEGF) and its receptors during the development of DR.METHODS:A rat model of diabetes was established by intraperitoneal injection of STZ. The diabetic rats were housed for 2, 3 and 4 months after the development of diabetes. Retinal histopathological observation was performed. The retinal vessels were observed by immunofluorescence staining by CD31. The mRNA expression of VEGF, VEGF receptor 1 and 2 (VEGFR1/2) in rat retina was detected by reverse transcription-polymerase chain reaction (RT-PCR) analysis.RESULTS:Retinal histopathological observation showed the morphological changes of inner nuclear layer (INL) and outer nuclear layer (ONL) at any time-point, and also demonstrated the increased new vessels at both 3, 4 months after the development of diabetes. The CD31 staining results showed that the number of vessels was increased in the retinas of diabetic rats at both 3 and 4 months after the development of diabetes. As compared to the normal rats, the mRNA expression of VEGF was increased in retinas of diabetic rats at 3 months after the development of diabetes, while VEGFR1 and VEGFR2 mRNA expression was increased at 2, 3 and 4 months after the development of diabetes.CONCLUSION: Taken together, our results demonstrated that DR was occurred at 3 months after the development of diabetes, and the mRNA expression of VEGF, VEGFR1 and VEGFR2 were increased in the process of DR. The present study further evidenced the involvement of VEGF and its receptors in the process of DR.

Evaluation of corneal graft survival in mice model

Guo-Ling Chen,Jing-Jing Zhang,Jun Zhao,Da-Jiang Wang and Han Zhang — 2013/10/21 0:00:00
AIM: To investigate the characteristics and criterion of graft rejection in mice model.METHODS: C57BL/6 or BALB/c mice corneal grafts were grafted onto BALB/c hosts. Each group was divided into two subgroups according to the corneal opacity scores 12d after transplantation. The characteristics of opacity and neovascularization were observed. Mice of the 12^th, 50^th day after transplantation, the grafts biopsy of mice in allogeneic group 1, which opacity score exceed 3, were prepared for histological observation and those restore transparent were endothelial stained.RESULTS: There was no difference of corneal opacity score on the 7^th and 12^th day after operation; the histological results had no disparity between syngeneic group and allogeneic group. On the 12^th day after surgery, the turbidity curve was apparent in grafts with opacity score ＜2. Mononuclear cells were shown in grafts with opacity score reached 3 in allogeneic group 1. Different rejection performance was observed in tissue sections on the 50^th day after surgery.CONCLUSION:Grafts, opacity score exceeds 3 from the 7^th to the 12^th day after operation could not be judged as a rejection. We should pay more attention to the variation of grafts opacity since 12d after corneal transplantation.

Measurement of central corneal thickness and pre-corneal tear film thickness of rabbits using the Scheimpflug system

Jing Dong,Qiang Wu and Xiao-Gang Wang — 2013/10/21 0:00:00
AIM:To measure central corneal thickness (CCT) and pre-corneal tear film thickness using the Galilei dual-Scheimpflug analyzer (GSA) in New Zealand white rabbits.METHODS:Ten normal New Zealand white rabbits (20 eyes) were included in this study. With the assistance of 0.1% fluorescein, the pre-corneal tear film can be well visualized. Both eyes of each rabbit were scanned once with the GSA pre- and post-instillation of 1μL 0.1% fluorescein. The difference between the two measurements of CCT (4-mm diameter) was recorded as the pachymetric values of the central tear film.RESULTS:The CCT of pre- and post-instillation was 388.8±9.5μm and 407.0±10.5μm, respectively. After a paired t-test analysis, the central pre-corneal tear film thickness of 4mm diameter was 18.2±5.31μm with a 95% confidence interval of (15.7, 20.6)μm (P<0.001).CONCLUSION:GSA can be used to measure CCT and analyze central tear film thickness of rabbits with the help of fluorescein.

Topically administered bevacizumab had longer standing anti-angiogenic effect than subconjunctivally injected bevacizumab in rat corneal neovacularization

Jae Yong Kim,Dong Yoon Kim,Eun-Soon Kim,Myoung Joon Kim and Hungwon Tchah — 2013/10/21 0:00:00
AIM: To compare the effect of topically administered and subconjunctivally injected bevacizumab on experimental corneal neovascularization in rats for two weeks after treatment.METHODS: Twenty-eight Sprague-Dawley rats were divided into four groups of 7 animals. Each corneal center of right eye was cauterized with silver/potassium nitrate for 8s. After corneal burning, bevacizumab (12.5mg/mL) was topically administered three times per day (TB group) for two weeks or subconjunctivally injected on days 2 and 4 after cauterization (0.02mL; SB group). As negative controls, rats received 0.9% saline topically three times per day (TS group) or subconjunctivally on days 2 and 4 (0.02mL; SS group). Digital photographs of the cornea were taken 1 and 2 weeks after treatment and analyzed to determine the area of cornea covered by neovascularization as the percentage of corneal neovascularization.RESULTS: One week after treatment, the percentage of corneal neovascularization was significantly lower in the TB and SB groups than in the TS and SS groups (all P<0.05). Two weeks after treatment, the percentage of corneal neovascularization was significantly lower in the TB group than in the TS group (P<0.05). In all groups, the percentage of neovascularization was decreasing as time passed (all P<0.05)CONCLUSION: Topically administered bevacizumab has longer standing anti-angiogenic effect than subconjunctivally injected bevacizumab in corneal neovascularization following chemical injury in rats.

Ultrasonographic visualization of lower eyelid structures and dynamic motion analysis

2013/10/21 0:00:00
AIM:To define the ultrasonographic structure of normal lower eyelid anatomic compartments and their spacial relationship in dynamic motion.METHODS:High resolution ultrasound (15MHz) was performed on the lower eyelids of 7 normal subjects. Movements of the lower eyelid and its compartments were visualized with ultrasound. In addition, the maximal excursion area of the lower eyelid fat compartments and retractor motions was measured before and after motion.RESULTS:The orbicularis muscle could be seen as an echolucent structure between the dermis and the echodence fat pads. Lower eyelid fat pad seems to be divided into 2 compartments as range of motion and direction of movement of each of them varies. It seems that these compartments have also different behavior. The measured profile area of the visible normal lower eyelid fat pads during movement of globe from up-gaze to down-gaze decreased by 50%. Order of movement of lower eyelid structures seems to be as follows:after globe movement fist we see retractor movement, anterior orbital fat pad, then skin and septum, and finally movement of inferior fat pad.CONCLUSION: Ultrasound represents a noninvasive tool for the visualization of lower eyelid morphology. Expanding its application could help us understand the compartmental changes in physiological eyelid movement, in aging and diseased study populations, as well as assess operative outcomes.

Effects of intraocular rifampicin on retinal ganglion cell structure:a stereological and histopathological study

2013/10/21 0:00:00
AIM: To determine the histopathological changes of rifampicin applied intravitreally on retinal ganglion cells by means of stereological and histopathological methods.METHODS: For this study twenty-four New Zealand adult rabbits were divided into four groups (n=6 for each group). 50μg/0.1mL (group 1), 100μg/0.1mL (group 2), 150μg/0.1mL (group 3) and 200μg/0.1mL (group 4), rifampicin were injected into the vitreous of the right eyes of animals, their left eyes were used as control (group 5). After the 28^th day of application, animals were anesthetised with xylazine (8mg/kg, IM) and then their eyes were enucleated immediately. Patterns were taken away and eyes were prepared for both stereological and electromicroscopic observation.RESULTS: Depending on the high dose of rifampicin, some histopathological changes such as cytoplasmic dilatation and damaged membrane were observed on the electromicroscopic level. Using quantitative examination, which was done at the light microscopic level, it was shown that the number of neurons decreased linearly as rifampicin dose increased when compared with the control group.CONCLUSION: Based on these findings, low-dose rifampicin (50μg/0.1mL) may be useful for treatment of the ocular diseases.

The correlation between rat retinal nerve fiber layer thickness around optic disc by using optical coherence tomography and histological measurements

2013/8/22 0:00:00
AIM:To explore the correlation between the retinal nerve fiber layer (RNFL) thickness by using optical coherence tomography (OCT) and by histological measurements in normal adult rats and optic nerve transected rats.METHODS:The RNFL thickness of 36 rats was scanned in a circle 3.46mm far from the optic disc by OCT. The two experimental groups were the normal group (n=20 rats) and the optic nerve transected group (n=16 rats). The latter group included 4 groups (n=4/group) surviving for 1 day, 3, 5 and 7 days. Then the RNFL thickness of the same retina area was also measured by NF-200 immunohistochemical staining method. Linear regression was used to analyze the correlation between the data obtained from these two methods.RESULTS: The RNFL thickness of normal right eyes around optic disc by OCT was 72.35±5.71μm and that of the left eyes was 72.65±5.88μm (P=0.074). The RNFL thickness of the corresponding histological section by immunohistochemistry was 37.54±4.05μm (right eyes) and 37.38±4.23μm (left eyes) (P=0.059). There was a good correlation between the RNFL thickness measured by OCT and that measured by histology (R²=0.8131). After optic nerve transection, the trend of the RNFL thickness was thinner with the prolonged survival time. The correlation of the thickness detected by the above two methods was approximately (R²=0.8265). Value of the RNFL thickness in rats around optic disc measured by OCT was obviously higher than that measured by common histological measurement in normal adult rats and optic nerve transected rats.CONCLUSION: The RNFL thickness measured by OCT has a strong correlation with that measured by histological method. Through OCT scanning, we found that the thickness of RNFL gradually becomes thinner in a time-dependent manner.

Protective effects of curcumin on retinal Müller cell in early diabetic rats

Zhong-Fu Zuo,Qiang Zhang and Xue-Zheng Liu — 2013/8/22 0:00:00
AIM: To explore the effects and potential mechanisms of curcumin on retinal Müller cell in early diabetic rats.METHODS: Diabetic rats were induced by a single intraperitoneal injection of streptozotocin (STZ). Male Sprague-Dawley (SD) rats were randomly assigned into 4 groups:control group (na?ve SD rats administered with a single intraperitoneal injection of citric buffer), diabetic group (STZ-diabetic rats), dimethyl sulfoxide (DMSO) group (diabetic rats intraperitoneally administered with mixture of DMSO and normal saline, once a day) and curcumin group (diabetic rats intraperitoneally administered with curcumin, 80mg/kg, once a day). Three months after diabetes onset, malondialdehyde (MDA, indication of oxidative stress level) and reduced glutathione (GSH) in retina were detected with kits, glial fibrillary acidic protein (GFAP) in retina was revealed by immunohistochemistry and Western blot, and retinal glutamine synthetase (GS) were observed by Western blot.RESULTS: Compared with control group, retinal MDA was increased, and GSH was decreased in diabetic and DMSO groups (P<0.05, respectively). While, retinal MDA and GSH in curcumin group showed no difference compared with control group (P>0.05). Furthermore, up-regulation of retinal GFAP and down-regulation of retinal GS were detected in diabetic and DMSO groups, and no alteration could be observed in curcumin group revealed with Western blot. Compared with control group, retinal Müller cells showed significant increase in GFAP immunochemistry staining in diabetic and DMSO groups. Moreover, GFAP-positive staining was decreased in curcumin group compared with diabetic group.CONCLUSION: Curcumin inhibits diabetic retinal oxidative stress, protects Müller cell, and prevents the down-regulation of GS in diabetic retina. Therefore, curcumin has a therapeutic potential in the treatment of diabetic retinopathy (DR).

In vitro tissue engineering of lamellar cornea using human amniotic epithelial cells and rabbit cornea stroma

2013/8/22 0:00:00
AIM:To reconstruct the lamellar cornea using human amniotic epithelial (HAE) cells and rabbit cornea stroma in vitro using tissue engineering technology.METHODS: Human amnia taken from uncomplicated caesarean sections were digested by collagenase to obtain HAE cells, and the cells were cultured to proliferate. Rabbit corneal epithelial cells were removed by n-heptanol to make lamellar matrix sheets. The second passage of HAE cells were cultured on the corneal stroma sheets for 1 or 2 days, then transferred to an air-liquid interface environment to culture for 2 weeks. Tissue engineered lamellar cornea (TELC) morphology was observed by Hematoxylin-eosin (HE) staining; its ultrastructure was observed by transmission electron microscopy (TEM) and scanning electron microscopy (SEM); corneal epithelial cell-specific keratin 3 and keratin 12 were detected with immunofluorescence microscopy.RESULTS:HAE cells grew on the rabbit corneal stroma, forming a monolayer after 1-2 days. About 4-5 layers of epithelial cells developed after 2 weeks of air-liquid interface cultivation, a result similar to normal corneal epithelium. Rabbit corneal stromal cells were significantly reduced after one week, then almost completely disappeared after 2 weeks. TEM showed desmosomes between the epithelial cells; hemidesmosomes formed between the epithelial cells and the basement membrane. SEM revealed that the HAE cells which grew on the lamellar cornea had abundant microvilli. The tissue-engineered cornea expressed keratin 3 and keratin 12, as detected by immunofluorescence assay.CONCLUSION: Functional tissue-engineered lamellar corneal grafts can be constructed in vitro using HAE cells and rabbit corneal stroma.

Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento

2013/8/22 0:00:00
AIM: To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations.METHODS:Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations.RESULTS: Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls.CONCLUSION: The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

Effects of aminoguanidine on retinal apoptosis in mice with oxygen-induced retinopathy

An-Jie Du,Bing Ren,Xiao-Wei Gao,Lei Yang,Yan Fu and Xu-Dong Zhao — 2013/8/22 0:00:00
AIM: To explore the protective effects of aminoguanidine (AG) on retinal apoptosis in mice with oxygen-induced retinopathy (OIR).METHODS:A total of 80 C57BL/6J mice, aged 7 days, were randomly divided into four groups:normal, high oxygen, high oxygen saline and high oxygen treated with AG. In the normal group, mice were housed in normoxic conditions from postnatal day P7 to P17. Mice in the other 3 groups were placed under hyperoxic conditions (75±2%O2) in an oxygen-regulated chamber for 5 days and subsequently placed in normoxic conditions for 5 days. Mice in the AG group were treated once daily, from P12 to P17, with AG hemisulfate (100mg/kg body weight, intraperitoneally) dissolved in physiological saline. An equivalent amount of 0.9% physiological saline was administered, as above, to mice in the high oxygen saline group. Ten mice were randomly selected from each group on P14 and on P17, euthanized and the retinas examined. Apoptotic cells in the retina were detected using the terminal-deoxynucleoitidyl transferase mediated nick end labeling (TUNEL) method. The expression of nitric oxide synthase (iNOS) in the retina was detected by immunohistochemistry and changes in rod cells were observed using electron microscopy.RESULTS:TUNEL-positive cells and iNOS immunoreactive neurons were present in the inner nuclear and ganglion cell retinal layers of mice in the high oxygen group. The number of TUNEL-positive cells was significantly greater in the high oxygen group compared with the normal group (t=-20.81, P14d <0.05; t=-15.05, P17d<0.05). However, the number of TUNEL-positive cells in the AG treatment group was significantly lower (t=-13.21, P14d<0.05; t=-6.61,P17d <0.05) compared with the high oxygen group. The expression of iNOS was significantly higher in the high oxygen group compared with the normal group (t=-21.95, P14d<0.05; t=-17.30, P17d<0.05). However, the expression of iNOS in the AG treatment group was significantly lower (t=-12.17,P14d<0.05; t=-10.30,P17d<0.05) compared with the high oxygen group. The outer segments of the rods were disorganized and short in the high oxygen group. Rod morphology appeared to be slightly improved in the AG group.CONCLUSION:AG may protect retinal neurons in OIR by inhibiting apoptosis. The mechanism may be related to iNOS.

Increased expression of nestin in human pterygial epithelium

Dan Wen,Hua Wang,Boon Chin Heng and Hua Liu — 2013/6/24 0:00:00
AIM:To investigate the distribution of nestin-positive cells in pterygium, as well as the relationship between nestin-positive cells and proliferative cells in the pathogenesis of pterygium.METHODS:Nine pterygium specimens and 5 normal conjunctiva specimens were investigated. All explanted specimens were immediately immersed in 5-Ethynyl-2’-deoxyuridine, and were subjected to hematoxylin and eosin staining, as well as immunostaining to detect nestin.RESULTS:Small sub-populations of nestin-expressing cells in both normal and pterygial conjunctiva epithelium were found. These were located at the superficial layer of the epithelium, and were significantly increased (P=0.007) and spread out in the pterygial conjunctiva epithelium, even though these cells were mitotically quiescent.CONCLUSION:In pterygium, more nestin-positive cells were present at the superficial layer of the epithelium. With growing scientific evidence that nestin plays an important role in defining various specialized cell types, such as stem cells, cancer cells and angiogenic cells, further investigations on the roles of nestin-expressing cells in pterygium may help to uncover the mechanisms of initiation, development and the prognosis of this disease.

Single nucleotide polymorphism of MYOC affected the severity of primary open angle glaucoma

2013/6/24 0:00:00
AIM:To detect the mutations in two candidate genes, myocilin (MYOC) and cytochrome P450 1B1 (CYP1B1), in a Chinese family with primary open angle glaucoma (POAG).METHODS: The family was composed of three members, the parents and a daughter. All members of the family underwent complete ophthalmologic examinations. Exons of MYOC and CYP1B1 genes were screened for sequence alterations by polymerase chain reaction (PCR) and direct DNA sequencing.RESULTS:The mother was the proband, she was diagnosed as POAG in both eyes. Her daughter was diagnosed as juvenile-onset POAG. The father was asymptomatic. One MYOC heterozygous mutation c.1150 G>A (D384N) in exon 3 was identified in the mother, another MYOC heterozygous variation c.1058 C>T (T353I) in exon 3 was identified in the father, and the daughter inherited both of the variations. Meanwhile, three single nucleotide polymorphisms (SNPs) in CYP1B1 gene were found in the family.CONCLUSION:The D384N mutation of MYOC has been reported as one of disease-causing mutations in POAG, whereas T353I variation of MYOC was thought as a high risk factor for POAG. The two variations of MYOC were first reported in one juvenile-onset POAG patient who presented with more severe clinical manifestations, suggesting that T353I polymorphism of MYOC may be associated with the severity of POAG.

Mechanism of immune tolerance induced by donor derived immature dendritic cells in rat high-risk corneal transplantation

Xiao-Wei Gao,Yan Fu,Wen-Jing Li,An-Jie Du,Xia Li and Xu-Dong Zhao — 2013/6/24 0:00:00
AIM: To study the role of immature dendritic cells (imDCs) on immune tolerance in rat penetrating keratoplasty (PKP) in high-risk eyes and to investigate the mechanism of immune hyporesponsiveness induced by donor-derived imDCs.METHODS:Seventy-five SD rats (recipient) and 39 Wistar rats (donor) were randomly divided into 3 groups:control, imDC and mature dendritic cell (mDC) group respectively. Using a model of orthotopic corneal transplantation in which allografts were placed in neovascularized high-risk eyes of recipient rat. Corneal neovascularization was induced by alkaline burn in the central cornea of recipient rat. Recipients in imDC group or mDC group were injected donor bone marrow-derived imDCs or mDCs of 1×10⁶ respectively 1 week before corneal transplantation via tail vein. Control rat received the same volume of PBS. In each group, 16 recipients were kept for determination of survival time and other 9 recipients were executed on day 3, 7 and 14 after transplantation. Cornea was harvested for hematoxylin-eosin staining and acute rejection evaluation, Western blot was used to detect the expression level of Foxp3.RESULTS: The mean survival time of imDC group was significantly longer than that of control and mDC groups (all P<0.05). The expression level of Foxp3 on CD4⁺CD25⁺T cells of imDC group (2.24±0.18) was significantly higher than that in the control (1.68±0.09) and mDC groups (1.46±0.13) (all P<0.05).CONCLUSION: Donor-derived imDC is an effective treatment in inducing immune hyporesponsiveness in rat PKP. The mechanism of immune tolerance induced by imDC might be inhibit T lymphocytes responsiveness by regulatory T cells.

Msx2 plays a critical role in lens epithelium cell cycle control

Jiang-Yue Zhao,Feng-Feng Zhuang,Hong-Yan Wang,Di Wu and Jin-Song Zhang — 2013/6/24 0:00:00
AIM: To investigate the effects of Msx2 on lens epithelium cell cycle, and evaluate the changes of the proliferation, apoptosis of lens epithelium cells.METHODS: Mice lens epithelium cells were cultured and transfected with pEGFP-Msx2 and control. Msx2-de?cient mice (Msx2^-/-) lens tissue were isolated. Lens tissue and transfected cells were prepared for mRNA extraction using Trizol reagent. CyclinD1 and Prox1 expression were evaluated by real-time RT-PCR. BrdU incorporation and apoptosis rate were investigated by immunofluorescence and flow cytometry analysis.RESULTS: After transfected with pEGFP-Msx2, lens epithelium cells failed to incorporate BrdU and anti-phospho-histone-3 immunofluorescence failed to detect cell nuclei which GFP were positive. Msx2 over expression resulted in increasing apoptosis rate in lens epithelium cells. CyclinD1 and Prox1 expression increased significantly in Msx2 knockout mice by real-time RT-PCR quantization and CyclinD1 expression decreased significantly in Msx2 overexpressed cell.CONCLUSION:Msx2 has the effect of inhibiting proliferation and differentiation, triggering apoptosis on mice lens epithelium cells.

Molecular hydrogen regulates the expression of miR-9, miR-21 and miR-199 in LPS-activated retinal microglia cells

Guo-Dan Liu,Hong Zhang,Lin Wang,Qing Han,Shi-Feng Zhou and Ping Liu — 2013/6/24 0:00:00
AIM:To explore the potential mechanism of molecular hydrogen in the regulation of miRNA expression and signal-modulating activities.METHODS:Retinal microglia cells were activated by Lipopolysaccharides (LPS) and then treated with hydrogen-saturated medium or normal medium without hydrogen. qRT-PCR was used to detect the expression difference in miR-9, miR-21 and miR-199 between these two groups. Moreover, the expression of LPS-induced signaling proteins, including Myd88, IKK-β, NF-κB, and PDCD4, were detected by Western blotting.RESULTS:The results demonstrated a marked down-regulation of miR-9 and miR-21 and up-regulation of miR-199 by hydrogen treatment; the expression of Myd88 and IKK-β was decreased after hydrogen treatment, whereas PDCD4 was increased, and there was no significant change in NF-κB expression.CONCLUSION:The results in the present study indicate that miR-9, miR-199 and miR-21 play an important role in the anti-inflammatory regulation of LPS-activated microglia cells by molecular hydrogen, which will help to explain the protective mechanism of molecular hydrogen against inflammatory injury.

Proteomic analysis of energy metabolism and signal transduction in irradiated melanoma cells

Lu-Bin Yan,Kai Shi,Zhi-Tong Bing,Yi-Lan Sun and Yang Shen — 2013/6/24 0:00:00
AIM:To analyze proteomic and signal transduction alterations in irradiated melanoma cells.METHODS:We combined stable isotope labeling with amino acids in cell culture (SILAC) with highly sensitive shotgun tandem mass spectrometry (MS) to create an efficient approach for protein quantification. Protein-protein interaction was used to analyze relationships among proteins.RESULTS: Energy metabolism protein levels were significantly different in glycolysis and not significantly different in oxidative phosphorylation after irradiation. Conversely, tumor suppressor proteins related to cell growth and development were downregulated, and those related to cell death and cell cycle were upregulated in irradiated cells.CONCLUSION:Our results indicate that irradiation induces differential expression of the 29 identified proteins closely related to cell survival, cell cycle arrest, and growth inhibition. The data may provide new insights into the pathogenesis of uveal melanoma and guide appropriate radiotherapy.

Myopia induced by flickering light in guinea pigs:a detailed assessment on susceptibility of different frequencies

Yue Di,Rui Liu,Ren-Yuan Chu,Xing-Tao Zhou and Xiao-Dong Zhou — 2013/4/22 0:00:00
AIM:To investigate the effectiveness and feasibility of inducing myopia in guinea pigs by flickering light (FL) stimulation with different frequencies. METHODS: Seventy 2-week-old guinea pigs were randomly assigned to six groups:five FL groups and a control group (n=12 for each). Animals in the five FL groups were raised under 500lx illumination with a duty diurnal cycle of 50% at a flash rate of 5, 1, 0.5, 0.25 and 0.1Hz respectively. Those in the control group were reared under steady 250lx illumination. Refraction, axial length, and radius of curvature were measured before and at 2, 4, 6, 8, 10 and 12 weeks after treatment. At week 12, the eyeballs were taken out and three ocular dimensions and dry weight of sclera were measured. RESULTS: A myopic shift and axial eye length increase developed in the five FL groups. Stimulation at 0.5Hz caused greater changes in myopic shift, axial elongation, eyeball dimension, and dry weight of sclera than stimulation at other frequencies. Compared with controls, eyes in 0.5Hz group were approximately -5.5±1.5D more myopic with increase in horizontal, vertical, axial dimensions by 0.89±0.3mm, 0.69±0.2mm, 1.12±0.2mm respectively and with increase in dry weight of sclera by 0.44mg. CONCLUSION: Chronic exposure to periodic illumination at temporal frequency is attended by development of excessive ocular enlargement and myopic refractive error. Emmetropization could be disrupted differently by frequency alteration.

Perineuronal nets increase inhibitory GABAergic currents during the critical period in rats

2013/4/22 0:00:00
AIM: To investigate inhibitory γ-aminobutyric acid (GABA) ergic postsynaptic currents (IPSCs) and postsynaptic currents (PSCs) in layer IV of the rat visual cortex during the critical period and when plasticity was extended through dissolution of the perineuronal nets (PNNs).METHODS:We employed 24 normal Long-Evans rats to study GABAA-PSC characteristics of neurons within layer IV of the visual cortex during development. The animals were divided into six groups of four rats according to ages at recording:PW3 (P21-23d), PW4 (P28-30d), PW5 (P35-37d), PW6 (P42-44d), PW7 (P49-51d), and PW8 (56-58d). An additional 24 chondroitin sulfate proteoglycan (CSPG) degradation rats (also Long-Evans) were generated by making a pattern of injections of chondroitinase ABC (chABC) into the visual cortex 1 week prior to recording at PW3, PW4, PW5, PW6, PW7, and PW8. Immunohistochemistry was used to identify the effect of chABC injection on CSPGs. PSCswere detected with whole-cell patch recordings, and GABAA receptor-mediated IPSCs were pharmacologically isolated.RESULTS:IPSC peak current showed a strong rise in the age-matched control group, peaked at PW5 and were maintained at a roughly constant value thereafter. Although there was a small increase in peak current for the chABC group with age, the peak currents continued to decrease with the delayed highest value at PW6, resulting in significantly different week-by-week comparison with normal development. IPSC decay time continued to increase until PW7 in the control group, while those in the chABC group were maintained at a stable level after an initial increase at PW4. Compared with normal rats, the decay times recorded in the chABC rats were always shorter, which differed significantly at each age. We did not observe any differences in IPSC properties between the age-matched control and penicillinase (P-ase) group.However, the change in IPSCs after chABC treatment was not reflected in the total PSCs or in basic membrane properties in layer IV of the rat visual cortex.CONCLUSION:Our results demonstrate that rather than rapidly increasing during the critical period for neuronal plasticity, IPSCs in layer IV of rat visual cortex are maintained at an immature level when PNNs are removed by chABC. This suggests that GABA receptor maturation involves the conformation of the CSPGs in PNNs.

Microscopic characteristics of the inferior tarsal muscle and its surroundings in Korean

2013/4/22 0:00:00
AIM: To investigate the detailed microscopic anatomic structures of the lower eyelid in Korean cadavers.METHODS: Eight lower eyelids of 4 formalin-fixed Asian cadavers (4 males; age range, 48-69 years; mean age, 60.2 years) were examined. Three perpendicular dissected sections with a 2mm thickness were obtained from each eyelid to investigate anatomic shapes, size and relationship with surrounding structures. One section was obtained from the midline and 2 the other sections were obtained from a 3mm apart from the lateral and medial tarsus margins.RESULTS:The inferior tarsal muscle fibers were not directly attached to the tarsus but were only linked to the tarsus with enclosed fibrous fascia. The inferior tarsal muscles connected loosely with the capsulopalpebral fascia anteriorly and the conjunctiva posteriorly. The inferior tarsal muscle runs horizontally to the tarsus according to the shape of muscle fibers. The capsulopalpebral fascia consisted of an anterior and posterior layer. The anterior layer reached the orbital septum and subcutaneous fat but the posterior layer forwarded into the tarsus. Lockwood''s ligament was separated from the inferior tarsal muscle and capsulopalpebral fascia or fused into the capsulopalpebral fascia.CONCLUSION: This study suggests that the inferior tarsal muscle which runs horizontally and doesn’t insert directly into the tarsus, plays an important role in the movement and localization of the lower eyelid.

Heparanase-1 activities in the development of laser induced choroidal neovascularization

Wei-Qiang Tang and Bao-Ke Hou — 2013/4/22 0:00:00
AIM:To investigate the role of heparanase-1 in laser-induced choroidal neovascularization (CNV).METHODS:Experimental CNV was induced by krypton laser photocoagulation in 15 male Brown Norway rats. Fundus fluorescein angiography and histopathological examination were performed in observing the CNV development. The expression and distribution of heparanase-1 protein in the laser lesions were determined by immunohistochemistry and western blotting analysis.RESULTS:The success rate of laser induced CNV was approximately 75% on 3-4 weeks after laser photocoagulation. The protein levels of heparanase-1 increased significantly in the retina-choroidal complex of CNV models when compared to normal rat eyes (P<0.01). Immunostaining confirmed strong heparanase-1 expressions in all laser lesions, and it displayed to be highest at the newly formed blood vessels within the fibrovascular complex in the subretinal space.CONCLUSION:Heparanase-1 is closely involved in the development of laser induced CNV.

Comparison of subconjunctivally injected bevacizumab, ranibizumab, and pegaptanib for inhibition of corneal neovascularization in a rat model

2013/4/22 0:00:00
AIM:To compare the efficacies of subconjunctival bevacizumab, ranibizumab, and pegaptanib sodium injections for the inhibition of corneal neovascularization in an experimental rat model.METHODS:Sixteen corneas of 16 rats were chemically cauterized and randomized into four groups:bevacizumab group that treated with 0.05mL/1.25mg bevacizumab, ranibizumab group that treated with 0.05mL/0.5mg ranibizumab, pegaptanib group that treated with 0.05mL/0.15mg pegaptanib sodium, and control group that treated with 0.05mL saline solution. Digital photographs of the corneas were taken and analyzed using an image analysis software program. All corneas were excised and examined histologically on the 15^th day.RESULTS: Each treatment group had significantly less neovascularized corneal areas and fewer blood vessels than the control group (all P<0.05). In addition, bevacizumab group had significantly less neovascularized corneal areas and fewer blood vessels than ranibizumab and pegaptanib groups (both P<0.05). However, there was no significant difference between the ranibizumab and pegaptanib groups regarding percentage of neovascularized corneal areas and number of blood vessels (both P>0.05). CONCLUSION:Subconjunctival bevacizumab, ranibizumab, and pegaptanib sodium were effective with no corneal epitheliopathy for inhibiting corneal neovascularization after corneal burn in rats. Bevacizumab was more effective than ranibizumab and pegaptanib sodium.

Application of sustained delivery microsphere of cyclosporine A for preventing posterior capsular opacification in rabbits

Cheng Pei,Yi Xu,Jean Xin. Jiang,Li-Jun Cui,Li Li and Li Qin
AIM: To explore the inhibitory effect of a sustained cyclosporin A (CsA) delivery microsphere (CsA-MS) on posterior capsular opacification (PCO) in rabbit eyes after cataract extraction.METHODS: Twenty New Zealand white rabbits accepted cataract extraction plus intraocular lens implantation and their left eyes were intraoperatively injected CsA-MS prepared using polymer polylactioglycolic acid (PLGA) as a carrier and their right eyes were injected with empty MS. The changes in cornea, anterior chamber reaction, intraocular pressure, PCO and CsA concentration in aqueous humor were examined postoperatively and all the eyes were enucleated 3 months after surgery for histopathological and morphological examination with light microscopy and electron microscopy.RESULTS:Conjunctival hyperemia, corneal edema, intraocular pressure and anterior chamber response of experimental and control eyes were similar, while PCO in CsA-MS injected eyes was greatly improved compared with that in control eyes. Posterior capsules in CsA-MS injected eyes were smooth and lens epithelial cells (LEC) did not proliferate significantly (P>0.05), while LEC in posterior capsule of control eyes had different degrees of proliferation and cortical regeneration. LEC in CsA-MS injected eyes were not functionally active and underwent apoptosis, whereas LEC in control eyes were functionally active (F-test, P=0.025). In addition, the corneal ultrastructure showed no differences between CsA-MS and MS injected eyes.CONCLUSION: CsA-MS has high bioavailability in rabbit eyes and could inhibit postoperative PCO occurrence and development during the study period, suggesting that CsA-MS may be a promising, effective and safe administration route to prevent PCO in clinic.

Inhibition of RhoA/Rho-kinase pathway suppresses the expression of extracellular matrix induced by CTGF or TGF- β in ARPE-19

Jing Zhu,Duy Nguyen,Hong Ouyang,Xiao-Hui Zhang,Xiao-Ming Chen and Kang Zhang
AIM: To investigate the role of Rho-associated protein kinase (ROCK) inhibitor, Y27632, in mediating the production of extracellular matrix (ECM) components including fibronectin, matrix metallo-proteinase-2 (MMP-2) and type I collagen as induced by connective tissue growth factor (CTGF) or transforming growth factor-β (TGF-β) in a human retinal pigment epithelial cell line, ARPE-19.METHODS: The effect of Y27632 on the CTGF or TGF-β induced phenotype in ARPE-19 cells was measured with immunocytochemistry as the change in F-actin. ARPE-19 cells were treated with CTGF (1, 10, 100ng/mL) and TGF-β (10ng/mL) in serum free media, and analyzed for fibronectin, laminin, and MMP-2 and type I collagen by RT-qPCR and immunocytochemistry. Cells were also pretreated with an ROCK inhibitor, Y27632, to analyze the signaling contributing to ECM production.RESULTS: Treatment of ARPE-19 cells in culture with TGF-β or CTGF induced an ECM change from a cobblestone morphology to a more elongated swirl pattern indicating a mesenchymal phenotype. RT-qPCR analysis and different gene expression analysis demonstrated an upregulation in expression of genes associated with cytoskeletal structure and motility. CTGF or TGF-β significantly increased expression of fibronectin mRNA (P=0.006, P=0.003 respectively), laminin mRNA (P=0.006, P=0.005), MMP-2 mRNA (P= 0.006, P= 0.001), COL1A1 mRNA (P=0.001, P=0.001), COL1A2 mRNA (P=0.001, P=0.001). Preincubation of ARPE-19 with Y27632 (10mmol/L) significantly prevented CTGF or TGF- β induced fibronectin (P=0.005, P=0.003 respectively), MMP-2 (P= 0.003, P=0.002), COL1A1 (P=0.006, P=0.003), and COL1A2 (P=0.006, P=0.004) gene expression, but not laminin (P=0.375, P=0.516)#$NLCONCLUSION: Our study demonstrated that both TGF-β and CTGF upregulate the expression of ECM components including fibronectin, laminin, MMP-2 and type I collagen by activating the RhoA/ROCK signaling pathway. During this process, ARPE-19 cells were shown to change from an epithelial to a mesenchymal phenotype in vitro. Y27632, a ROCK inhibitor, inhibited the transcription of fibronectin, MMP-2 and type I collagen, but not laminin. The data from our work suggest a role for CTGF as a profibrotic mediator. Inhibiting the RhoA/ROCK pathway represents a potential target to prevent the fibrosis of RPE cells. This might lead to a novel therapeutic approach to preventing the onset of early PVR.

Effect of Y-27632 on the cultured retinal neurocytes of rats

Pei-Li Feng,Jing Wang,Zi-Jian Yang,Xiao-Hong Liu and Yi-Sheng Zhong
AIM: To investigate the effect of Y-27632 on the survival and neurite outgrowth of the cultured retinal neurocytes.METHODS: After the postnatal day 2-3, Sprague-Dawley retinal neurocytes were cultured for 48 hours, the culture media was replaced with serum-free media (control group) and serum-free media contained 30mmol/L Y-27632 (Y-27632 group), and the cells were continually cultured another 48 hours. The cultured retinal neurocytes were identified with anti-neuron specific enolase (NSE) immunocytochemistry. The survival state of those cells was estimated by MTT assay, and the neurite outgrowth of those cells was evaluated by the computerized image-analysis system.RESULTS:Compared with the control group, the absorbance values of cells survival in Y-27632 group increased 12.90% and 33.33% respectively after 72 and 96 hours culture. Y-27632 had no significant effect on the diameter of cultured retinal neurocytes. Compared with the control group, Y-27632 induced a stable improvement of neurite outgrowth of retinal neurocytes after 72 and 96 hours culture (P=0.001).CONCLUSION: Y-27632 could promote the survival and neurite outgrowth of the early postnatal cultured retinal neurocytes.

Mechanism of the DL-alpha-aminoadipic acid inhibitory effect on form-deprived myopia in guinea pig

Jun-Feng Mao and Shuang-Zhen Liu
AIM:To investigate the effect of intravitreal injection of DL-alpha-aminoadipic acid (DL-α-AAA) on ocular refractive state and retinal dopamine, transforming growth factor-β2 (TGFβ2), vasoactive intestinal polypeptide (VIP) in guinea pig form-deprived myopia.METHODS:Four-week-old pigmented guinea pigs were randomly assigned to 4 groups:normal control, deprivation, deprivation plus DL-α-AAA, deprivation plus saline. Form deprivation was induced with the self-made translucent eye shields, and lasted for 14 days. 8μg DL-α-AAA was injected into the vitreous chamber of deprived eyes. The corneal radius of curvature, refraction and axial length were measured. Retinal dopamine content was evaluated by the high-performance liquid chromatography with electrochemical detection, and TGFβ2 and VIP protein were detected by Western blotting.RESULTS:Fourteen days of eye occlusion caused the axial length to elongate and become myopic in the form-deprived eyes, with the decrease of retinal dopamine and the increase of TGFβ2 and vasoactive intestinal polypeptide (VIP) protein. Intravitreal injection of DL-α-AAA could inhibit the myopic shift from (-3.65±1.06)D to (-1.48±0.63)D, P<0.01 due to goggles occluding and cause the decrease of retinal TGFβ2 protein in the deprived eyes. However, intravitreal injection of DL-α-AAA had no significant effect on retinal dopamine and VIP protein in deprived eyes. Retinal TGFβ2 protein correlated highly with the ocular refraction (y=-3.34+0.31/x, F=74.75, P<0.001) and axial length (y=8.39-0.02/x, F=48.32, P<0.001) in different treatment groups.CONCLUSION:Intravitreal injection of DL-α-AAA is effectively able to suppress the development of form deprivation myopia, which may be associated with retinal TGFβ2 protein in guinea pigs.

Regulation of interleukin 33/ST2 signaling of human corneal epithelium in allergic diseases
AIM: To identify the function of ST2 and explore the role of IL-33/ST2 signaling in regulating the pro-allergic cytokine production in human corneal epithelial cells (HCECs).METHODS: Human corneal tissues and cultured primary HCECs were treated with IL-33 in different concentrations without or with different inhibitors to evaluate the expression, location and signaling pathways of ST2 in regulating production of pro-allergic cytokine and chemokine. The expression of mRNA was determined by reverse transcription and real time PCR, and protein production was measured by enzyme-linked immunosorbent assay (ELISA), immunohistochemical and immunofluorescent staining. ST2 protein was detected in donor corneal epithelium, and ST2 signal was enhanced by exposure to IL-33.RESULTS: IL-33 significantly stimulated production of pro-allergic cytokines thymic stromal lymphopoietin (TSLP) and chemokine (CCL2, CCL20, CCL22) in HCECs at both mRNA and protein levels. These stimulated productions of pro-allergic mediators by IL-33 were blocked by ST2 antibody or soluble ST2 protein (P<0.05). Interestingly, the IκB-α inhibitor BAY11-7082 or NF-κB activation inhibitor quinazoline blocked NF-κB p65 protein nuclear translocation, and also suppressed the productions of these pro-allergic cytokines and chemokine induced by IL-33.CONCLUSION:These findings demonstrate that IL-33/ST2 signaling plays an important role in regulating IL-33 induced pro-allergic responses. IL-33 and ST2 could become novel molecular targets for the intervention of allergic diseases in ocular surface.

Dectin-1 expression at early period of Aspergillus fumigatus infection in rat’s corneal epithelium
AIM:To investigate the expression of dendritic cell-associated C-type lectin-1(dectin-1) at the early period of Aspergillus fumigatus infection in rat’s corneal epithelium.METHODS:A total of 72 Wistar rats were randomly divided into three groups:A, B and C. The right eyes were chosen as experimental eyes. Group A was control group. Rats in group B were not inoculated with Aspergillus fumigatus. Group C was taken as Aspergillus fumigatus keratitis model. Rats in group B and C (six from each group) were executed randomly at 4, 8, 16 and 24 hours after experimental model being established to assess the expression of dectin-1 mRNA through real-time PCR. Another six rats in group B and C were executed randomly at 24 hours to assess the expression of dectin-1 protein through immunohistochemistry.RESULTS:The results of real-time PCR indicated that dectin-1 mRNA expression was low in corneal epithelium of normal rats’. There was no significantly difference of dectin-1 mRNA expression in group A and B (P>0.05). The expression of Aspergillus fumigatus infected corneal epithelium increased gradually after 8 hours in group C. The synchronous expression of group A and C had significant difference (P<0.01). Immunohistochemisty discovered that dectin-1 receptor existed in normal rat’s corneal epithelium . Dectin-1 protein increased after 24 hours in group C. There was a significant difference of synchronous expression in group B and C(P<0.01).CONCLUSION:Dectin-1 exists in rat’s corneal epithelium and its expression significantly increases at the early period of Aspergillus fumigatus infection. Dectin-1 is a pattern recognition receptor that expresses in corneal epithelium and involves in immune response to Aspergillus fungal keratitis.

A novel p.R890C mutation in EPHA2 gene associated with progressive childhood posterior cataract in a Chinese family

Xing-Chao Shentu,Su-Juan Zhao,Li Zhang and Qi Miao
AIM:To identify the genetic defect in a Chinese family with bilateral progressive childhood posterior cataract.METHODS: A two-generation family was recruited in this study. Family history and clinical data were recorded. All reported candidate genes associated with congenital posterior cataract were screened by direct DNA sequencing.RESULTS: All affected individuals presented posterior opacities in the lens. Direct sequencing of the candidate genes showed a heterozygous c. 2668C>T variation in EPHA2 gene, which resulted in the replacement of arginine by cysteine at codon 890 (p. R890C). This mutation was found in two affected individuals, but was not observed in 200 normal controls.CONCLUSION: We report a novel mutation (p. R890C) in the EPHA2 receptor tyrosine kinase gene. The finding expands the mutation spectrum of EPHA2 in association with posterior cataract.

Molecular mechanism of the inhibition effect of Lipoxin A4 on corneal dissolving pathology process

Hong-Yan Zhou,Ji-Long Hao,Miao-Miao Bi,Shuang Wang,Hong Zhang and Wen-Song Zhang
AIM: Excessive dissolve of corneal tissue induced by MMPs which were activated by cytokins and chemokines will lead to corneal ulcer. The molecular mechanism of Lipoxin A4 (LXA4) on corneal collagen degradation in three dimensions was investigated.METHODS:Rabbit corneal fibroblasts were harvested and suspended in serum-free MEM. Type I collagen, DMEM, collagen reconstitution buffer and corneal fibroblast suspension were mixed on ice. The resultant mixture solidified in an incubator, after which test reagents and plasminogen was overlaid and the cultures were returned to the incubator. The supernatants from collagen gel incubations were collected and the amount of hydroxyproline in the hydrolysate was measured. Immunoblot analysis of MMP-1, -3 and TMMP-1,-2 was performed. MMP-2,-9 was detected by the method of Gelatin zymography. Cytotoxicity assay was measured.RESULTS:LXA4 inhibited corneal collagen degradation in a dose and time manner. LXA4 inhibited the IL-1β induced increases in the pro-MMP-1, -2, -3, -9 and active MMP-1, -2, -3, -9 in a concentration dependent manner. LXA4 could also inhibit the IL-1β induced increases in TIMP-1, -2.CONCLUSION: As a potent anti-inflammation reagent, LXA4 can inhibit corneal collagen degradation induced by IL-1β in corneal fibroblasts thus inhibiting corneal dissolving pathology process.

Efficacy of Seprafilm^® graft with adhesiolysis in experimentally induced lid adhesion in rabbits

Sang Wook Jin,Hee Bae Ahn,Mi Sook Roh,Yoon Hyung Kwon and Won Yeol Ryu
AIM:To evaluate the efficacy of Seprafilm^® transplantation following adhesiolysis for preventing postoperative readhesion and improving surgical outcomes.METHODS:Primary blepharoplasty was carried out on both eyelids of 18 albino rabbits. After 2 weeks, a new skin incision was made, and adhesiolysis was performed on both eyelids. The rabbits were categorized into two groups, one with adhesiolysis alone in the left eyelid (control group), and the other with adhesiolysis with a Seprafilm^® graft in the right eyelid (Seprafilm^® group). The degrees of inflammation and fibrosis were examined with hematoxylin-eosin (HE) and Masson’s trichrome stains. Expression of α-smooth muscle actin (α-SMA) was also immunohistochemically examined.RESULTS:Eyelid examination immediately after the operation revealed mild swelling and hemorrhage in both groups, but these symptoms resolved after 1 week-2 weeks, and eyelid shape had recovered completely in both groups. Microscopic assessments demonstrated that the Seprafilm^® group showed less inflammation and fibrosis than the control group. The Seprafilm^® group also exhibited fewer α-SMA-positive cells than the control group.CONCLUSION:Based on these findings, we conclude that Seprafilm^® graft with adhesiolysis is an effective method for preventing postoperative readhesions after eyelid surgery.

The role of the cytokines in the pathogenesis of pseudoexfoliation syndrome

Zuhal Yildirim, Filiz Yildirim, Nil Irem Uçgun and Aylin Sepici-Dinçel
AIM: To examine the mechanism of the development of pseudoexfoliation (PSX) syndrome via both cytokine formation and endothelial vasorelaxing and growth factors that will provide us new therapeutic insights for the treatment.METHODS: This is a cross sectional study included two groups; Group 1:control patients with nuclear cataract (n=20, aged 51-80 years). Group 2:PSX patients with nuclear cataract (n=18, aged 50-90 years). Patients with other ophthalmic problems and systemic diseases were excluded. Vascular endothelial growth factor (VEGF), interleukin-6 (IL-6) and interleukin-1β (IL-1β) and nitrotyrosine levels were determined through serum samples by Enzyme-linked immunosorbent assay (ELISA) method. Nitrite-nitrate levels were measured with photometric endpoint determination.RESULTS: There were no significant differences between the groups in terms of age, VEGF, IL-1β, nitrite-nitrate and nitrotyrosine. The significant results were the mean IL-6 levels that were higher in PSX group 2 (37.68±29.52 pg/mL) compared to that in control group 1 (15.32±10.08 pg/mL) (P<0.001).CONCLUSION: Several interacting and extending biochemical pathways may lead to the promotion of VEGF and IL-6 expressions. IL-6 which is the only altered marker in our study may indirectly cause an increase of vascular permeability and neovascularization. We suggest inflammation as a factor that can be involved in etiopathogenesis of PSX.

Expressions of type I collagen, α2 integrin and β1 integrin in sclera of guinea pig with defocus myopia and inhibitory effects of bFGF on the formation of myopia
AIM: Toinvestigate the expressions of type I collagen, α2 integrin and β1 integrin in the posterior sclera of guinea pigs with defocus myopia and whether basic fibroblast growth factor (bFGF) injection inhibits the formation and development of myopia by upregulating the expression of type I collagen, α2 integrin and β1 integrin.METHODS: After 14 days of treatment, the refractive state and axial length were measured and the levels of type I collagen, α2 integrin and β1 integrin were assayed in the posterior sclerae of groups of guinea pigs that wore a monocular -7D polymethylmethacrylate (PMMA) lens or had -7D lens wear followed by the peribulbar injection of Phosphate Buffer Solution (PBS) or bFGF. The untreated fellow eye served as a control. Guinea pigs with no treatment served as normal group.RESULTS: The results showed that 14 days of monocular defocus increased axial eye length and refraction, while bFGF delivery inhibited them markedly. Further, it was also found that the monocular -7D lens could decrease the levels of type I collagen, α2 integrin and β1 integrin expressions, while, unlike PBS, bFGF increased them significantly in comparison to contralateral control eyes and normal eyes.CONCLUSION: bFGF can prevent the formation and development of defocus myopia by upregulating the expressions of type I collagen, α2 integrin and β1 integrin. Taken together, our results demonstrate that bFGF promotes sclera remodeling to prevent myopia in guinea pigs.

Impact of Lycium Barbarum Polysaccharide and Danshensu on vascular endothelial growth factor in the process of retinal neovascularization of rabbit

Xue-Min Tian,Rui Wang,Bai-Ke Zhang,Chun-Lei Wang,Hao Guo and Shi-Jin Zhang
AIM:To discuss the impact of Lycium Barbarum Polysaccharide (LBP) and Danshensu purified from Traditional Chinese Medicine (TCM) on vascular endothelial growth factor (VEGF) of rabbits with retinal neovascularization.METHODS:Forty rabbits were divided into normal control group, model control group, LBP group and Danshensu group. Animals in the normal control group were fed in the normal oxygen environment. Animals in the other three groups were put into the environment with 70% oxygen for 5 days in order to build the model of oxygen-induced vascular proliferation retinopathy. And then different TCM extract was injected into the abdominal cavities of these annimals. After 7 days, the VEGF content of in the serum of rabbit was measured by double antibody sandwich method.RESULTS:Data analysis indicated that VEGF content was as follows:Danshensu group was lower than model control group (12.92±3.84ng/L vs 19.32±4.15ng/L, P<0.05); LBP group and normal control group were lower than model control group (12.92±3.84ng/L, 9.26±1.61ng/L vs 19.32±4.15ng/L, P<0.01); total blood viscosity, plasma viscosity, cholesterol content, fibrinogen content and triacylglycerol content after peritoneal injection of LBP and Danshensu were obviously lower than before injection.CONCLUSION:TCM extract-LBP and Danshensu can prominently reduce the content of VEGF in the process of vascular proliferative retinopathy of rabbit; can prevent the occurrence of retinal microvascular disease by improving partial oxygen-deficient environment or affecting all kinds of new growth factor.

Effect of titanium dioxide nanoparticles on zebrafish embryos and developing retina

2014/12/15 0:00:00
AIM:To investigate the impact of titanium dioxide nanoparticles (TiO2 NPs) on embryonic development and retinal neurogenesis. METHODS:The agglomeration and sedimentation of TiO2 NPs solutions at different dilutions were observed, and the ultraviolet-visible spectra of their supernatants were measured. Zebrafish embryos were experimentally exposed to TiO2 NPs until 72h postfertilization (hpf). The retinal neurogenesis and distribution of the microglia were analyzed by immunohistochemistry and whole mount in situ hybridization. RESULTS: The1 mg/L was determined to be an appropriate exposure dose. Embryos exposed to TiO2 NPs had a normal phenotype. The neurogenesis was initiated on time, and ganglion cells, cones and rods were well differentiated at 72 hpf. The expression of fms mRNA and the 4C4 antibody, which were specific to microglia in the central nervous system (CNS), closely resembled their endogenous profile. CONCLUSION:These data demonstrate that short-term exposure to TiO2 NPs at a low dose does not lead to delayed embryonic development or retinal neurotoxicity.

Gene transfer to human trabecular meshwork cells in vitro and ex vivo using HIV-based lentivirus

2014/12/15 0:00:00
AIM:To investigate whether the enhanced green fluorescent protein (EGFP) reporter gene could be transferred into human trabecular meshwork (HTM) cells by a HIV-based lentivirus both in vitro and ex vivo.METHODS:The HIV-based lentivirus that contains an EF1-α promoter driving EGFP expression cassette was constructed following the standard molecular cloning methods. The cultured HTM cells were transduced at a range of multiplicity of infection (MOI) with HIV-based lentivirus. EGFP positive cell populations were detected by flow cytometry. Human anterior eye segments were cultured with perfusion culture system and transfected by HIV-based lentivirus with a 1×10⁸ transducing unit (TU) virus in perfusion liquid. The intraocular pressure was recorded every 8h for 21d. The expression of EGFP in the anterior segment of the human eye was detected by fluorescence microscopy. Furthermore, the distribution of EGFP expression was confirmed by anti-EGFP immunohistochemical staining.RESULTS:The HIV-based lentivirus which contains an EF1-α promoter driving EGFP expression cassette was constructed successfully. After HTM cells were transduced with HIV-based lentivirus containing EGFP in vitro, the ratio of EGFP positive cells to the total cell number reached 92.3%, with the MOI of 15. After the lentivirus containing EGFP were used to transduce human anterior eye segments, the EGFP could be directly detected by fluorescence microscopy in vivo. Immunohistochemistry staining revealed that 88.19% EGFP-positive trabecular meshwork (TM) cells were observed in the human anterior segment. Nevertheless, the intraocular pressure in the lentivirus-transduced group kept constant when compared with control group (P>0.05).CONCLUSION:EGFP gene could be efficiently transferred into HTM cells both in vitro and ex vivo by using HIV-based lentivirus.

Reliability of Tonolab measurements in rats

Li-Fang Liu,Chu-Kai Huang and Ming-Zhi Zhang — 2014/12/15 0:00:00
AIM:To assess the repeatability and reproducibility of Tonolab tonometer in rats with high intraocular pressure (IOP) and evaluate its ability to detect IOP changes in rats with general anaesthesia.METHODS:Left eyes of adult Fischer rats (F344) were photocoagulated by 532 nm diode laser to induce high IOP. Hypertensive eyes of 30 conscious rats were randomly chosen to measure IOP on a single occasion. Two observers independently and alternately undertook IOP measurements consecutively for three times using the same Tonolab tonometer blind to the other observer''s IOP measurements. The within subject standard deviation (Sw), coefficient of variation (CVw) (100×Sw/overall mean), and intraclass correlation coefficient (ICC) were calculated to evaluate intra-observer repeatability. Inter-observer difference was analysed by using 95% limits of agreement described by Bland-Altman and paired sample t-test. Also, another 13 normal F344 rats were intraperitoneally administrated with ketamine/xylazine or chloral hydrate, and IOPs of both eyes were measured by a single operator once every 5min until animals came to conscious. IOPs at various time points were compared by using one-way ANOVAs.RESULTS: Mean IOP was 35.58 mm Hg (range 17.33 to 65.33 mm Hg). For intraobserver repeatability, the Sw, CVw and ICC of high IOP for two observers were 5.20 mm Hg/3.41 mm Hg, 9.98%/8.08% and 0.820/0.928 respectively. The inter-observer difference was 14.76%±19.76% of the mean IOP of two observers, with a 95% limits of agreement -23.97% to 53.50%, and the difference between mean IOP of these two observers was statistically significant (P=0.001). IOPs dropped slightly during the first 15min post-aneathesia, with a IOP change between 0.17 and 1.17 mm Hg. IOPs changed from basline of 11.75±2.05 mm Hg (n=12) to 8.75±1.06 mm Hg 20min post-anesthesia (P=0.001), and this hypotensive condition persisted until 80min post-anesthesia.CONCLUSION: In this sample of hypertensive rats, Tonolab measurements demonstrated high levels of intraobserver repeatability, however, its interobserver reproducibility was poor. Longitudinal changes of IOP caused by genral anaesthesia can be sensitively detected by Tonolab. So we suggested that measurements of IOP using Tonolab are best measured by a single observer, and it could be included in experimental glaucoma.

Tonicity response element binding protein associated with neuronal cell death in the experimental diabetic retinopathy

2014/12/15 0:00:00
AIM:To studythe contribution of tonicity response element binding protein (TonEBP) in retinal ganglion cell (RGC) death of diabetic retinopathy (DR).METHODS:Diabetes was induced in C57BL/6 mice by five consecutive intraperitoneal injections of 55 mg/kg streptozotocin (STZ). Control mice received vehicle (phosphate-buffered saline). All mice were killed 2mo after injections, and the extent of cell death and the protein expression levels of TonEBP and aldose reductase (AR) were examined.RESULTS:The TonEBP and AR protein levels and the death of RGC were significantly increased in the retinas of diabetic mice compared with controls 2mo after the induction of diabetes. Terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick end labeling (TUNEL)-positive signals co-localized with TonEBP immunoreactive RGC. These changes were increased in the diabetic retinas compared with controls.CONCLUSION:The present data show that AR and TonEBP are upregulated in the DR and TonEBP may contribute to apoptosis of RGC in the DR.

Pigment epithelium-derived factor protects the morphological structure of retinal Müller cells in diabetic rats

Xiao-Hui Zhang,Zhao-Hui Feng and Yi Zhang — 2014/12/15 0:00:00
AIM:To investigate if pigment epithelium-derived factor (PEDF) has any protective effect on the retinal Müller cells of Sprague-Dawley rats suffering from diabetes mellitus.METHODS:Sixty Sprague-Dawley rats were randomly divided into a negative control group, a group receiving 0.1 μg/μL PEDF, another group receiving 0.2 μg/μL PEDF, and a group receiving balanced salt solution (BSS). Rats in both the PEDF and BSS groups were treated intravitreally based on previously established diabetic models. After 4wk of treatment, morphological alterations of Müller cells and protein expression of glutamine synthase (GS) and glial fibrillary acidic protein (GFAP) were analyzed.RESULTS:PEDFat either0.1 μg/μL or 0.2 μg/μL significantly improved the structures of both nuclei and organelles of Müller cells compared to the BSS-treated group. Expression of GS was significantly higher in the 0.2 μg/μL PEDF group than that in the BSS group (P=0.012), but expression of GFAP was significantly lower in the 0.2 μg/μL PEDF group than that in the BSS group (P=0.000); however, there were no significant differences in expression of these proteins between the 0.1 μg/μL PEDF group and the BSS group (P=0.608, P=0.152).CONCLUSION:PEDF protects the morphological ultrastructure of Müller cells, improves the expression of glutamate synthase and prevents cell gliosis.

Effects of different concentrations of tetramethylpyrazine, an active constituent of Chinese herb, on human corneal epithelial cell damaged by hydrogen peroxide

Na Li,Xin-Guo Deng,Shi-Hua Zhang,Mei-Feng He and Dong-Qing Zhao — 2014/12/15 0:00:00
AIM:To discuss the effects of different concentrations of tetramethylpyrazine (TMP), an active constituent of Chinese herb, on damaged Shandonghuman corneal epithelial cell (SDHCEC) induced by hydrogen peroxide.METHODS:We detected the combined effects of TMP with concentrations ranging from 4 mg/mL to 0.03 mg/mL and 800 μM hydrogen peroxide on SDHCEC. The methyl thiazolyl tetrazolium (MTT) assay was processed at 3, 6 and 12h separately while the detection of cell apoptosis at 6h only by flow cytometry.RESULTS:The viability of SDHCEC with 0.5 mg/mL, 0.25 mg/mL, 0.125 mg/mL and 0.06 mg/mL TMP joint with 800 μM hydrogen peroxide at 3h and 6h was significantly higher than that with 800 μM hydrogen peroxide only, P＜0.05. However, except 0.25 mg/mL, TMP with other concentrations joint with 800 μM hydrogen peroxide at 12h could not significantly inhibit decreased SDHCEC viability induced by 800 μM hydrogen peroxide. At 12h, TMP of 0.5 mg/mL, 0.25 mg/mL, 0.125 mg/mL and 0.06 mg/mL could significantly inhibit SDHCEC early apoptosis induced by 800 μM hydrogen peroxide, most remarkable at 0.25 mg/mL TMP, P＜0.05.CONCLUSION:Our results suggested that hydrogen peroxide can induce apoptosis related damage to SDHCEC. TMP can protect SDHCEC from the damage, and the protective effects may be associated with its anti-apoptosis mechanism.

Suppression of laser-induced choroidal neovascularization by intravitreal injection of tristetraprolin

2014/12/15 0:00:00
AIM:To examine the effect of intravitreal adenoviral vector-mediated tristetraprolin (Ad-TTP) on VEGF mRNA expression in a rat model of laser-induced choroidal neovascularization.METHODS:Ad-TTP was prepared using a commercial kit. Retinal laser-induced photocoagulation (10 spots per eye) was performed on rats in this experimental choroidal neovascularization (CNV) model. Rats were divided into four groups:control (single intravitreal injection of balanced salt solution, n=10), laser-induced CNV (photocoagulation only, n=20), laser-induced CNV plus Ad-TTP injection (photocoagulation plus a single intravitreal Ad-TTP injection, n=20) and Ad-TTP injection only (n=10). Changes in choroidal morphology were evaluated in ten rats in the laser only and the laser plus Ad-TTP groups. Two weeks after laser injury, the size of CNV was calculated by perfusion with high-molecular-weight fluorescein isothiocyanate (FITC)-dextran. VEGF mRNA expression in retina-choroid tissue from ten rats in each group was measured by reverse transcription polymerase chain reaction (RT-PCR).RESULTS:Two weeks after treatment, the area of laser-induced CNV was reduced by approximately 60% in the rats given the Ad-TTP injection compared with that in the laser-only group. There was a tendency toward decreased VEGF mRNA expression in the Ad-TTP injection groups.CONCLUSION:A single intravitreal injection of Ad-TTP significantly suppressed CNV size in this experimental laser-induced CNV model. Ad-TTP injection also decreased VEGF mRNA expression compared with that in the laser-induced CNV group. The present study is meaningful as the first study to investigate the effect of tristetraprolin delivered via intravitreal injection.

A histological study of rabbit corneas after transepithelial corneal crosslinking using partial epithelial photoablation or ethanol treatment

2014/12/15 0:00:00
AIM: To evaluate the histological changes after transepithelial corneal crosslinking (CXL) using partial thickness excimer laser ablation or epithelial ethanol application in an experimental rabbit study.METHODS: Right eyes of twenty-four rabbits were studied. Four eyes received total epithelial debridement (group I). Four eyes received partial thickness epithelial ablation with excimer laser (group II). Twelve eyes were treated with different durations (30s and 60s) and concentrations (18% to 48%) of ethanol (group III). Riboflavin was applied for 30min intervals along with topical proparacaine drops with benzalkonium chloride, and 370 nm irradiation was performed for 30min, while riboflavin was instilled every 3min. Four eyes (group IV) received 48% ethanol for 30s without riboflavin and irradiation. Eyes were collected after 24h and examined histologically.RESULTS: All eyes in group I showed keratocyte loss in the superficial 300 μ of corneal storma. In group II, 1-4 layers of epithelium were preserved and no keratocyte loss occurred. In group III, CXL after treatment with ethanol up to 24% concentration and up to 60s revealed no keratocyte loss. CXL after treatment with 48% and higher ethanol concentrations yielded keratocyte loss in the superficial 200 μ to 300 μ of cornea.CONCLUSION: Incomplete excimer laser ablation of the epithelium or treatment with ethanol up to 24% concentration and up to 60s duration yielded no stromal keratocyte loss. To get the same histological appearance seen in epithelial debridement group, partial thickness excimer laser epithelial ablation or ethanol application is not adequate for transepithelial CXL.

Activation of autophagy in photoreceptor necroptosis after experimental retinal detachment

Kai Dong,Zi-Cheng Zhu,Feng-Hua Wang,Gen-Jie Ke,Zhang Yu and Xun Xu — 2014/10/20 0:00:00
AIM:To investigate whether photoreceptor necroptosis induced by z-VAD-FMK (pan caspase inhibitor) was involved the activation of autophagy and whether Necrostatin-1, a specific necroptosis inhibitor, could inhibit this induction of autophagy after experimental retinal detachment.METHODS:Experimental retinal detachment models were created in Sprague-Dawley rats by subretinal injection of sodium hyaluronate and subretinal injections of z-VAD-FMK, vehicle or z-VAD-FMK plus Necrostatin-1. Three days after retinal detachment, morphologic changes were observed by transmission electron microscopy. In other animals, retinas were subjected to immunoprecipitation and Western Blotting, then probed with anti-RIP1, phosphoserine, LC-3II or caspase 8 antibody.RESULTS:It was proved by immunoprecipitation and western blotting, that photoreceptor necroptosis was mediated by caspase-8 inhibition and receptor interacting protein kinase (RIP1) phosphorylation activation. Transmission electron microscope and western blotting results indicated that photoreceptor necroptosis was involved the LC-3II and autophagosomes induction. We also discovered Necrostatin-1 could inhibit RIP1 phosphorylation and LC-3II induction.CONCLUSION:These data firstly indicate photoreceptor necroptosis is associated with the activation of autophagy. Necrostatin-1 protects photoreceptors from necroptosis and autophagy by down-regulation of RIP1 phosphorylation and LC-3II.

Genetic analysis of Chinese families reveals a novel truncation allele of the retinitis pigmentosa GTPase regulator gene

2014/10/20 0:00:00
AIM: To make comprehensive molecular diagnosis for retinitis pigmentosa (RP) patients in a consanguineous Han Chinese family using next generation sequencing based Capture-NGS screen technology. METHODS: A five-generation Han Chinese family diagnosed as non-syndromic X-linked recessive RP (XLRP) was recruited, including four affected males, four obligate female carriers and eleven unaffected family members. Capture-NGS was performed using a custom designed capture panel covers 163 known retinal disease genes including 47 RP genes, followed by the validation of detected mutation using Sanger sequencing in all recruited family members. RESULTS: Capture-NGS in one affected 47-year-old male reveals a novel mutation, c.2417_2418insG:p.E806fs, in exon ORF15 of RP GTPase regulator (RPGR) gene results in a frameshift change that results in a premature stop codon and a truncated protein product. The mutation was further validated in three of four affected males and two of four female carriers but not in the other unaffected family members. CONCLUSION: We have identified a novel mutation, c.2417_2418insG:p.E806fs, in a Han Chinese family with XLRP. Our findings expand the mutation spectrum of RPGR and the phenotypic spectrum of XLRP in Han Chinese families, and confirms Capture-NGS could be an effective and economic approach for the comprehensive molecular diagnosis of RP.

Transforming growth factor-β2 induces morphological alteration of human corneal endothelial cells in vitro

Jing Wang,Ting-Jun Fan,Xiu-Xia Yang and Shi-Min Chang — 2014/10/20 0:00:00
AIM:To investigate the morphological altering effect of transforming growth factor-β2 (TGF-β2) on untransfected human corneal endothelial cells (HCECs) in vitro.METHODS: After untransfected HCECs were treated with TGF-β2 at different concentrations, the morphology, cytoskeleton distribution, and type IV collagen expression of the cells were examined with inverted contrast light microscopy, fluorescence microscopy, immunofluorescence or Western Blot.RESULTS:TGF-β2 at the concentration of 3-15 μg/L had obviously alterative effects on HCECs morphology in dose and time-dependent manner, and 9 μg/L was the peak concentration. TGF-β2 (9 μg/L) altered HCE cell morphology after treatment for 36h, increased the mean optical density (P<0.01) and the length of F-actin, reduced the mean optical density (P<0.01) of the collagen type IV in extracellular matrix (ECM) and induced the rearrangement of F-actin, microtubule in cytoplasm and collagen type IV in ECM after treatment for 72h. CONCLUTION:TGF-β2 has obviously alterative effect on the morphology of HCECs from polygonal phenotype to enlarged spindle-shaped phenotype, in dose and time-dependence manner by inducing more, elongation and alignment of F-actin, rearrangement of microtubule and larger spread area of collagen type IV.

Roles of tissue plasminogen activator and its inhibitor in proliferative diabetic retinopathy

Shu-Ling Wu,Dong-Mei Zhan,Shu-Hong Xi and Xiang-Lian He — 2014/10/20 0:00:00
AIM:To investigate the role of tissue plasminogen activator (t-PA) and plasminogen activator inhibitor (PAI) in proliferative diabetic retinopathy (PDR) and to discuss the correlations among t-PA, PAI and vascular endothelial growth factor (VEGF) expressions.METHODS: A total of 36 vitreous samples were collected from 36 patients with PDR (PDR group), and 17 vitreous samples from 17 patients with idiopathic macular hole were used as control. The concentrations of t-PA, PAI and VEGF in samples were determined by ELISA method. The correlations among t-PA, PAI and VEGF expressions were discussed.RESULTS: The concentrations of t-PA, PAI and VEGF in the PDR group were significantly higher than those in the control group (P<0.001). The t-PA and PAI expressions were highly correlated with the VEGF expression (P<0.001).CONCLUSION:In addition to VEGF, a variety of bioactive substances, such as t-PA and PAI, are involved in the pathogenesis involved in the angiogenesis of PDR. VEGF can activate t-PA expression, resulting in collagen tissue degradation and angiogenesis. VEGF may also activate the mechanism for endogenous anti-neovascularization.

Comparison of conventional and directional freezing for the cryopreservation of human umbilical vein endothelial cells

Bing Qi,Qing-Shan Ji,Guang-Hui Hou,Liu Li,Xian-Fen Cao and Jing Wu — 2014/10/20 0:00:00
AIM:To compare conventional slow equilibrium cooling and directional freezing (DF) by gauze package for cryopreservation of human umbilical vein endothelial cells (HUVECs).METHODS: HUVECs were randomly assigned to conventional freezing (CF) and DF by gauze package group. The two groups of HUVECs were incubated with a freezing liquid consisting of 10% dimethylsulfoxide (DMSO), 60% fetal bovine serum(FBS) and 30% Dulbecco’s modified Eagle’s medium(DMEM) and then put into cryopreserved tubes. CF group, slow equilibrium cooling was performed with the following program:precool in 4℃ for 30min, -20℃ for 1h, and then immersion in -80℃ refrigerator. DF group, the tubes were packaged with gauze and then directional freezing in -80℃ refrigerator straightly. One month later, the vitality of HUVECs were calculated between two groups.RESULTS: There was no significant difference in the survival rate and growth curve between CF and DF groups. The DF group was significantly better than CF group in adherent rates, morphological changes and proliferative ability.CONCLUSION:In the conventional cryopreserved method, cells are slow equilibrium cooling by steps (4℃, -20℃ and finally -80℃), which is a complicated and time-consuming process. But the improved DF by gauze package method is better than conventional method, for which is convenient and easy to operate.

Vascular endothelial growth factor gene polymorphisms in age-related macular degeneration in a Turkish population

2014/10/20 0:00:00
AIM:To assess the association between age-related macular degeneration (AMD) and three single nucleotide polymorphisms (SNPs) related to the vascular endothelial growth factor (VEGF) gene.METHODS: The patients who were diagnosed with AMD were included in this prospective study. Three SNPs (rs1413711, rs2146323, and rs3025033) of the VEGF gene were genotyped by real-time polymerase chain reaction in the genomic DNA isolated from peripheral blood samples of the 82 patients and 80 controls.RESULTS: The genotype frequencies of rs1413711 and rs2146323 were not significantly different between the study group and the control group (P=0.072 and P=0.058). However, there was a significant difference in the genotype frequencies of these SNPs between the wet type AMD and dry type AMD (P=0.005 and P=0.010, respectively). One of the SNPs (rs1413711) was also found to be associated with the severity of AMD (P=0.001) with significant genotype distribution between early, intermediate, and advanced stages of the disease. The ancestral alleles were protective for both SNPs while the polymorphic alleles increased the risk for dry AMD.CONCLUSION: VEGF SNPs rs1413711 and rs2146323 polymorphisms are significantly associated with AMD subtypes in our population.

In vitro and comparative study on the extracellular enzyme activity of molds isolated from keratomycosis and soil

2014/10/20 0:00:00
AIM:To isolate and identify the molds involved in mycotic keratitis; to isolate corresponding species from soil samples; to compare the extracellular enzyme activity indices of the molds isolated from keratitis cases and the corresponding soil isolates.METHODS:The specimens were collected from the target patients attending the microbiology laboratory of tertiary eye hospital in Coimbatore, Tamilnadu state, India. The isolates were subjected for identification based on the growth on solid media, direct microscopy and lacto phenol cotton blue wet mount preparation. Extracellular enzymes such as lipase, deoxyribonuclease (DNase), α-amylase, protease, cellulase and pectinase produced by the fungalisolates were screened on solid media supplemented with the corresponding substrates. Based on growth and zone diameter, the enzyme activity indices were calculated and were compared with that of the soil fungalisolates.RESULTS:A total of 108 clinical samples were collected from a tertiary eye care hospital and out of which 60 fungal isolates were obtained. Among these, Fusarium spp. (n=30), non sporulating molds (n=9), Aspergillus flavus (n=6), Bipolaris spp. (n=6), Exserohilum spp. (n=4), Curvularia spp. (n=3), Alternaria spp. (n=1) and Exophiala spp. (n=1)were identified and designated as FS1-30, NSM1-9, AF1-6, BS1-6, ES1-4, CS1-3, AS1 and EX1, respectively. For comparative analysis, soil samples were also collected from which, one isolate of each Fusarium spp., Aspergillus flavus, Bipolaris spp., Exserohilum spp., and Curvularia spp., respectively were selected. Highest lipase activity was seen in corneal isolate NSM2 (EAI= 2.14). The DNase activity was higher in NSM9 (EAI=1.88). In case of protease, Fusarium spp. (FS9) had prominent enzyme activity index of 1.38; α-amylase activity was also superior in corneal isolate FS13 with EAI of 1.63 when compared to other isolates. The enzyme activity index for cellulase was also noted to be higher in corneal isolates i.e. NSM7 with EAI of 1.98 when compared to other corneal and soil isolates. The pectinase activity index was also prominent for corneal isolate NSM5 versus the soil isolates, SAF1, SFS1, SES1, SBS1 and SCS 1 as 1.76 versus 1.47, 1.38, 1.16, 1.11 and 1.14, respectively.CONCLUSION: The most common isolate was Fusarium spp. followed by Aspergillus, Curvularia, Exserohilum, Bipolaris, Exophiala and Alternaria species. Enzyme activity indices (EAI) of the enzymes analysed varied with the clinical and soil isolates with respect to protease and cellulase (P=0.01). Of all the strains compared it was noted that mean EAI was greater in many clinical fusarial isolates followed by non sporulating molds.

A comparison of three methods of decellularization of pig corneas to reduce immunogenicity

Whayoung Lee,Yuko Miyagawa,Cassandra Long,David K. C. Cooper and Hidetaka Hara — 2014/8/15 0:00:00
AIM:To investigate whether decellularization using different techniques can reduce immunogenicity of the cornea, and to explore the decellularized cornea as a scaffold for cultured corneal endothelial cells (CECs). Transplantation of decellularized porcine corneas increases graft transparency and survival for longer periods compared with fresh grafts.METHODS: Six-month-old wild-type pig corneas were cut into 100-200 μm thickness, and then decellularized by three different methods:1) 0.1% sodium dodecyl sulfate (SDS); 2) hypoxic nitrogen (N2); and 3) hypertonic NaCl. Thickness and transparency were assessed visually. Fresh and decellularized corneas were stained with hematoxylin/eosin (H&E), and for the presence of galactose-α1,3-galactose (Gal) and N-glycolylneuraminic acid (NeuGc, a nonGal antigen). Also, a human IgM/IgG binding assay was performed. Cultured porcine CECs were seeded on the surface of the decellularized cornea and examined after H&E staining.RESULTS:All three methods of decellularization reduced the number of keratocytes in the stromal tissue by >80% while the collagen structure remained preserved. No remaining nuclei stained positive for Gal or NeuGc, and expression of these oligosaccharides on collagen was also greatly decreased compared to expression on fresh corneas. Human IgM/IgG binding to decellularized corneal tissue was considerably reduced compared to fresh corneal tissue. The cultured CECs formed a confluent monolayer on the surface of decellularized tissue.CONCLUSION:Though incomplete, the significant reduction in the cellular component of the decellularized cornea should be associated with a significantly reduced in vivo immune response compared to fresh corneas.

Expression levels of autophagy related proteins and their prognostic significance in retinocytoma and retinoblastoma

2014/8/15 0:00:00
AIM:To discuss the prognostic significant of autophagy related proteins (ARPs) in retinoblastoma (RB) and to find the molecular marker to distinguish retinocytoma (RC) and RB byinvestigating the different expression profiling of microtubule-associated protein light chain 3 (LC3B) and other ARPs in RC and RB.METHODS: Specimens with retinocytoma region (RCR) or mainly composed with Flexner-Winterstein rosettes (FWR) were screen out from 219 paraffin-embedded RB samples and respectively taken as RCR group and FWR group. Others were taken as undifferentiated (UD) group. Immunochemistry (IHC) of LC3B and electronic microscopy was used to identify autophagy. The IHC scores of LC3B and other ARPs, such as Beclin, PTEN, p27, p16^INK4a, mTOR and BCL-2 were compared and correlation analysis was applied to find potential proteins which may involve in autophagy regulation. The prognostics significance of LC3B was evaluated by comparing the high risk features (HRFs) in 3 groups of total 219 samples.RESULTS: Twenty-one specimens with RCR and 36 specimens mainly composed with FWR were screen out. RCR cell had a high level of LC3B and lots of autophagic vacuoles. Beclin, PTEN, p27 had positive correlation with LC3, and p16^INK4a had negative correlation, while the expression of mTOR and BCL-2 in RCR and RB region did not show any difference. Cases with RCR had lower rate of HRFs than undifferentiated cases.CONCLUSION: ARPs had different expression pattern between RCR and other pathological types of RB, and could be ideal markers to distinguish RC from RB. Our finding indicated cases with RCR had favorable prognosis just like those with FWR.

Retinal vessel diameter changes induced by transient high perfusion pressure

Yin-Ying Zhao,Ping-Jun Chang,Fang Yu and Yun-E Zhao — 2014/8/15 0:00:00
AIM: To investigate the effects of transient high perfusion pressure on the retinal vessel diameter and retinal ganglion cells. METHODS: The animals were divided into four groups according to different infusion pressure and infusion time (60 mm Hg-3min, 60 mm Hg-5min, 100 mm Hg-3min, 100 mm Hg-5min). Each group consisted of six rabbits. The left eye was used as the experimental eye and the right as a control. Retinal vascular diameters were evaluated before, during infusion, immediately after infusion, 5min, 10min and 30min after infusion based on the fundus photographs. Blood pressure was monitored during infusion. The eyes were removed after 24h. Damage to retinal ganglion cell (RGC) was analyzed by histology. RESULTS:Retina became whiten and papilla optic was pale during perfusion. Measurements showed signi?cant decrease in retinal artery and vein diameter during perfusion in all of the four groups at the proximal of the edge of the optic disc. The changes were significant in the 100 mm Hg-3min group and 100 mm Hg-5min group compared with 60 mm Hg-3min group (P1=0.025, P2=0.000). The diameters in all the groups recovered completely after 30min of reperfusion. The number of RGC showed no signi?cant changes at the IOP in 100 mm Hg with 5min compared with contralateral untreated eye (P＞0.05). CONCLUSION: Transient fluctuations during infusion lead to temporal changes of retinal vessels, which could affect the retinal blood circulation. The RGCs were not affected by this transient fluctuation. Further studies are necessary to evaluate the effect of pressure during real-time phacoemusification on retinal blood circulation.

Bevacizumab treatment reduces retinal neovascularization in a mouse model of retinopathy of prematurity

Fei Feng,Yan Cheng and Qing-Huai Liu — 2014/8/15 0:00:00
AIM: To evaluate the effect of different bevacizumab concentrations on retinal neovascularization in a retinopathy of prematurity (ROP) mouse model.METHODS: A total of 60 of C57BL?6 J mice were exposed to 75%±2% oxygen from postnatal d7 to postnatal d12. Fifteen nonexposed mice served as negative controls (group A). On d12, 30 mice (group C) were injected with 2.5 μg intravitreal bevacizumab (IVB), 30 mice (group D) were injected with 1.25 μg IVB in one eye. The contralateral eyes were injected with balanced salt solution (BSS) (control group=group B). The adenosine diphosphatase (ADPase) histochemical technique was used for retinal flat mount to assess the oxygen-induced changes of retinal vessels. Neovascularization was quantified by counting the endothelial cell proliferation on the vitreal side of the inner limiting membrane of the retina. Histological changes were examined by light microscopy. The mRNA levels of vascular endothelial growth factor (VEGF) were quantified by Real-time PCR. Western-blotting analysis was performed to examine the expression of P-VEGFR.RESULTS:Comparing with the control group B, regular distributions and reduced tortuosity of vessels were observed in our retinal flat mounts in groups C and D. The endothelial cell count per histological section was lower in groups C (P<0.0001) and D (P<0.0001) compared with the control group B. Histological evaluation showed no retinal toxicity in any group. In all oxygen treated groups VEGF mRNA expression was significantly increased as compared to age-matched controls. No significant change in VEGF mRNA expression could be achieved in either of the treatments or the oxygen controls. The results of the Western blot were consistent with that of the Real-time PCR analysis.CONCLUSION:An intravitreal injection of Bevacizumab is able to reduce angioproliferative retinopathy in a mouse model for oxygen-induced retinopathy.

Effectiveness of selenium on acrylamide toxicity to retina

Mervat Ahmed Ali,Eman Mohamed Aly and Amal Ibrahim Elawady — 2014/8/15 0:00:00
AIM: To investigate the hematological parameters, biochemical and electrophysiological role of acrylamide (ACR) in the retina and to assess whether selenium (Se) has protective potential in experimental oral intoxication with ACR.METHODS: Sixty Wistar age matched-albino rats (3mo) weighing 195-230 g comprised of both sex were divided into 4 groups. Group I served as the control one in which animals take saline; group II was animals administrated ACR in dose of 15 mg/kg body weight per day for 28d; group III was animals received ACR then additionally Se (0.1 mg/kg body weight) for 28d; and group IV was animals received Se only (0.1 mg/kg body weight) for 28d. Blood analysis and serum trace element levels (Fe, Cu, and Zn) were measured. The electroretinogram (ERG) was recorded, the levels of malondialdehyde (MDA) and glutathione peroxidase (GSH-Px) in the retinal tissues were determined. Moreover the regulation of ion channels such as calcium, sodium and potassium were studied. All measurements were done for all groups after 28d.RESULTS:Administration of ACR in group II caused a significant decrease (P<0.05) in hemoglobin (Hb), red blood cells (RBCs), hematocrit (HCT), white blood cells (WBCs) and lymphocyte of rats. A significant decrease (P<0.05) in Zn level, and alkaline phosphatase enzyme was observed compared to control. ERG which is a reflection of the electric activity in the retina; a- and-b wave amplitudes in ACR group had a reduction of 40% and 20% respectively. These changes accompanied by^significant increases (P<0.05) in MDA level in the ACR group, in contrast with GSH-Px which is significant decreased (P<0.05). Moreover sodium and calcium were significant increased but potassium was significant decreased (P<0.05) compared to control group. There were no significant differences between group III (treated with Se) and control in all hematological parameter. Also serum trace elements levels (Cu, Fe and Zn), alkaline phosphatase enzyme and electric activity of the retina didn’t change compared to control due to Se treatment.CONCLUSION: This study provides evidence for the protective effect of Se on acrylamide induced toxicity by reducing oxidative stress.

Correlation of discoloration and biomechanical properties in porcine sclera induced by genipin

Tai-Xiang Liu,Xin Luo,Yu-Wei Gu,Bin Yang and Zheng Wang — 2014/8/15 0:00:00
AIM: To study the feasibility of using the discoloration to evaluate the biomechanical properties after treating with genipin.METHODS: Porcine cadaver eyes were treated for 30min with 1.0% (by w/v)genipin. Untreated samples were used as controls. After treatment, scleral strips of 4.0×10.0-mm² were cut. The denaturation temperature (Td) measurement and stress-strain test were performed after taking photograph to analyze the color.RESULTS:Within 24h after treating with genipin, the sclera exhibited a bluish color which became deeper with time. And the denaturation temperature also was increased gradually. Compared with untreated groups, at 1, 6, 12, 24 and 36h after treatment, the ultimate stress were increased by 56%, 153%, 173%, 225% and 211% respectively. The Young’s modulus at 10% strain also increased by 170%, 246%, 264%, 389% and 288% respectively. There were strong correlation between the discoloration and the biomechanical properties (ΔE-Ultimate stress:R²=0.892, P=0.00; ΔE-Young’s modulus:R²=0.602, P=0.00).CONCLUSION:Genipin could be used to strengthen collagen gradually in a relatively short time span. And the biomechanical properties could be reliably evaluated via simple visible discoloration.

Evaluation of the effects of acyclovir and/or human amniotic membrane on herpes virus culture and quantitative virus inactivity by real-time polymerase chain reaction

Feride Aylin Kantarci,Ali Reza Faraji,Aykut Ozkul and Fikret Akata — 2014/8/15 0:00:00
AIM: To investigate the permeability of amniotic membrane in herpes virus cell culture to acyclovir with real time polymerase chain reaction (RT-PCR).METHODS: Madin-Darby Bovine Kidney (MDBK) cell culture and Bovine Herpes Virus (BHV1) type 1 were used in the study. Cell cultures were grouped into two on the basis of herpes virus inoculation. Each group was sub-grouped into three. Amniotic membrane (V-HAM), acyclovir (V-A), and amniotic membrane and acyclovir (V-HAM-A) were applied to these subgroup cultures, respectively. After the application of the membrane and the drug, the cultures were evaluated at 24 and 48h for cytopathic effect positive (CPE+) with a tissue culture microscope. In the CPE (+) samples, the DNA was extracted for viral DNA analysis by RT-PCR.RESULTS: In control cultures without herpes virus CPE was not detected. Besides, amniotic membrane and acyclovir did not have cytotoxic effect on cell cultures. CPE were detected in Bovine Herpesvirus type-1 inoculated cell cultures after amniotic membrane and/or acyclovir application. DNA analysis with RT-PCR indicated that Cycle threshold (Ct) values were lower in the BHV1 and membrane applied group (amniotic membrane group< acyclovir group< membrane and acyclovir group). This showed that membrane did not have antiviral effect. The membrane and acyclovir cell culture groups with high Ct values indicated that membrane was permeable and had a low barrier effect to drug,CONCLUSION: In our in-vitro study, we found that amniotic membrane, which can be used in the treatment of corneal diseases, did not have antiviral effect. Besides, we detected that amniotic membrane was permeable to acyclovir in BHV-1 inoculated MDBK cell culture. However, more studies are necessary to investigate the quantitative effects of amniotic membrane and acyclovir.

Protective effects of naringenin eye drops on N-methyl-N-nitrosourea-induced photoreceptor cell death in rats

2014/6/24 0:00:00
AIM: To investigate the effects of naringenin eye drops on N-methyl-N-nitrosourea (MNU)-induced photoreceptor cell death in rats.METHODS: Photoreceptor cell death was induced by single intraperitoneal injection of MNU (60 mg/kg) in rats. Both eyes of all animals were instilled with one drop of vehicle, 0.5% or 1.0% naringenin eye drops three times per day from 7d before to 17d after MNU injection. Effects of naringenin on MNU-induced photoreceptor cell death were evaluated by electrophysiological and histological analysis.RESULTS:Flash electroretinography (FERG) and oscillatory potentials (OPs) recordings showed that the vehicle control group had remarkable reduction of amplitudes and prolongation of latency times. FERG and OPs responses were significantly reversed in MNU-induced rats treated with 0.5% or 1.0% naringenin eye drops compared with the vehicle control. The retinal morphological results showed that naringenin dose-dependently preserved the outer nuclear layer, outer retina and total retina.CONCLUSION:These results indicate that topical treatment with naringenin eye drops prevented retinal neurons from MNU-induced structural and functional damages.

The association between matrix metalloprotease-9 gene polymorphisms and primary angle-closure glaucoma in a Chinese Han population

Xiao-Jin Gao,Sheng-Ping Hou and Ping-Hua Li — 2014/6/24 0:00:00
AIM:To examine the association between the single nucleotide polymorphisms (SNPs) of matrix metalloprotease-9 (MMP-9) gene and primary angle-closure glaucoma (PACG) in a Chinese Han population.METHODS: DNA samples were extracted from peripheral-blood mononuclear cells of 214 PACG patients and 224 healthy controls. Genotyping of rs3918249, rs3918254, rs17577 and rs3787268 in MMP-9 was performed using polymerase chain reaction restriction fragment length polymorphism (PCR-RFLP) analysis and the direct sequencing technique. The association between these genetic polymorphisms and risk of PACG was estimated by χ²test.RESULTS: The distributions of rs3918249, rs3918254, rs17577 and rs3787268 genotypes among cases and healthy controls were compatible with that from Hardy-Weinberg equilibrium (HWE, P>0.05).The increased frequency of CC and CT genotypes of rs3918254 were observed in PACG patients compared to healthy controls [P=0.006, Pcorrected (Pcorr)=0.048]. The haplotype analysis showed that the CCGG haplotype was nominal associated with PACG (P=0.015), however, the significant was lost when the Bonferroni correction was used (Pcorr=0.105).CONCLUSION:Our results revealed that rs3918254 in MMP-9 may be a susceptible locus to PACG in China, people with the CC and CT genotypes of rs3918254 are more susceptible to PACG. The susceptibility to PACG in Chinese Han patients may be not influenced by SNPs rs3918249, rs3787268 and rs17577 in MMP-9.

Hypoxia increases adipogenesis and affects adipocytokine production in orbital fibroblasts–a possible explanation of the link between smoking and Graves’ ophthalmopathy

2014/6/24 0:00:00
AIM: To assess the effects of hypoxia on human orbital fibroblasts (OF) on adipogenesis and adipocytokine production.METHODS:Human OF were derived from tissues obtained from patients with Graves’ ophthalmopathy (GO) and from patients without known thyroid diseases undergoing blepharoplasty. The OF were cultured separately under normoxic and hypoxic conditions. Comparisons of adipocytokine concentrations using multiplex ELISA and lipid accumulation in the cells using Oil Red O staining were subsequently performed.RESULTS:There was increased adipogenesis in OF from GO subject when exposed to hypoxic culture conditions. This was not observed in OF from normal controls. Hypoxia led to an increase in leptin and a decrease in MCP-1 secretion in OF cultures.CONCLUSION: Hypoxia induces adipogenesis in OF and may represent a mechanism by which smoking contributes to deterioration of GO. We also found novel changes to leptin and MCP-1 production in OF cultures exposed to hypoxia suggesting important roles of these cytokines in the disease process.

Epigallocatechin-3-gallate attenuates lipopolysaccharide-induced inflammation in human retinal endothelial cells

Hui-Yan Zhang,Jian-Yong Wang and Hang-Ping Yao — 2014/6/24 0:00:00
AIM: To investigate the mechanism underlying the anti-inflammatory effects of epigallocatechin-3-gallate (EGCG) in lipopolysaccharide (LPS)-stimulated human retinal endothelial cells (HRECs).METHODS: HRECs pre-treated with EGCG (0-100 μmol/L) were stimulated with LPS (250 ng/mL). Levels of tumor necrosis factor alpha (TNF-α), vascular endothelial growth factor (VEGF), monocyte chemotactic protein-1 (MCP-1) and nitric oxide (NO) in the supernatants were determined by enzyme-linked immunosorbent assay (ELISA) and Griess assay. The protein expression of phosphorylated extracellular signal-regulated kinase (ERK) 1/2 and p38 mitogen-activated protein kinases (p38) were determined by Western blot analysis.RESULTS: EGCG pre-treatment significantly inhibited the secretion of TNF-α, VEGF, MCP-1 and NO in LPS-stimulated HRECs. Moreover, EGCG effectively attenuated LPS-induced activation and phosphorylation of ERK1/2 and p38 in HRECs in a dose-dependent manner.CONCLUSION: EGCG exhibited inhibitory effects on LPS-induced pro-inflammatory cytokines production by modulating ERK1/2 and p38 pathways in HRECs, suggesting EGCG as a potential candidate for anti-inflammatory intervention.

PI3K-mediated glioprotective effect of epidermal growth factor under oxidative stress conditions

2014/6/24 0:00:00
AIM:To determine the effects of epidermal growth factor (EGF) on the proliferation and migration of Müller cell line Moorfields/Institute of Ophthalmology-Müller 1 (MIO-M1), and its related molecular mechanisms under normal and oxidative stress conditions.METHODS: Müller cells were cultured with different concentrations of EGF in the presence or absence of varied amounts of H2O2 and glucose oxidase (GO) which induced oxidative stress. The proliferation and migration of Müller cells were examined by 5-Bromo-2-deoxyUridine (BrdU), MTT assay, Transwell assay and scratch wound healing assays. The cell viability was determined with the MTT assay. The secretion of EGF by Müller cells was evaluated by ELISA. Western blot was performed to detect the activation of extracellular regulated protein kinases (ERK)1/2 and Akt signal pathways.RESULTS:EGF stimulated the proliferation and migration of Müller cells in a concentration-dependent manner in vitro. Underoxidative damage condition,2h of pretreatment with 10-100 ng/mL EGF can mostly inhibit 50% lethal dose of 0.08 mmol/L H2O2-induced cell damage. The Western blot results showed that after Müller cells were exposed to varying EGF for 24h, Akt and ERK1/2 were phosphorylated in a dose-dependent manner. In the presence of the LY294002, the potent PI3K inhibitor, the p-Akt was significantly attenuated.CONCLUSION:EGF may induce the proliferation and migration of human Müller cells through the Akt and the ERK1/2 signal pathways, and induce PI3K-mediated glioprotective effect under oxidative stress.

Relationship between raised intraocular pressure and ischemia-modified albumin in serum and humor aqueous:a pilot study in rabbits

2014/6/24 0:00:00
AIM: We evaluated the relationship between increased intraocular pressure (IOP), ischemia-modified albumin levels in serum (IMA-s) and in humor aqueous (IMA-HA) in rabbits.METHODS: Twenty-five albino New Zealand rabbits weighing between 2.0 and 2.8 kg were used in this pilot study. With permission from Canakkale Onsekiz Mart University Animal Ethics Committee, the IOP of both eyes of each rabbit were recorded with a Tonopen (Tono-Pen XL, Reichart Inc., Depew, NY, USA) after the application of topical proparacaine 0.5% HCl anesthesia. Blood (4 mL) was collected from the marginal ear vein and an intracameral injection of 2.3 mg/mL sodium hyaluronate and subconjunctival dexamethasone was given in the right eye. Anterior chamber aqueous fluid was obtained using a limbal approach with a 27 gauge needle from both eyes. The left eyes were used as controls. IOP was measured on the 1^st, 3^rd and 10^th day after the initial injection, with Tonopen, IMA-s levels and IMA-HA examined simultaneously.RESULTS:Before the injections, IOP was 11.4±3.0 mm Hg in the right eye and 11.3±3.1 mm Hg in the left eye (P>0.05). There was a statistically significant difference between IMA-s levels before the IOP increase (IMA-s0) and IMA-s levels on the 1^st and 3^rd days after the increase in IOP (P=0.012 and P=0.01, respectively). No difference was observed between IMA-s0 and serum IMA levels on the 10^thday (IMA-s10) after IOP increase (P=0.989). IMA-HA in the right eye in the first day after the injection was positively correlated with IOP (r=0.748; P=0.02). No other correlation is found between any other parameter with IMA-HA levels at any test time. A statistically significant positive correlation was observed between IMA-s values and IOP on the 1^st and 3^rd days (r=0.398, P=0.04 and r=0.382, P=0.04, respectively). There was no correlation between IMA-s levels and increased IOP on the 10^th day after IOP increase (r=0.026, P=0.902).CONCLUSION: IMA may be an important indicator of acute damage caused by diseases involving ischemic damage to the eye, especially in case of increased intraocular pressure.

Association of apolipoprotein E-219T>G promoter polymorphism with primary open angle glaucoma in Turkish population

Emel Saglar,Banu Bozkurt and Murat Irkec — 2014/6/24 0:00:00
AIM: To investigate the association between apolipoprotein E (APOE) -219 T>G promoter polymorphism and primary open angle glaucoma (POAG).METHODS: Patients and healthy subjects were genotyped with polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP). Genotype/allele frequencies were compared between 122 healthy subjects and in 75 POAG patients using Chi-square test.RESULTS:Although the frequency of APOE -219 GG genotype was higher in POAG group (13.3%) than in control group (6.6%), this finding was not statistically significant (P=0.09). In glaucoma patients carrying GG genotype, mean linear C/D ratio was higher and progression was more compared to glaucoma patients with GT genotype.CONCLUSION: APOE -219 T>G polymorphism does not seem to be a risk factor for the presence of glaucoma, but might play a role in deterioration of the disease, which needs further evaluation.

Toxoplasma gondii infection can induce retinal DNA damage:an experimental study

Nagwa Mostafa El-Sayed and Eman Mohamed Aly — 2014/6/24 0:00:00
AIM: To detect whether Toxoplasma gondii (T. gondii) infection of mice can induce retinal DNA damage.METHODS: A total of 20 laboratory-bred male Swiss albino mice were used and divided into four groups:control group (non-infected animals); T. gondiiinfected group; immunosuppressed infected group; and infected#$NLgroup treated with sulfadiazine and pyrimethamine. Mice eyes were collected 6wk post infection and retinas were obtained. Each retina was immediately processed for comet assay and the frequency of tailed nuclei (DNA damage) was calculated. In addition, retinal DNA damage was revealed by various comet assay parameters that were provided by the image analysis software including tail length, percentage of DNA in the tail, percentage of tailed cells and tail moment.RESULTS: The obtained results showed that T. gondii infectioninduced a statistically significant increase in the frequency of tailed nuclei, tail length, percentage of DNA in the tail, and tail moment in mice retinal cells compared to the control group (which showed some degree of DNA damage). In immunosuppressed infected group, retinal DNA damage was severing and there wassignificant increase in various comet assay parameters compared to both control and infected groups. After treatment with sulfadiazine and pyrimethamine, retinal DNA damage decreased and all comet assay parameters showed a statistical significant decrease compared to infected groups.CONCLUSION: T. gondii infectioncan induce DNA damage in mice retinal cells.

Experimental histopathological study on retinal and renal cellular response to intravitreous antiangiogenic drugs

2014/6/24 0:00:00
AIM:To evaluate histopathological retinal and renal response after one single dose of intravitreous injection of antiangiogenic drugs ranibizumab and bevacizumab in rats.METHODS:Experimental study in 60d of life adults Wistar rats. Ten animals were included. Group 1 included 5 animals that were injected with 1 μL ranibizumab 1.25 mg in the right eye and with 1 μL of balanced salt solution (BSS) in the left eye, as control; Group 2 included 5 animals that were injected with 1 μL of bevacizumab in the right eye and with 1 μL of BSS in the fellow eye. All injections were performed with Hamilton syringes. After 15d of the interventions, all animals were sacrificed in CO2 chamber. Both eyes were enucleated and one kidney was removed, fixed and embedded in paraffin for histopathological analysis by optic microscopy. For statistical purposes the initial expected abnormal histopathological responses were defined as 0%.RESULTS:Atypicalhistopathological retinal response was detected in 2 eyes injected with ranibizumab (40%) as well as in 2 control eyes in group 1. Same was detected in 1 eye injected with bevacizumab (20%) as well as in 1 control eye, in group 2. The noted atypical findings were lymphocytes and eosinophils in the vitreous posterior cavity and mild retinal inflammatory reaction with ganglion cell layer edema but without clinical significance. No atypical histopathological renal response was detected.CONCLUSION:Unexpected atypical histopathological retinal response without clinical significance was observed in 3 eyes injected with antiangiogenic drugs (2 in group 1 and 1 in group 2) as well as in 3 control eyes (2 in group 1 and 1 in group 2). No atypical renal response was detected suggesting no extra ocular involvement of the intravitreous injected antiangiogenic drugs.

Serum amyloid A and pairing formyl peptide receptor 2 are expressed in corneas and involved in inflammation-mediated neovascularization

Sheng-Wei Ren,Xia Qi,Chang-Kai Jia and Yi-Qiang Wang — 2014/4/23 0:00:00
AIM:To solidify the involvement of Saa-related pathway in corneal neovascularization (CorNV). The pathogenesis of inflammatory CorNV is not fully understood yet, and our previous study implicated that serum amyloid A (Saa) 1 (Saa1) and Saa3 were among the genes up-regulated upon CorNV induction in mice.METHODS:Microarray data obtained during our profiling project on CorNV were analyzed for the genes encoding the four SAA family members (Saa1-4), six reported SAA receptors (formyl peptide receptor 2, Tlr2, Tlr4, Cd36, Scarb1, P2rx7) and seven matrix metallopeptidases (Mmp) 1a, 1b, 2, 3, 9, 10, 13 reportedly to be expressed upon SAA pathway activation. The baseline expression or changes of interested genes were further confirmed in animals with CorNV using molecular or histological methods. CorNV was induced in Balb/c and C57BL/6 mice by placing either three interrupted 10-0 sutures or a 2 mm filter paper soaked with sodium hydroxide in the central area of the cornea. At desired time points, the corneas were harvested for histology examination or for extraction of mRNA and protein. The mRNA levels of Saa1, Saa3, Fpr2, Mmp2 and Mmp3 in corneas were detected using quantitative reverse transcription-PCR, and SAA3 protein in tissues detected using immunohistochemistry or western blotting.RESULTS:Microarray data analysis revealed that Saa1, Saa3, Fpr2, Mmp2, Mmp3 messengers were readily detected in normal corneas and significantly up-regulated upon CorNV induction. The changes of these five genes were confirmed with real-time PCR assay. On the contrary, other SAA members (Saa2, Saa4), other SAA receptors (Tlr2, Tlr4, Cd36, P2rx7, etc), or other Mmps (Mmp1a, Mmp1b, Mmp9, Mmp10, Mmp13) did not show consistent changes. Immunohistochemistry study and western blotting further confirmed the expression of SAA3 products in normal corneas as well as their up-regulation in corneas with CorNV.CONCLUSION:SAA-FPR2 pathway composing genes were expressed in normal murine corneas and, upon inflammatory stimuli challenge to the corneas, their expressions were up-regulated, suggesting their roles in pathogenesis of CorNV. The potential usefulness of SAA-FPR2 targets in future management of CorNV-related diseases deserves investigation.

Interleukin-6 receptor blockade suppresses subretinal fibrosis in a mouse model

Wei Cui,Han Zhang and Zhe-Li Liu — 2014/4/23 0:00:00
AIM:To determine the involvement of the interleukin (IL)-6 with the development of experimental subretinal fibrosis in a mouse model.METHODS:Subretinal fibrosis was induced by subretinal injection of macrophage-rich peritoneal exudate cells and the local expression of IL-6 was assessed by quantitative real-time reverse transcription-polymerase chain reaction (RT-PCR) and enzyme-linked immunosorbent assay (ELISA) at various time points. In addition, we investigated the effect of IL-6 receptor (IL-6R) monoclonal antibody (MR16-1) on subretinal fibrosis development.RESULTS:IL-6 mRNA level was significantly elevated at 1d after subretinal fibrosis induction and increased further to about 12-fold at 2d, reaching the peak. The result of ELISA showed that IL-6 protein was not detected in naive mice. At 2d after subretinal fibrosis induction, IL-6 protein level was upregulated to 67.33±14.96 pg/mg in subretinal fibrosis mice. MR16-1 treatment resulted in a reduced subretinal fibrosis area by 48% compared to animals from control group at 7d.CONCLUSION:Our results indicated that IL-6 signaling may contribute to the pathogenesis of subretinal fibrogenesis and IL-6R inhibition may provide an effective, novel treatment of advanced and late-stage neovascular age-related macular degeneration.

Inhibition of retinopathy of prematurity in rat by intravitreal injection of sorafenib

2014/4/23 0:00:00
AIM:To investigate the effect of intravitreal injection administered sorafenib, a multikinase inhibitor, in a rat model of oxygen-induced retinopathy (OIR).METHODS:Seven-day-old Sprague-Dawley rats (n=144) were randomly assigned to six groups. Group A received normal partial oxygen pressure and groups B, C, D, E and F were exposed to hyperoxia (75±2)% from postnatal 7d (P7) to P12 to induce retinopathy of prematurity. The rats in groups C, D, E and F were received intravitreal injections of either vehicle (DMSO) or sorafenib at P12 (5, 20 and 80 μg, respectively). Then they returned to normoxia after P12. The retinas were whole-mounted and imaged with a confocal microscopy. The vascular branching points were counted to quantify neovascularization at P17. Cross-sections of the retina were stained with hematoxylin and eosin (HE). The nuclei of new vessels breaking the internal limiting membrane were counted to quantify the proliferative neovascular response.RESULTS:The retinal vessel in groups B and C turned into tortuosity and a great deal of neovascularization were observed. Sorafenib-treated rats had significantly less neovascularization as compared with vehicle-treated and control rats in a dose dependent manner (P<0.05). The number of vascular branching points in A, B, C, D, E and F were 16.50±3.90, 37.44±6.47, 37.08±5.10, 30.80±6.85, 26.08±5.08 and 19.83±3.51, respectively. The number of the nuclei of retinal new vessel in A, B, C, D, E and F were 0.22±0.42, 35.66±4.70, 35.30±4.54, 27.30±4.28, 21.41±3.53, and 7.41±2.87, respectively. There were significant difference between each group (P＜0.05) except groups B and C.CONCLUSION: In the rat OIR model, sorafenib could inhibit retinal neovascularization in a dose dependent manner.

Evaluation of the in vitro antimicrobial properties of ultraviolet A/riboflavin mediated crosslinking on Candida albicans and Fusarium solani

Bing Sun,Zhi-Wei Li,Hai-Qun Yu,Xiang-Chen Tao,Yong Zhang and Guo-Ying Mu — 2014/4/23 0:00:00
AIM:To evaluate the antimicrobial properties of ultraviolet A (UVA) (365 nm)/riboflavin against Candida albicans and Fusarium solani.METHODS:Two fungus isolates were cultured in vitro and prepared with 10-fold serial PBS dilutions of cell concentration. For each dilution of fungus suspension, the concentration (colony-forming units/mL, CFU/mL) and the inactivation ratio of fungal cells were evaluated under 4 conditions:no treatment (control), UVA (365 nm)/riboflavin, riboflavin, and UVA (365 nm).RESULTS:The cell concentration decreased in UVA (365 nm)/riboflavin group for Candida albicans at each dilution and Fusarium solani at dilutions of 10⁴, 10³, 10² CFU/mL, when compared with that in control, riboflavin, and UVA (365 nm) groups (P<0.01). No difference of cell concentration was detected amongst the culture of control, riboflavin, and UVA (365 nm) groups for the two fungus. There is a negative correlation between suspension concentration (log-transformed) and the inactivation ratio in UVA (365 nm)/riboflavin group for Candida albicans and Fusarium solani (P<0.01).CONCLUSION: According to the standard protocol of corneal collagen cross-linking, UVA (365 nm)/riboflavin combination treatment is found to moderately inactivate the viability of Candida albicans and Fusarium solaniin vitro. The inactivation ratio was found to increase with the decrease of cell concentration under UVA (365 nm)/riboflavin condition.

Keratinocyte growth factor-2 and autologous serum potentiate the regenerative effect of mesenchymal stem cells in cornea damage in rats

2014/4/23 0:00:00
AIM:To investigate the healing process after severe corneal epithelial damage in rats treated with mesenchymal stem cells (MSCs) cultured with or without keratinocyte growth factor (KGF-2) and autologous serum (AS) on amniotic membrane (AM). Many patients are blind and devastated by severe ocular surface diseases due to limbal stem cell deficiency. Bone marrow-derived MSCs are potential sources for cell-based tissue engineering to repair or replace the corneal tissue, having the potential to differentiate to epithelial cells.METHODS:The study included 5 groups each including 10 female “Sprague Dawley” rats in addition to 20 male rats used as bone marrow donors. Group I rats received AM+MSCs, Group II rats AM+MSCs cultured with KGF-2, Group III rats AM+MSCs cultured with KGF-2+AS, Group IV rats only AM and Group V rats, none. AS was derived from blood drawn from male rats and bone marrow was obtained from the femur and tibia bones of the same animals. Therapeutic effect was evaluated with clinical, histopathological and immunohistochemical assessment. MSC engraftment was demonstrated via detection of donor genotype (Y+) in the recipient tissue (X) with polymerase chain reaction.RESULTS:Corneal healing was significantly better in Groups I-III rats treated with MSC transplantation compared to Group IV and Group V rats with supportive treatment only. The best results were obtained in Group III rats with 90% transparency, 70% lack of neovascularization, and 100% epithelium damage limited to less than 1/4 of cornea.CONCLUSION: We suggest that culture of MSCs with KGF-2 and AS on AM is effective in corneal repair in case of irreversible damage to limbal stem cells.

Inhibitory effects of regorafenib, a multiple tyrosine kinase inhibitor, on corneal neovascularization

2014/4/23 0:00:00
AIM:To evaluate the inhibitory effects of regorafenib (BAY 73-4506), a multikinase inhibitor, on corneal neovascularization (NV).METHODS:Thirty adult male Sprague-Dawley rats weighing 250-300 g, were used. Corneal NV was induced by NaOH in the left eyes of each rat. Following the establishment of alkali burn, the animals were randomized into five groups according to topical treatment. Group 1 (n = 6) received 0.9% NaCl, Group 2 (n = 6) received dimethyl sulfoxide, Group 3 (n = 6) received regorafenib 1 mg/mL, Group 4 (n =6) received bevacizumab 5 mg/mL and Group 5 (n = 6) received 0.1% dexamethasone phosphate. On the 7d, the corneal surface covered with neovascular vessels was measured on photographs as the percentage of the cornea’s total area using computer-imaging analysis. The corneas obtained from rats were semiquantitatively evaluated for caspase-3 and vascular endothelial growth factor by immunostaining.RESULTS:A statistically significant difference in the percent area of corneal NV was found among the groups (P <0.001). Although the Group 5 had the smallest percent area of corneal NV, there was no difference among Groups 3, 4 and 5 (P >0.005). There was a statistically significant difference among the groups in apoptotic cell density (P = 0.002). The staining intensity of vascular endothelial growth factor in the epithelial and endothelial layers of cornea was significantly different among the groups (P <0.05). The staining intensity of epithelial and endothelial vascular endothelial growth factor was significantly weaker in Groups 3, 4 and 5 than in Groups 1 and 2.CONCLUSION: Topical administration of regorafenib 1 mg/mL is partly effective for preventing alkali-induced corneal NV in rats.

Effects of Honghua preserved amniotic membrane on scar healing in experimental glaucoma surgery

2014/4/23 0:00:00
AIM: To investigate the efficacy and safety of Honghua preserved amniotic membrane (AM) for preventing scar formation of the filtering bleb in a rabbit model of glaucoma trabeculectomy surgery.METHODS: Totally 36 rabbits (36 eyes) were randomly divided into 3 groups:the experimental group (ocular trabeculectomy in combination with Honghua preserved AM transplantation), the control group (ocular trabeculectomy surgery in combination with AM implantation), and the blank group (single trabeculectomy). Clinical observations [including intraocular pressure (IOP), filtering blebs and complications], Masson-Trichrome staining, real-time quantitative reverse transcription-polymerase chain reaction (real-time PCR), Western blot were performed on different time points (D1, D7, D14, D21 and D56) after the surgery.RESULTS: After operated for 14d, there were statistically significant differences in the filtering blebs compared to the situation before operation (P<0.05), whereas no statistically difference on that among three groups (P>0.05). After 21d, the IOP of experimental group was lowest (P<0.05). There was significant difference between control group and blank group (P<0.05). On postoperative D14, the mean number of fibroblasts in the experimental group was significantly lower (40.6±10.2) compared to those in the control group (54.4±10.8) and blank group (68.2±11.6) (P<0.05, respectively). The mean numbers of the macrophage in the experimental and control groups were respcitively significantly lower versus the blank group (P<0.05, P<0.05, respectively). Compared to that in blank group, the level of transforming growth factor-β (TGF-β1) expression in sclera and conjunctival areas was reduced in the experimental and control groups on protein and mRNA level (P<0.05), but not significant difference between these two groups (P>0.05).CONCLUSION:The trabeculectory surgery with Honghua preserved AM can control IOP, sustain the functional filtration bleb, inhibit the proliferation of fibroblasts and open the filtrating pathway on the rabbit glaucoma models.

Establishing an experimental rat model of photodynamically-induced retinal vein occlusion using erythrosin B

Wei Chen,Ying Wu,Mi Zheng,Qing Gu,Zhi Zheng and Xin Xia — 2014/4/23 0:00:00
AIM:To develop a reliable, reproducible rat model of retinal vein occlusion (RVO) with a novel photosensitizer (erythrosin B) and study the cellular responses in the retina.METHODS:Central and branch RVOs were created in adult male rats via photochemically-induced ischemia. Retinal changes were monitored via color fundus photography and fluorescein angiography at 1 and 3h, and 1, 4, 7, 14, and 21d after irradiation. Tissue slices were evaluated histopathologically. Retinal ganglion cell survival at different times after RVO induction was quantified by nuclear density count. Retinal thickness was also observed.RESULTS:For all rats in both the central and branch RVO groups, blood flow ceased immediately after laser irradiation and retinal edema was evident at one hour. The retinal detachment rate was 100% at 3h and developed into bullous retinal detachment within 24h. Retinal hemorrhages were not observed until 24h. Clearance of the occluded veins at 7d was observed by fluorescein angiography. Disease manifestation in the central RVO eyes was more severe than in the branch RVO group. A remarkable reduction in the ganglion cell count and retinal thickness was observed in the central RVO group by 21d, whereas moderate changes occurred in the branch RVO group.CONCLUSION: Rat RVO created by photochemically-induced ischemia using erythrosin B is a reproducible and reliable animal model for mimicking the key features of human RVO. However, considering the 100% rate of retinal detachment, this animal model is more suitable for studying RVO with chronic retinal detachment.

Effects of hepatocyte growth factor on MMP-2 expression in scleral fibroblasts from a guinea pig myopia model

Xiu-Juan Li,Xiao-Peng Yang,Guang-Ming Wan,Yu-Ying Wang and Jin-Song Zhang — 2014/4/23 0:00:00
AIM:To investigate the effects of hepatocyte growth factor (HGF) on MMP-2 expression in scleral fibroblasts from guinea pig with LIM.METHODS:Sixty 1-week-old guinea pigs were chosen for the study. The right eyes were treated with -10.0 D lenses as the LIM group; the left eyes remained untreated as the control group. The refraction and axial length were measured by streak retinoscopy and A-scan ultrasonography respectively prior to and 4 weeks after the experiment. Four weeks later, the guinea pigs were sacrificed and primary scleral fibroblasts were taken for tissue culture. The 3^rd-5th generation scleral fibroblasts were chosen for the experiments. The expression levels of HGF and MMP-2 protein in the scleral fibroblasts were analyzed by Western blotting. After HGF with different doses acted on the scleral fibroblasts of the control group, MMP-2 protein expression in the scleral fibroblasts was analyzed by Western blotting. HGF siRNA was transfected into the scleral fibroblasts of the LIM group and the protein expressions of HGF and MMP-2 were analyzed by Western blotting.RESULTS:The LIM group became myopic with a significant increase in axial length (7.97±0.29 mm vs 7.01±0.26 mm, P<0.05), and a significant decrease in refraction (-5.06±0.31 D vs 0.55±0.25 D, P<0.05) compared with the control group. The protein expression of HGF in the scleral fibroblasts of the LIM group was significantly higher compared with the control group ( 1.26±0.04 vs 0.32 ±0.04, P<0.05). The protein expression of MMP-2 in the scleral fibroblasts of the LIM group was significantly higher compared with the control group (0.89±0.06 vs 0.42±0.05, P<0.05). In the scleral fibroblasts of the control group, HGF(0, 0.1, 1, 10 ng/mL) upregulated MMP-2 protein expression in a dose-dependent manner (0.35±0.03, 0.44±0.02, 0.91±0.03, 1.33±0.04, all P<0.05). In the scleral fibroblasts of the LIM group transfected with HGF siRNA, MMP-2 protein expressions were significantly decreased compared with the negative control group (0.29±0.03 vs 0.81±0.05, P<0.05).CONCLUSION:HGF is a upstream mediator of MMP-2 in scleral fibroblasts from guinea pig.

Comparison of form-deprived myopia and lens-induced myopia in guinea pigs

Hui Xiao,Zhong-Yi Fan,Xiao-Dan Tian and Yan-Chun Xu — 2014/4/23 0:00:00
AIM: To study the efficacy difference between form-deprived myopia (FDM) and lens-induced myopia (LIM), the degree of myopia, axial length and pathological changes of the posterior sclera from guinea pigs were evaluated.METHODS: Four-week pigmented guinea pigs were randomly assigned into 3 groups, including normal control (n=6), FDM group with monocular cover (n=11) and LIM group with monocular -7D lens treatment (n=11). FDM group was form-deprived while LIM group was lens-induced for 14 d. Refractive error and axial length were measured prior to and post treatment, respectively. Morphological changes of sclera were examined using both light and electronic microscopes.RESULTS: After 14d treatment, refractive errors for FDM group and LIM group were -3.05±0.71D and -2.12±1.29D, respectively, which were significantly more myopic than that of normal controls and fellow control eyes (P<0.01). As for axial length, it was 7.93±0.03 mm for FDM group and 7.89±0.06 mm for LIM group, which were significantly longer than both normal and fellow controls (P<0.01). With respect to both refractory error and axial length, the differences between FDM group and LIM group were not significant (P>0.05). Under light microscope, both FDM group and LIM group showed thinned sclera, disarrangement of fibrosis and enlarged disassociation between fibers. Consistently, ultrastructural examination showed degenerated fibroblasts and thinned fibers in posterior sclera.CONCLUSION:Following two weeks of myopia induction in guinea pigs, with regard to the degree of myopia, axial length and pathological alterations, there was no significant difference between FDM and LIM models. Therefore, FDM and LIM are equally effective and useful as a model of experimental myopia and guinea pigs are ideal animals for induction of experimental myopia because their high sensitivity to both form-deprivation and lens-induction.

Effect of intravitreal injection of bevacizumab-chitosan nanoparticles on retina of diabetic rats

Yan Lu,Nan Zhou,Xiao Huang,Jin-Wei Cheng,Feng-Qian Li,Rui-Li Wei and Ji-Ping Cai — 2014/2/20 0:00:00
AIM:To investigate the effects of intravitreal injection of bevacizumab-chitosan nanoparticles on pathological morphology of retina and the expression of vascular endothelial growth factor (VEGF) protein and VEGF mRNA in the retina of diabetic rats.METHODS: Seventy-two 3-month aged diabetic rats were randomly divided into 3 groups, each containing 24 animals and 48 eyes. Both eyes of the rats in group A were injected into the vitreous at the pars plana with 3μL of physiological saline, while in groups B and C were injected with 3μL (75μg) of bevacizumab and 3μL of bevacizumab-chitosan nanoparticles (containing 75μg of bevacizumab), respectively. Immunohistochemistry was used to assess retinal angiogenesis, real-time PCR assay was used to analyse the expression of VEGF mRNA, and light microscopy was used to evaluate the morphology of retinal capillaries.RESULTS:Real-time PCR assay revealed that the VEGF mRNA expression in the retina before injection was similar to 1 week after injection in group A (P>0.05), while theVEGF mRNA expression before injection significantly differed from those 4 and 8 weeks after injection (P<0.05). Retinal expression of VEGF protein and VEGF mRNA was inhibited 1 week and 4 weeks after injection (P<0.05) in group B, and the expression of VEGF protein and VEGF mRNA was obviously inhibited until 8 weeks after injection (P<0.05) in group C. Using multiple comparisons among group A, group B, and group C, the VEGF expression before injection was higher than at 1, 4 and 8 weeks after injection (P<0.05). The amount of VEGF expression was higher 8 weeks after injection than 1 week or 4 weeks after injection, and also higher 1 week after injection compared with 4 weeks after injection (P<0.05). No toxic effect on SD rats was observed with bevacizumab-chitosan nanoparticles injection alone.CONCLUSION: The results offer a new approach for inhibiting angiogenesis of diabetic retinopathy and indicate that the intravitreal injection of bevacizumab inhibits VEGF expression in retina, and bevacizumab-chitosan nanoparticles have a longer duration of action.

Effect of EGb761 on light-damaged retinal pigment epithelial cells

2014/2/20 0:00:00
AIM:To investigate the protective mechanism of Gingko Biloba extract (EGb761) on the ability of retinal pigment epithelial (RPE) cells to resist light-induced damage in a comparative proteomics study.METHODS:Human RPE cells (ARPE-19) were randomly distributed to one of three groups:normal control (NC group) and light-damaged model without or with EGb761 group (M and ME groups, respectively). The light-damaged model was formed by exposing to white light (2 200±300)lx for 6h. The RPE cells in ME group were conducted with EGb 761 (100μg/mL) before light exposure. The soluble cellular proteins extracting from each groups were separated by two-dimensional electrophoresis and stained by silver staining. Different proteins in the profiles of the gels were analyzed by Image Master Software. Two-fold expressing protein spots were identified by Matrix-assisted laser desorption/ionization tandem time-of-flight (MALDI-TOF/TOF) mass spectrometry.RESULTS: NC, M and ME groups displayed 1 892±71, 2 145±23 and 2 216±85 protein spots, respectively. We identified 33 proteins with different expression levels between the NC and M groups, 25 proteins between the M and ME groups, and 11 proteins between the NC and ME groups. MALDI-TOF/TOF mass spectrometry successfully identified 16 proteins, including metabolic enzymes, cytoskeletal proteins, anti-oxidation proteins, and others.CONCLUSION:Differences in some important proteins, such as cathepsin B, heat shock protein, and cytochrome creductase, indicated that multiple pathways may be induced in light-damaged RPE cells and the protective effect of EGb761.

Cytotoxic effects of betaxolol on healthy corneal endothelial cells both in vitro and in vivo

Ying Miao,Qian Sun,Qian Wen,Yue Qiu,Yuan Ge,Miao-Miao Yu and Ting-Jun Fan — 2014/2/20 0:00:00
AIM: To demonstrate the cytotoxic effect of betaxolol and its underlying mechanism on human corneal endothelial cells(HCE cells) in vitro and cat corneal endothelial cells(CCE cells) in vivo, providing experimental basis for safety anti-glaucoma drug usage in clinic of ophthalmology.METHODS: In vivo and in vitro experiments were conducted to explore whether and how betaxolol participates in corneal endothelial cell injury. The in vitro morphology, growth status, plasma membrane permeability, DNA fragmentation, and ultrastructure of HCE cells treated with 0.021875-0.28g/L betaxolol were examined by light microscope, 3-(4,5)-dimethylthiahiazo (-z-y1)-3,5-di-phenytetrazoliumromide (MTT) assay, acridine orange (AO)/ethidium bromide (EB) double-fluorescent staining, DNA agarose gel electrophoresis, and transmission electron microscope (TEM). The in vivo density, morphology, and ultrastructure of CCE cells, corneal thickness, and eye pressure of cat eyes treated with 0.28g/L betaxolol were investigated by specular microscopy, applanation tonometer, alizarin red staining, scanning electron microscope (SEM), and TEM.RESULTS: Exposure to betaxolol at doses from 0.0875g/L to 2.8g/L induced morphological and ultrastructural changes of in vitro cultured HCE cells such as cytoplasmic vacuolation, cellular shrinkage, structural disorganization, chromatin condensation, and apoptotic body appearance. Simultaneously, betaxolol elevated plasma membrane permeability and induced DNA fragmentation of these cells in a dose-dependent manner in AO/EB staining. Furthermore, betaxolol at a dose of 2.8g/L also induced decrease of density of CCE cells in vivo, and non-hexagonal and shrunk apoptotic cells were also found in betaxolol-treated cat corneal endothelia.CONCLUSION: Betaxolol has significant cytotoxicity on HCE cells in vitro by inducing apoptosis of these cells, and induced apoptosis of CCE cells in vivo as well. The findings help provide new insight into the apoptosis-inducing effect of anti-glaucoma drugs in eye clinic.

Promotion of minTBP-1-PRGDN on the attachment, proliferation and collagen I synthesis of human keratocyte on titanium

Xin-Yu Li,Cai-Ni Ji,Ling-Juan Xu,Wei-Kun Hu,Bin Zhou and Gui-Gang Li — 2014/2/20 0:00:00
AIM:To investigate the influence of minTBP-1-PRGDN on the attachment, proliferation and collagen I synthesis of human keratocyte on titanium (Ti) surface.METHODS:The chimeric peptide RKLPDAPRGDN (minTBP-1-PRGDN) was synthesized by connecting RKLPDA (minTBP-1) to the N-terminal of PRGDN , the influence of minTBP-1-PRGDN on the attachment, proliferation and collagen I synthesis of human keratocyte on Ti surface were tested using PRGDN and minTBP-1as controls. The keratocytes attached to the surface of Ti were either stained with FITC-labeled phalloidin and viewed with fluorescence microscope or quantified with alamar Blue method. The proliferation of keratocytes on Ti were quantified with 3-(4,5-dim- ethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide up-taking methods. The secretion of type I collagen were determined using an ELISA kit.RESULTS:The results showed that minTBP-1-PRGDN at a concentration of 100ng/mL was the most potent peptide to enhance the attachment of human keratocytes to the surface of Ti (1.40±0.03 folds, P=0.003), to promote the proliferation (1.26±0.05 folds, P=0.014) and the synthesis of type I collagen (1.530±0.128, P=0.008). MinTBP-1 at the same concentration could only promote the attachment (1.13±0.04 folds, P=0.020) and proliferation(1.15±0.06 folds, P=0.021), while PRGDN had no significant influence (P＞0.05).CONCLUSION:Our data shows that the novel chimeric peptide minTBP-1-PRGDN could promote the attachment, proliferation and type I collagen synthesis of human keratocytes on the surface of Ti.

Expression of IGFBP-6 in a proliferative vitreoretinopathy rat model and its effects on retinal pigment epithelial cell proliferation and migration

Hong-Mei Zhao,Min-Jie Sheng and Jing Yu — 2014/2/20 0:00:00
AIM: To investigate the expression of insulin-like growth factor binding protein-6 (IGFBP-6) in a proliferative vitreoretinopathy (PVR) model and its effects on proliferation and migration in retinal pigment epithelial (RPE) cells.METHODS: A PVR Wistar rat model was established by the intravitreal injection of RPE-J cells combined with platelet-rich plasma (PRP). The expression levels of IGFBP-6 were tested by ELISA. ARPE-19 cell proliferation was evaluated by the MTS method, and cell migration was evaluated by wound healing assays.RESULTS: The success rate of the PVR model was 89.3% (25/28). IGFBP-6 was expressed at higher levels in the vitreous, serum and retina of rats experiencing advanced PVR (grade 3) than in the control group (vitreous:152.80±15.08ng/mL vs 105.44±24.81ng/mL, P>0.05; serum:93.48±9.27ng/mL vs 80.59±5.20ng/mL, P<0.05; retina:3.02±0.38ng/mg vs 2.05±0.53ng/mg, P<0.05). In vitro, IGFBP-6 (500ng/mL) inhibited the IGF-II (50ng/mL) induced ARPE-19 cell proliferation (OD value at 24h:from 1.38±0.05 to 1.30±0.02; 48h:from 1.44±0.06 to 1.35±0.05). However, it did not affect basal or VEGF-, TGF-β- and PDGF-induced cell proliferation. IGFBP-6 (500ng/mL) reduced the IGF-II (50ng/mL)-induced would healing rate [24h:from (43.91±3.85)% to (29.76±2.49)%; 48 h:from (66.09±1.67)% to (59.88±3.43)%].CONCLUSION: Concentrations of IGFBP-6 increased in the vitreous, serum, and retinas only in advanced PVR in vivo. IGFBP-6 also inhibited IGF-II-induced cell proliferation in a not dose or time dependent manner and migration. IGFBP-6 participates in the development of PVR and might play a protective role in PVR.

Expression of dectin-1 during fungus infection in human corneal epithelial cells

2014/2/20 0:00:00
AIM:To evaluate the expression of dendritic cell-associated C-type lectin-1 (dectin-1) in human corneal epithelial (HCE) cells infected by fungus.METHODS:A total of 20 cases of healthy donor corneas were group A, and 20 patients (20 eyes) suffered from fungal keratitis (FK) composed group B. Real-time qPCR and immunohistochemistry were applied to detect dectin-1 expression in corneal epithelium of both groups. HCE cells were cultured with aspergillus fumigatus (AF) antigens in vitro. The expression of dectin-1 mRNA was measured by real-time qPCR at the stimulation of 0, 4, 8 and 24h separately. Dectin-1 protein was detected by immunocytochemistry at 0 and 24h separately.RESULTS: Dectin-1 expressed in corneal epithelium of normal persons and FK patients. Vitro cellular experiment showed that the expression of dectin-1 mRNA in HCE cells began to increase after stimulation of AF antigens at 4h, and dectin-1 protein expression increased after stimulation at 24h.CONCLUSION: Dectin-1 expressed in corneal epithelium of normal persons. AF antigens stimulation can elevate the expression of dectin-1 in HCE cells in vitro.

Mitochondrial proteomic analysis of ecdysterone protection against oxidative damage in human lens epithelial cells

2014/2/20 0:00:00
AIM:To investigate the protective effects of the natural medicinal monomer ecdysterone (ECR) with estrogenic activity against oxidative damage in human lens epithelial cells B3 (HLE-B3) caused by hydrogen peroxide 21(H2O2) and to pursue the possible mitochondrial proteomic regularity of the protective effects.METHODS: HLE-B3 cells were treated with H2O2 (300μmol/L), β-estuarial (E2; 10^-8mol/L) and H2O2, ECR (10^-6mol/L) and H2O2, or left untreated. Altered expression of all mitochondrial proteins was analyzed by protein array and surface-enhanced laser desorption ionization time of flight mass spectrometry (SELDI-TOF-MS). The mass/charge (M/Z) ratios of each peak were tested by the Kruskal-Wallis rank sum test, and the protein peak value of the M/Z ratio for each treatment by pair comparison was analyzed with the Nemenyi test.RESULTS: H2O2 up-regulated expression of two protein spots (with M/Z of 6 532 and 6 809). When E2 mitigated the oxidative damage, the expression of one protein spot (M/Z 6 532) was down-regulated. In contrast, ECR down-regulated both of protein spots (M/Z 6 532 and 6 809).CONCLUSION: ECR could effectively inhibite H2O2 induced oxidative damage in HLE-B3 cells. The protein spot at M/Z of 6 532 might be the target spot of ECR against oxidative damage induced by H2O2.

Anticipation, anti-glaucoma drug treatment response and phenotype of a Chinese family with glaucoma caused by the Pro370Leu myocilin mutation

2014/2/19 0:00:00
AIM:To describe the anticipation and anti-glaucoma drugs response of a Chinese family with juvenile-onset open angle glaucoma (JOAG) caused by the Pro370Leu myocilin (MYOC) mutation.METHODS: Fifteen members of a three-generation Chinese family with JOAG were recruited to this study. They all underwent ophthalmic common examinations. Patients suspected to have JOAG got an assessment of visual field and optical coherence tomography. Intraocular pressures (IOPs) of four patients were measured at 8, 10, 12, 14, 17 o’clock respectively after using anti-glaucoma drugs. Mutation screening of all MYOC gene coding exons of the participants was performed by using direct sequencing of PCR products.RESULTS: Clinical examinations and pedigree analysis revealed eight family members were suffered from JOAG. Apparent genetics anticipation phenomenon was observed in this family. Their clinical features included elevated IOP of 35-55mmHg, loss of visual field, thinning of retinal nerve fiber layer, and glaucomatous optic disc damage. Noticeably, their intraocular pressure levels could be controlled within normal range at 8 and 10 o’clock by anti-glaucoma drugs,but their IOPs would elevate >21mmHg after 12 o’clock. Seven patients received trabeculectomy produced thin-walled, pale, and saccate filtering blebs maintaining lower intraocular pressure efficiently. Mutation screening indentified a heterozygous C→T missense mutation in the MYOC gene at position 1 109 in exon 3, corresponding to a substitution of a highly conserved proline to leucine at codon 370 in the olfactomedin domain of MYOC.CONCLUSION: The clinical characteristics of JOAG in this family were 1) genetics anticipation; 2) high IOP; 3) temporay response to anti-glaucoma drugs; 4) filtering surgery produced thin-walled and saccate filtering blebs, helping maintain lower IOP.

5-Aza-2’-deoxycytidine inhibits retinoblastoma cell by reactivating epigenetically silenced RASSF1A gene

Ru Liu,Xiao-Huan Zhang,Kun Zhang,Wei Li,Wen-Jun Wang,Di-Xian Luo and Ling Gao — 2014/2/20 0:00:00
AIM:To investigate the effect of 5-Aza-2’-deoxycytidine (5-Aza-CdR), a DNA methyltransferase (DNMT) inhibitor, on the growth and survival of the Chinese retinoblastoma (RB) cell line HXO-RB44.METHODS:The DNA methylation status of the Ras association domain family (RASSF1A) promoter in the presence of 5-Aza-CdR at different concentrations was analyzed by methylation-specific polymerase chain reaction (MSP). RASSF1A mRNA and protein levels were measured by semiquantitative RT-PCR and immunohistochemistry staining, respectively, when cells were treated with 5.0μmol/L of 5-Aza-CdR. The effect of 5.0μmol/L 5-Aza-CdR on the proliferation and viability of HXO-RB44 cells was examined using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay and flow cytometry.RESULTS:5-Aza-CdR efficiently induced cell cycle arrest at G0/G1 and apoptotic death in HXO-RB44 cells. MSP analysis showed that unmethylated RASSF1A DNA increased and methylated RASSF1A decreased in a dose-dependent manner in a range of 0.5-5.0μmol/L 5-Aza-CdR. Accordingly, RASSF1A expression was reactivated at both mRNA and protein levels. Incubation time of 5-Aza-CdR treatment also functioned as a factor for the demethylation status of RASSF1A promoter DNA, with a plateau on day four. 5-Aza-CdR at 5.0μmol/L completely demethylated the RASSF1A promoter in HXO-RB44 cells on day four, and as a result, RASSF1A expression increased significantly from day 4 to day 7.CONCLUSION: 5-Aza-CdR inhibits the growth of the HXO-RB44 RB cell line and induces apoptosis by demethylating the RASSF1A gene.

Comparison of the effect of intravitreal bevacizumab and intravitreal fasudil on retinal VEGF, TNFα, and caspase 3 levels in an experimental diabetes model

2014/2/20 0:00:00
AIM: To evaluate the influence of an intravitreal injection of bevacizumab and fasudil on the retinal vascular endothelial growth factor (VEGF), tumor necrosis factor alpha (TNFα), and caspase 3 levels in a diabetic rabbit model.RESULTS: There was a statistically significant difference in the VEGF and caspase 3 levels between groups (P=0.005 and P =0.013, respectively), but the TNFα level did not differ significantly between groups (P=0.792). It was found that VEGF levels were significantly lower in Group 1 and Group 3 than in Group 2 using the Mann-Whitney U test with the Bonferroni correction (P=0.004 for both comparison). There was no statistically significant difference between other groups with regard to VEGF levels (the P value ranged between 0.015 and 0.886). Although the P values of the caspase 3 levels were 0.015 for Group 1 and Group 4, 0.038 for Group 2 and Group 3, and 0.018 for Group 3 and Group 4, these P values remained above the threshold P value of 0.0083, which was the statistically significant level for post hoc tests.CONCLUSION: An intravitreal injection of bevacizumab decreased both the VEGF level, which plays a role in angiogenesis, and the caspase 3 level, which plays a role in apoptosis. Although not as effective as bevacizumab, fasudil had a beneficial effect on the VEGF levels but significantly increased the caspase 3 levels.

Anti-apoptosis effects of vascular endothelial cadherin in experimental corneal neovascularization

Gao-Qin Liu,Hong-Ya Wu,Jing Xu,Meng-Jiao Wang,Pei-Rong Lu and Xue-Guang Zhang — 2015/11/12 0:00:00
AIM: To explore the effects and mechanism of vascular endothelial cadherin (VE-cadherin) on experimental corneal neovascularization (CRNV). METHODS: Mouse corneas were burned with sodium hydroxide to build a CRNV model. The burned corneas were locally administrated with anti-mouse VE-cadherin neutralizing antibody. Annexin V and cluster of differentiation 31 (CD31) double staining was used to measure vascular endothelial cell apoptosis with the use of flow cytometry (FCM). The protein expression of NADPH oxidase 2 (Nox2), caspase-3, and protein kinase C (PKC) in the burned corneas were examined by Western blot. Human retinal endothelial cell (HREC) proliferation was detected using a Cell Counting Kit 8 (CCK-8) assay in vitro. RESULTS: The amount of CRNV peaked two weeks after the alkali burn. FCM confirmed that VE-cadherin neutralizing antibody treatment increased CD31 positive cell apoptosis. Western blot revealed that the intracorneal protein expression of Nox2 and caspase-3 were up-regulated, while PKC was down-regulated in the VE-cadherin neutralizing antibody administrated group. CCK-8 assay showed that VE-cadherin neutralizing antibody markedly inhibited HREC proliferation. CONCLUSION: VE-cadherin exhibited an anti-apoptosis effect through enhanced PKC signaling and an enhanced cell proliferation pathway.

Influence of transient intraocular pressure elevation during laser in situ keratomileusis on rabbit retina thickness

Hai-Xia Zhao,Hui Liu,Chun-Mei Niu and Wen-Ying Guan — 2015/11/12 0:00:00
AIM: To utilize tissue micro measurement to study the effect of transient high intraocular pressure (IOP) induced by different durations of suction during laser in situ keratomileusis (LASIK) on rabbit retina thickness. METHODS: Sixty healthy New Zealand white rabbits were randomly divided into a control group, and 3 negative-pressure suction groups (20s group, 45s group, and 3min group) and each group was comprised of 15 rabbits (30 eyes); the latter 3 groups were the transient high IOP models. The retinal tissue around the papilledema was separated. Hematoxylin and eosin (HE) staining was carried out to generate slices for light microscopy. The changes in the retina thickness values of each layer were measured for all animals in each group at different postoperative recovery periods and compared with the values recorded for the animals in the control group. The thickness of the retinal tissue showed a normal distribution. The ANOVA was performed by using SPSS13.0 statistic software. RESULTS: In the comparison between the 20s and 45s negative-pressure suction groups and the control group, no significant differences were observed, except at 14d. Significant difference was observed between the 3min negative-pressure suction group and the control group, and the retina thickness value of each layer reached a peak at 14d after repair. CONCLUSION: Conventional negative suction during LASIK may not lead to significant changes in retinal tissue thickness; however, if the suction duration is increased to 3min, it will cause significant changes in retinal tissue thickness.

Danhong Huayu Koufuye combined with metformin attenuated diabetic retinopathy in Zucker diabetic fatty rats

2015/11/12 0:00:00
AIM: To evaluate effects of Danhong Huayu Koufuye (DHK, a Chinese medicinal formulae) alone or combined with metformin on diabetic retinopathy (DR) in Zucker diabetic fatty (ZDF) rats, an animal model of obese type-2 diabetes, and then to investigate the mechanisms. METHODS: ZDF (fa/fa) rats were administered with vehicle (distilled water), metformin, DHK, and DHK plus metformin. Electrophysiological and histological analysis were applied to evaluated effects of DHK alone or combined with metformin on DR. The levels of fasting blood glucose (FBG) and glycosylated hemoglobin (HbA1c) in blood were measured to evaluate the antihyperglycemic activity of DHK. Furthermore, levels of nitric oxide (NO), malondialdehyde (MDA) and activities of superoxide dismutase (SOD), glutathione peroxidase (GSH-Px) in serum were measured to study effects of DHK on oxidative stress in ZDF rats. In addition, body weight, lipidic indexes and insulin level were also assessed. RESULTS: DHK combined with metformin significantly reversed the prolongation of latency times of flash electroretinogram (FERG) and oscillatory potentials (OPs) in diabetic rats. Furthermore, DHK alone or combined with metformin showed a remarkable suppression of retinal neovascularization and amelioration of retinal internal limiting membrane morphology. Moreover, DHK alone or plus metformin reduced FBG (P<0.05), HbA1c (P<0.01) and MDA (P<0.01) levels in diabetic rats. In addition, reductions in levels of triglycerides (TG) (P<0.01) and low density lipoprotein cholesterol (LDL-c) (P<0.01 and P<0.05, respectively) were also observed in diabetic rats treated with DHK alone or plus metformin. CONCLUSION: DHK in combination with metformin had a preventive and therapeutic effect on DR in type-2 diabetic rats, and the possible mechanisms may be alleviating hyperglycemia, reducing oxidative stress and improving lipid metabolism.

Extraction (DSX) from Erigeron breviscapus modulates outward potassium currents in rat retinal ganglion cells

Shuo Yin,Zhong-Feng Wang,Jun-Guo Duan,Lu Ji and Xue-Jing Lu — 2015/11/12 0:00:00
AIM: To investigate the effect of DSX, an active component extracted from Erigeron breviscapus, on the voltage-gated outward K+ channel currents in rat retinal ganglion cells (RGCs) by using electrophysiological method, and to explore the possible mechanisms of DSX on optic nerve protection. METHODS: Outward K+ currents were recorded by using whole-cell patch-clamp techniques on acutely isolated rat RGCs. Outward K+ currents were induced by a series of depolarizing voltage pulses from a holding potential of -70 mV to +20 mV in an increment of 10 mV. RESULTS: Extracellular application of DSX voltage-dependently suppressed both the steady-state and peak current amplitudes of outward K+ currents in rat RGCs. Furthermore, DSX reversibly and dose-dependently inhibited the amplitudes of outward K+ currents of the cells. At +20 mV membrane potential DSX at the concentrations of 0.02 g/L and 0.05 g/L showed no significant effects on the currents. In contrast, DSX at higher concentrations (0.1 g/L, 0.2 g/L and 0.5 g/L) significantly suppressed the current amplitudes. CONCLUSION: These results suggest that DSX reversibly and dose-dependently suppress outward K+ channel currents in rat RGCs, which may be one of the possible mechanisms underlying Erigeron breviscapus prevents vision loss and RGC damage caused by glaucoma.

Frequency spectrum might act as communication code between retina and visual cortex I

Xu Yang,Bo Gong and Jian-Wei Lu — 2015/11/12 0:00:00
AIM: To explore changes and possible communication relationship of local potential signals recorded simultaneously from retina and visual cortex I (V1). METHODS: Fourteen C57BL/6J mice were measured with pattern electroretinogram (PERG) and pattern visually evoked potential (PVEP) and fast Fourier transform has been used to analyze the frequency components of those signals. RESULTS: The amplitude of PERG and PVEP was measured at about 36.7 µV and 112.5 µV respectively and the dominant frequency of PERG and PVEP, however, stay unchanged and both signals do not have second, or otherwise, harmonic generation. CONCLUSION: The results suggested that retina encodes visual information in the way of frequency spectrum and then transfers it to primary visual cortex. The primary visual cortex accepts and deciphers the input visual information coded from retina. Frequency spectrum may act as communication code between retina and V1.

A novel CRX mutation by whole-exome sequencing in an autosomal dominant cone-rod dystrophy pedigree

2015/11/12 0:00:00
AIM: To identify the disease-causing gene mutation in a Chinese pedigree with autosomal dominant cone-rod dystrophy (adCORD). METHODS: A southern Chinese adCORD pedigree including 9 affected individuals was studied. Whole-exome sequencing (WES), coupling the Agilent whole-exome capture system to the Illumina HiSeq 2000 DNA sequencing platform was used to search the specific gene mutation in 3 affected family members and 1 unaffected member. After a suggested variant was found through the data analysis, the putative mutation was validated by Sanger DNA sequencing of samples from all available family members. RESULTS: The results of both WES and Sanger sequencing revealed a novel nonsense mutation c.C766T (p.Q256X) within exon 5 of CRX gene which was pathogenic for adCORD in this family. The mutation could affect photoreceptor-specific gene expression with a dominant-negative effect and resulted in loss of the OTX tail, thus the mutant protein occupies the CRX-binding site in target promoters without establishing an interaction and, consequently, may block transactivation. CONCLUSION: All modes of Mendelian inheritance in CORD have been observed, and genetic heterogeneity is a hallmark of CORD. Therefore, conventional genetic diagnosis of CORD would be time-consuming and labor-intensive. Our study indicated the robustness and cost-effectiveness of WES in the genetic diagnosis of CORD.

Pterygium epithelium abnormal differentiation related to activation of extracellular signal-regulated kinase signaling pathway in vitro

Juan Peng,Xiang-Yin Sha,Yi Liu,Rui-Ming Yang and Ye Wen — 2015/11/12 0:00:00
AIM: To investigate whether the abnormal differentiation of the pterygium epithelium is related to the extracellular signal-regulated kinase (ERK) signaling pathway in vitro. METHODS: The expression levels of phosphorylated ERK (P-ERK), keratin family members including K19 and K10 and the ocular master control gene Pax-6 were measured in 16 surgically excised pterygium tissues and 12 eye bank conjunctiva. In colony-forming cell assays, the differences in clone morphology and in K10, K19, P-ERK and Pax-6 expression between the head and body were investigated. When cocultured with the ERK signaling pathway inhibitor PD98059, the changes in clone morphology, colony-forming efficiency, differentiated marker K10, K19 and Pax-6 expression and P-ERK protein expression level were examined by immunoreactivity and Western blot analysis. RESULTS: The expression of K19 and Pax-6 decreased in the pterygium, especially in the head. No staining of K10 was found in the normal conjunctiva epithelium, but it was found to be expressed in the superficial cells in the head of the pterygium. Characteristic upregulation of P-ERK was observed by immunohistochemistry. The clone from the head with more differentiated cells in the center expressed more K10, and the clone from the body expressed more K19. The P-ERK protein level increased in the pterygium epithelium compared with conjunctiva and decreased when cocultured with PD98059. The same medium with the ERK inhibitor PD98059 was more effective in promoting clonal growth than conventional medium with 3T3 murine feeder layers. It was observed that the epithelium clone co-cultured with the inhibitor had decreased K10 expression and increased K19 and Pax-6 expression. CONCLUSION: We suggest ERK signaling pathway activation might play a role in the pterygium epithelium abnormal differentiation.

Correlation between polymorphisms in the MFN1 gene and myopia in Chinese population

Yun-Chun Zou,Jia-Hong Lei,Ying Wang and Shuang Xu — 2015/11/12 0:00:00
AIM: To explore whether genetic variations in the MFN1 gene are associated with low to moderate myopia in Chinese population. METHODS: The case-control association analysis was used. The study included 100 independent myopia patients (-0.75 D ≤ spherical refraction ≤-8.00 D) and 100 sex-matched healthy controls (with binocular spherical equivalent ranges between -0.50 D and +0.50 D). Four single nucleotide polymorphism (SNP) tags (rs3976523, rs13098637, rs6762399 and rs7618348) were selected for genotyping by direct sequencing. The frequencies of genotypes and their alleles were calculated based on the number of SNP genotypes in each sample. The Chi-square test was used to examine the difference in the frequency between the myopia cases and controls. RESULTS: Genotype distributions in the four SNPs were all in accordance with the Hardy-Weinberg equilibrium; analysis showed that rs13098637 was significantly associated with low to moderate myopia (P=0.003 and empirical P=0.010). There were no statistically significant differences observed for the genotype or allele frequencies of the other three SNPs between the myopia cases and controls in the Chinese population in this study. CONCLUSION: The current study has revealed that the C allele of rs13098637 in MFN1 had a significant association with low to moderate myopia.

A novel FBN1 missense mutation (p.C102Y) associated with ectopia lentis syndrome in a Chinese family

Yi Zhai,Wei Wang,Ya-Nan Zhu,Jin-Yu Li,Yin-Hui Yu,Kai-Ran Lai and Ke Yao — 2015/10/9 0:00:00
AIM:To characterize the disease-causing mutations in a Chinese family with ectopia lentis syndrome (ELS).METHODS:Patients and their family members were given complete physical, ophthalmic, and cardiovascular examinations. Genomic DNA samples were extracted from the peripheral blood of the pedigree members and 100 healthy controls. Mutation screening was performed in the fibrillin-1 (FBN1) gene by bi-directional sequencing of the amplified products. The mutation was analyzed using two bioinformatics methods.RESULTS:A novel heterozygous c.305G>A mutation in exon 3 of FBN1 was detected. As a result of this change, a highly conserved cysteine residue was replaced by a tyrosine residue (p.C102Y). Another mutation was found in the same exon (c.303T>C), which did not change the amino acid sequence. Both mutations were discovered in each affected individual, but not in the unaffected family members, or in 100 ethnically matched controls. A bioinformatics analysis predicted that mutation p.C102Y would affect protein function.CONCLUSION:In the first epidermal growth factor-like module, we identified a novel FBN1 mutation (p.C102Y), which caused ELS in the family. Our study presented a unique phenotype, including some distinct ophthalmic findings, such as hypoplasia of the iris and anisometropia. Our results expanded the mutation spectrum of FBN1 and enriched the overall knowledge of genotype-phenotype correlations due to FBN1 mutations.

Efficacy of the nucleotide-binding oligomerzation domain 1 inhibitor Nodinhibit-1 on corneal alkali burns in rats

Xu Huang,Yun Han,Yi Shao and Jing-Lin Yi — 2015/10/9 0:00:00
AIM:To evaluate the therapeutic effect of Nodinhibit-1 on alkali-burn-induced corneal neovascularization (CNV) and inflammation.The nucleotide-binding oligomerzation domain 1 (NOD1) is a potent angiogenic gene.METHODS:The alkali-burned rat corneas (32 right eyes) were treated with eye drops containing Nodinhibit-1 or phosphate buffered solution (PBS, PH 7.4) only, four times per day. CNV and inflammation were monitored using slit lamp microscopy, and the area of CNV was measured by formula. Vascular endothelial growth factor (VEGF) and pigment epithelium-derived factor (PEDF) was determined by Western blot analysis. The TUNEL assay was used to assess the corneal apoptosis cells.RESULTS:Alkali-burn-induced progressive CNV and inflammation in the cornea. After treatment for 7d and 14d, there were statistically significant differences in the CNV areas and inflammatory index on that between two group(P＜0.05, respectively). Epithelial defect quantification showed a significant difference between the two groups at days 4 and 7 after the alkali burns (P＜0.05). The apoptotic cells on days 1, 4, and 7 between the two groups showed significant differences at all time points (P<0.05, respectively). Compared to that in control group, the protein level of VEGF expression was significantly reduced whereas the PEDF expression was increase in the Nodinhibit-1 groups on day 14 (P＜0.05, respectively＝.CONCLUSION:Topical application of 10.0 μg/mL Nodinhibit-1 may have potential effect for the alkali burn-induced CNV and inflammation. The effect of Nodinhibit-1 on CNV may be by regulation the equilibrium of VEGF and PEDF in the wounded cornea.

Expression of vitamin D receptor and cathelicidin in human corneal epithelium cells during fusarium solani infection

2015/10/9 0:00:00
AIM:To observe the expression of vitamin D receptor (VDR) in human specimen and immortalized human corneal epithelium cells (HCEC) when challenged with fusarium solani. Moreover, we decided to discover the pathway of VDR expression. Also, we would like to detect the expression of cathelicidin antimicrobial peptide (CAMP) in the downstream pathway of VDR.METHODS:Immunohistochemistry was used to examine the VDR expression in HCEC from healthy and fungal keratitis patients. Real time quantitative polymerase chain reaction (qPCR) was performed to observe the messenger ribonucleic acid (mRNA) change of VDR when immortalized HCEC were challenged with fusarium solani for different hours. CAMP was detected at both mRNA and protein levels.RESULTS:We found out that the VDR expression in fusarium solani keratitis patients’ specimen was much more than that in healthy people. The mRNA and protein expression of VDR increased when we stimulated HCEC with fusarium solani antigen (P<0.01) and it could be inhibited by toll like receptor 2 (TLR2) monoclonal antibody. The CAMP expression was decreased because of fusarium solani antigen stimulation (P<0.01).CONCLUSION:The VDR expression can be increased via TLR2/1-VDR pathway while the CAMP expression is decreased by the stimulation of fusarium solani antigen.

Expression of transcription factors Slug in the lens epithelial cells undergoing epithelial-mesenchymal transition induced by connective tissue growth factor

Ying-Na Wang,Li Qin,Jing-Ming Li,Li Chen and Cheng Pei — 2015/10/9 0:00:00
AIM:To investigate the expression of transcription factors Slug in human lens epithelial cells (HLECs) undergoing epithelial-mesenchymal transition (EMT) induced by connective tissue growth factor (CTGF).METHODS: HLECs were treated with CTGF of different concentrations (20, 50 and 100 ng/mL) or without CTGF (control) for 24h. The morphological changes of HLECs were analysed by microscopy. The expression and cellular localization of Slug was evaluated by immumo-fluorescence. Expressions of Slug, E-cadherin and alpha smooth muscle actin (α-SMA) were further determined by Western blot analysis. RESULTS: HLECs showed spidle fibrolasts-like characteristics and loosely connected each other after CTGF treatment. The immuno-fluorescence staining indicated that Slug was localized in the nuclei and its expression was induced by CTGF. The relative expressions of Slug protein were 1.64±0.11, 1.96 ±0.03, 3.12 ±0.10, and 4.08±0.14, respectively, in response to control group and treatment with CTGF of 20, 50 and 100 ng/mL (F=443.86, P<0.01). The increased Slug protein levels were correlated well with up-expression of α-SMA (0.78±0.05, 0.85±0.06, 2.17±0.15, 2.86±0.10; F=449.85, P<0.01) and down-expression of E-cadherin (2.50±0.11, 1.79±0.26, 1.05±0.14, 0.63±0.08; F=101.55, P<0.01). CONCLUSION: Transcription factor Slug may be involved in EMT of HLECs induced by CTGF in vitro.

Small interfering RNA targeting PGC-1α inhibits VEGF expression and tube formation in human retinal vascular endothelial cells

Jian Jiang,Lu Zhang and Xiao-Bo Xia — 2015/10/9 0:00:00
AIM:To determine whether small interfering RNA (siRNA) of PGC-1α could inhibit vascular endothelial growth factor (VEGF) expression and tube formation in human retinal vascular endothelial cells (hRVECs).METHODS:hRVECs transfected with peroxisome proliferator-activated receptor-γ coactivator-1α (PGC-1α) siRNA were incubated for 24h and then placed into a normoxic (20%, O2) or hypoxic (1%, O2) environment for another 16h. PGC-1α mRNA and protein levels were detected by real-time PCR and Western blot. VEGF mRNA and protein levels were detected by real-time PCR and ELISA. Cell proliferation was evaluated by BrdU incorporation assay. Forty-eight hours after siRNA transfection, hRVECs were planted into Matrigel-coated plates and cultured under normoxic (20%, O2) or hypoxic (1%, O2) conditions for another 48h. The tube formation of hRVECs was observed under an optical microscope and quantified by counting the number of branch points and calculating the total tube length.RESULTS: PGC-1α mRNA and protein levels were significantly reduced by PGC-1α siRNA, and VEGF mRNA and protein levels also decreased significantly. The percentage of BrdU-labeled cells in siPGC-1α groups were significantly decreased compared with control siRNA groups under normoxia and hypoxia in cell proliferation assay. In the tube formation assay, PGC-1α siRNA treated cells formed significantly fewer tubes.CONCLUSION: Blocking PGC-1α expression can inhibit VEGF expression in hRVECs and inhibit their ability to form tubes under both normoxic and hypoxic conditions.

The protective role of tacrine and donepezil in the retina of acetylcholinesterase knockout mice

Yun-Min Yi,Li Cai,Yi Shao,Man Xu and Jing-Lin Yi — 2015/10/9 0:00:00
AIM:To determine the effect of different concentrations of the acetylcholinesterase (AChE) inhibitors tacrine and donepezil on retinal protection in AChE^+/- mice (AChE knockout mice) of various ages.METHODS:Cultured ARPE-19 cells were treated with hydrogen peroxide (H2O2) at concentrations of 0, 250, 500, 1000 and 2000 μmol/L and protein levels were measured using Western blot. Intraperitoneal injections of tacrine and donepezil (0.1 mg/mL, 0.2 mg/mL and 0.4 mg/mL) were respectively given to AChE^+/- mice aged 2mo and 4mo and wild-type S129 mice for 7d; phosphate buffered saline (PBS) was administered to the control group. The mice were sacrificed after 30d by in vitro cardiac perfusion and retinal samples were taken. AChE-deficient mice were identified by polymerase chain reaction (PCR) analysis using specific genotyping protocols obtained from the Jackson Laboratory website. H&E staining, immunofluorescence and Western blot were performed to observe AChE protein expression changes in the retinal pigment epithelial (RPE) cell layer.RESULTS:Different concentrations of H2O2 induced AChE expression during RPE cell apoptosis. AChE^+/-mice retina were thinner than those in wild-type mice (P<0.05); the retinal structure was still intact at 2mo but became thinner with increasing age (P<0.05); furthermore, AChE^+/- mice developed more slowly than wild-type mice (P<0.05). Increased concentrations of tacrine and donepezil did not significantly improve the protection of the retina function and morphology (P>0.05).CONCLUSION:In vivo, tacrine and donepezil can inhibit the expression of AChE; the decrease of AChE expression in the retina is beneficial for the development of the retina.

Protein tyrosine phosphatase 1B regulates migration of ARPE-19 cells through EGFR/ERK signaling pathway

Zhao-Dong Du,Li-Ting Hu,Gui-Qiu Zhao,Qian Wang,Qiang Xu,Nan Jiang and Jing Lin — 2015/10/9 0:00:00
AIM: To evaluate whether protein tyrosine phosphatase 1B (PTP1B) contributed to initiate human retinal pigment epithelium cells (A)-19 migration and investigate the signaling pathways involved in this process. METHODS:ARPE-19 cells were cultured and treated with the siRNA-PTP1B. Expression of PTP1B was confirmed by quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR). AG1478 [a selective inhibitor of epidermal growth factor receptor (EGFR)] and PD98059 (a specific inhibitor of the activation of mitogen-activated protein kinase) were used to help to determine the PTP1B signaling mechanism. Western blot analysis verified expression of EGFR and extracellular signal-regulated kinase (ERK) in ARPE-19 cells. The effect of siRNA-PTP1B on cell differentiation was confirmed by immunostaining for α-smooth muscle actin (α-SMA) and qRT-PCR. Cell migration ability was analyzed by transwell chamber assay.RESULTS: The mRNA levels of PTP1B were reduced by siRNA-PTP1B as determined by qRT-PCR assay. SiRNA-PTP1B activated EGFR and ERK phosphorylation. α-SMA staining and qRT-PCR assay demonstrated that siRNA-PTP1B induced retinal pigment epithelium (RPE) cells to differentiate toward better contractility and motility. Transwell chamber assay proved that PTP1B inhibition improved migration activity of RPE cells. Treatment with AG1478 and PD98059 abolished siRNA-PTP1B-induced activation of EGFR and ERK, α-SMA expression and cell migration.CONCLUSION: PTP1B inhibition promoted myofibroblast differentiation and migration of ARPE-19 cells, and EGFR/ERK signaling pathway played important role in migration process.

Comparison of electroretinographic responses between two different age groups of adult Dark Agouti rats

Lin Fu,Amy Cheuk Yin Lo,Jimmy Shiu Ming Lai and Kendrick Co Shih — 2015/10/9 0:00:00
AIM: To describe and compare the differences in electroretinographic responses between two different age groups of adult Dark Agouti (DA) rats and to better understand the effect of age on retinal histology and function.METHODS: The electroretinographic responses of two different age groups of adult DA rats were compared. Animals were divided into younger adult DA rats 10-12wk (n=8) and older adult DA rats 17-19wk (n=8). Full field electroretinography (ERG) was recorded simultaneously from both eyes after dark adaption and light adaption and parameters including the positive scotopic threshold response (pSTR), negative scotopic threshold response (nSTR), scotopic a-wave, b-wave, photopic a-wave, b-wave and photopic negative response (PhNR) were compared between groups.RESULTS: The older adult rats displayed lower stimulation thresholds of the STRs (pSTR and nSTR) and higher amplitudes of pSTR, scotopic a-wave and b-wave, photopic b-wave and PhNR amplitudes, with shorter implicit times. Photopic a-wave amplitudes were however higher in the younger adult rats.CONCLUSION:In summary, for the rod system, photoreceptor, bipolar cell and RGC activity was enhanced in the older adult rats. For the cone system, RGC and bipolar cell activity was enhanced, while photoreceptor activity was depressed in the older adult rats. Such age-related selective modification of retinal cell function needs to be considered when conducting ophthalmic research in adult rats.

Effects of 530 nm monochromatic light on basic fibroblast growth factor and transforming growth factor-β1 expression in Müller cells

2015/10/9 0:00:00
AIM: To expose rat retinal Müller cells to 530 nm monochromatic light and investigate the influence of varying light illumination times on basic fibroblast growth factor (bFGF) and transforming growth factor-β1 (TGF-β1) expression.METHODS: Three groups of rat retinal Müller cells cultured in vitro under a 530 nm monochromatic light were divided into 6, 12 and 24h experimental groups , while cells incubated under dark conditions served as the control group. The bFGF and TGF-β1 mRNA expression, protein levels and fluorescence intensity of the Müller cells were analyzed.RESULTS:ThebFGF mRNA expression and protein levels were significantly upregulated in Müller cells in all three experimental groups compared with the control group (P<0.05), while that of TGF-β1 was downregulated (P<0.05). Also, bFGF expression was positively correlated, but TGF-β1 expression was negatively correlated with illumination time. The largest changes for both cytokines were seen in the 24h group. The changes in bFGF and TGF-β1 fluorescence intensity were highest in the 24h group, and significant differences were observed among the experimental groups (P<0.05).CONCLUSION:The expressions ofbFGF and TGF-β1 changed in a time-dependent manner in Müller cells exposed to 530 nm monochromatic light with 250 lx illumination intensity. Müller cells might play a role in the development of myopia by increasing bFGF expression or decreasing TGF-β1 expression. Changes in cytokine expression in retinal Müller cells may affect monochromatic light-induced myopia.

Achromatopsia caused by novel missense mutations in the CNGA3 gene

Xi-Teng Chen,Hui Huang,Yan-Hua Chen,Li-Jie Dong,Xiao-Rong Li and Xiao-Min Zhang — 2015/10/9 0:00:00
AIM:To identify the genetic defects in a Chinese family with achromatopsia.METHODS:A 2.5-year-old boy, who displayed nystagmus, photophobia, and hyperopia since early infancy, was clinically evaluated. To further confirm and localize the causative mutations in this family, targeted region capture and next-generation sequencing of candidate genes, such as CNGA3, CNGB3, GNAT2, PDE6C, and PDE6H were performed using a custom-made capture array.RESULTS:Slit-lamp examination showed no specific findings in the anterior segments. The optic discs and maculae were normal on fundoscopy. The unaffected family members reported no ocular complaints. Clinical signs and symptoms were consistent with a clinical impression of autosomal recessive achromatopsia. The results of sequence analysis revealed two novel missense mutations in CNGA3, c.633T>A (p.D211E) and c.1006G>T (p.V336F), with an autosomal recessive mode of inheritance.CONCLUSION: Genetic analysis of a Chinese family confirmed the clinical diagnosis of achromatopsia. Two novel mutations were identified in CNGA3, which extended the mutation spectrum of this disorder.

β-Ⅲ-Tubulin:a reliable marker for retinal ganglion cell labeling in experimental models of glaucoma

Shan-Ming Jiang,Li-Ping Zeng,Ji-Hong Zeng,Li Tang,Xiao-Ming Chen and Xin Wei — 2015/7/27 0:00:00
AIM: To evaluate the reliability of β-III-Tubulin protein as a retinal ganglion cell (RGC) marker in the experimental glaucoma model. METHODS: Glaucoma mouse models were established by injecting polystyrene microbeads into the anterior chamber of C57BL/6J mice, then their retinas were obtained 14d and 28d after the intraocular pressure (IOP) was elevated. Retinal flat mounts and sections were double-labeled by fluorogold (FG) and β-III-Tubulin antibody or single-labeled by β-III-Tubulin antibody, then RGCs were counted and compared respectively. RESULTS: IOP of the injected eyes were elevated significantly and reached the peak at 22.8±0.7 mm Hg by day 14 after injection, then dropped to 11.3±0.7 mm Hg by day 28. RGC numbers counted by FG labeling and β-III-Tubulin antibody labeling were 64 807±4930 and 64614±5054 respectively in the control group, with no significant difference. By day 14, RGCs in the experimental group decreased significantly compared to the control group, but there was no significant difference between the FG labeling counting and the β-III-Tubulin antibody labeling counting either in the experimental group or in the control group. The result was similar by day 28, with further RGC loss. CONCLUSION: Our result suggested that the β-III-Tubulin protein was not affected by IOP elevation and can be used as a reliable marker for RGC in experimental models of glaucoma.

Pharmacokinetics and distributions of bevacizumab by intravitreal injection of bevacizumab-PLGA microspheres in rabbits

Zhuo Ye,Yan-Li Ji,Xiang Ma,Jian-Guo Wen,Wei Wei and Shu-Man Huang — 2015/7/27 0:00:00
AIM:To investigate the pharmacokinetics and distributions of bevacizumab by intravitreal injection of prepared bevacizumab-poly (L-lactic-co-glycolic acid) (PLGA) microspheres in rabbits, to provide evidence for clinical application of this kind of bevacizumab sustained release dosage form.METHODS:Bevacizumab was encapsulated into PLGA microsphere via the solid-in-oil-in-hydrophilic oil (S/O/hO) method. Fifteen healthy New Zealand albino-rabbits were used in experiments. The eyes of each rabbit received an intravitreal injection. The left eyes were injected with prepared bevacizumab-PLGA microspheres and the right eyes were injected with bevacizumab solution. After intravitreal injection, rabbits were randomly selected at days 3, 7, 14, 28 and 42 respectively, three animals each day. Then we used immunofluorescence staining to observe the distribution and duration of bevacizumab in rabbit eye tissues, and used the sandwich ELISA to quantify the concentration of free bevacizumab from the rabbit aqueous humor and vitreous after intravitreal injection.RESULTS:The results show that the concentration of bevacizumab in vitreous and aqueous humor after administration of PLGA formulation was higher than that of bevacizumab solution. The T1/2 of intravitreal injection of bevacizumab-PLGA microspheres is 9.6d in vitreous and 10.2d in aqueous humor, and the T1/2 of intravitreal injection of soluble bevacizumab is 3.91d in vitreous and 4.1d in aqueous humor. There were statistical significant difference for comparison the results of the bevacizumab in vitreous and aqueous humor between the left and right eyes (P<0.05). The AUC0-t of the sustained release dosage form was 1-fold higher than that of the soluble form. The relative bioavailability was raised significantly. The immunofluorescence staining of PLGA-encapsulated bevacizumab (b-PLGA) in rabbit eye tissues was still observed up to 42d. It was longer than that of the soluble form.CONCLUSION: The result of this study shows the beneficial effects of PLGA in prolonging the residency of bevacizumab in the vitreous. And the drug delivery system may have potential as a treatment modality for related disease.

Rapamycin ameliorates experimental autoimmune uveoretinitis by inhibiting Th1/Th2/Th17 cells and upregulating CD4+CD25+ Foxp3 regulatory T cells

Li-Fei Yuan,Guang-Da Li,Xin-Jun Ren,Hong Nian,Xiao-Rong Li and Xiao-Min Zhang — 2015/7/27 0:00:00
AIM:To determine the effects of rapamycin on experimental autoimmune uveoretinitis (EAU) and investigate of role of rapamycin on T cell subsets in the disease. METHODS:EAU was induced in rats using peptides 1169 to 1191 of the interphotoreceptor binding protein (IRBP). Rapamycin (0.2 mg/kg/d) was administrated by intraperitoneal injection for a consecutive 7d after immunization. Th1/Th2/Th17 cytokines, TGF-β1, and IL-6 produced by lymphocyteswere measured by ELISA, while Th17 cells and CD4+CD25+ regulatory T cells (Tregs) from rat spleen were detected by flow cytometry. RESULTS: Intraperitoneal treatment immediately after immunization dramatically ameliorated the clinical course of EAU. Clinical responses were associated with reduced retinal inflammatory cell infiltration and tissue destruction. Rapamycin induced suppression of Th1/Th2/Th17 cytokines, including IFN-γ, IL-2, IL-17, IL-4, and IL-10 release from T lymphocytes of EAU rats, in vitro. Rapamycin also significantly increased TGF-β1 production but had no effect on IL-6 productionof T lymphocytes from EAU rats in vitro. Furthermore, rapamycin decreased the ratio of Th17 cells/CD4+T cells and upregulated Tregs in EAU, as detected by flow cytometry. CONCLUSION: Rapamycin effectively interferes with T cell mediated autoimmune uveitis by inhibiting antigen-specific T cell functions and enhancing Tregs in EAU. Rapamycin is a promising new alternative as an adjunct corticosteroid-sparing agent for treating uveitis.

Emodin ameliorates lipopolysaccharides-induced corneal inflammation in rats

Guo-Ling Chen,Jing-Jing Zhang,Xin Kao,Lu-Wan Wei and Zhi-Yu Liu — 2015/7/27 0:00:00
AIM:To investigate the effect of emodin on pseudomonas aeruginosa lipopolysaccharides (LPS)-induced corneal inflammation in rats.METHODS:Corneal infection was induced by pseudomonas aeruginosa LPS in Wistar rats. The inflammation induced by LPS were examined by slit lamp microscope and cytological checkup of aqueous humor. Corneal tissue structure was observed by hematoxylin and eosin (HE) staining. The activation of nuclear factor kappaB (NF-κB) was determined by Western blot. Messenger ribonucleic acid (mRNA) of tumor necrosis factor-α (TNF-α) and intercellular adhesion molecule-1 (ICAM-1) in LPS-challenged rat corneas were measured with reverse transcription-polymerase chain reaction (RT-PCR).RESULTS:Typical manifestations of acute corneal inflammation were observed in LPS-induce rat model, and the corneal inflammatory response and structure were improved in rats pretreated with emodin. Treatment with emodin could improve corneal structure, reduce corneal injure by reducing corneal inflammatory response. Emodin could inhibit the decreasing lever of inhibitor of kappaB alpha (IкBα) express, and the mRNA expression of TNF-α and ICAM-1 in corneal tissues was also inhibited by emodin. The differences were statistically significant between groups treated with emodin and those without treatment (P<0.01).CONCLUSION:Emodin could ameliorate LPS-induced corneal inflammation, which might via inhibiting the activation of NF-κB.

Phenotype of Usher syndrome type II assosiated with compound missense mutations of c.721 C>T and c.1969 C>T in MYO7A in a Chinese Usher syndrome family

Wei Zhai,Xin Jin,Yan Gong,Ling-Hui Qu,Chen Zhao and Zhao-Hui Li — 2015/7/27 0:00:00
AIM:To identify the pathogenic mutations in a Chinese pedigree affected with Usher syndrome type II (USH2).METHODS:The ophthalmic examinations and audiometric tests were performed to ascertain the phenotype of the family. To detect the genetic defect, exons of 103 known RDs -associated genes including 12 Usher syndrome (USH) genes of the proband were captured and sequencing analysis was performed to exclude known genetic defects and find potential pathogenic mutations. Subsequently, candidate mutations were validated in his pedigree and 100 normal controls using polymerase chain reaction (PCR) and Sanger sequencing.RESULTS:The patient in the family occurred hearing loss (HL) and retinitis pigmentosa (RP) without vestibular dysfunction, which were consistent with standards of classification for USH2. He carried the compound heterozygous mutations, c.721 C>T and c.1969 C>T, in the MYO7A gene and the unaffected members carried only one of the two mutations. The mutations were not present in the 100 normal controls.CONCLUSION:We suggested that the compound heterozygous mutations of the MYO7A could lead to USH2, which had revealed distinguished clinical phenotypes associated with MYO7A and expanded the spectrum of clinical phenotypes of the MYO7A mutations.

Complement factors C1q, C3 and C5b-9 in the posterior sclera of guinea pigs with negative lens-defocused myopia

Ting-Ting Gao,Qin Long and Xue Yang — 2015/7/27 0:00:00
AIM:To investigate the expression of complement factors in the posterior scleral ?broblasts of guinea pigs with negative lens-defocused myopia.METHODS:Eighteen guinea pigs were assigned randomly to two groups:the negative lens-defocused group (NLD group, n=9) and the normal control without treatment group (NC group, n=9). The effect of myopic induction was compared in three subgroups:eyes treated with a -10.00 D negative lens in the NLD group (NL group), eyes treated with a plano (0 D) lens in the NLD group (PL group), and untreated right eyes in the NC group (NC group). The following analyses were conducted at four weeks:examination of the refractive error via retinoscopy, assessment of complement C5b-9 expression in the posterior scleral fibroblasts using immunohistochemistry, and measurements of complement C1q and C3 protein levels in the posterior sclera by Western blot.RESULTS:After an induction period of four weeks, a significant myopic shift was detected in the eyes of the NL group, relative to that of the PL and NC groups (P<0.05). Data analysis showed a significant increase in the percentage of C5b-9 immunopositive fibroblasts in the posterior sclera of the NL group eyes, compared to the PL group (q=11.50, P<0.001). Significantly higher levels of C1q (q=4.94, P=0.01) and C3 (q=4.07, P=0.03) protein were detected in the posterior sclera of NL group eyes, compared to the PL group. There were no significant difference between the PL and NC groups for C5b-9 (q=2.44, P=0.10), C1q (q=1.55, P=0.53) and C3 (q=0.98, P=0.77) in the posterior sclera.CONCLUSION:The data from present study provide evidence of the up-regulation of C5b-9, C1q and C3 in the posterior scleral fibroblasts in a NLD myopic animal model. The results suggest that the complement system may be involved in the development of myopia.

Cirrhosis-induced morphological changes in the retina:possible role of endogenous opioid

2015/7/27 0:00:00
AIM:To investigate the impact of cirrhosis on retinal morphology and to evaluate the role of endogenous opioids as a mediator in cirrhosis induced retinal change.METHODS:Thirty-six male rats were divided into 3 main groups; the common bile duct ligated (BDL) group, the sham-operated (Sham) group and the unoperated (Unop) group. Then each of these three main groups was divided into two subgroups; the first subgroup received daily injection of naltrexone hydrochloride (NTX) and the second group was injected with normal saline (Saline) daily. After 28d, rats were anesthetized and their right eyes were enucleated and assessed for histological changes. The thickness of the rod and cons layer, outer nuclear layer, outer plexiform layer, inner nuclear layer, inner plexiform layer and ganglion cell layer for each eye were measured in micrometers by light microscope.RESULTS:Ganglion cell layer showed significant increase in thickness in the BDL group (P<0.05). This increase was eliminated in the group where BDL rats received daily intraperitoneal injection of naltrexone hydrochloride (20 mg/kg). No other histological changes were detected in the other 5 layers we measuredCONCLUSION:The morphological change we detected in the retina of cirrhotic rats is probably due to opioids increased tone in cirrhosis since the increase in thickness in the ganglion cell layer was almost eliminated when naltrexone hydrochloride was injected. These results suggest a possible role for endogenous opioids in the morphological retinal changes detected in cirrhotic rats.

Association of TCR-signaling pathway with the development of lacrimal gland benign lymphoepithelial lesions

Jian-Min Ma,Yi-Xin Cui,Xin Ge,Jing Li,Jin-Ru Li and Xiao-Na Wang — 2015/7/27 0:00:00
AIM: To identify the association of the T cell receptor (TCR) signaling with the development of benign lymphoepithelial lesions (BLEL) of the lacrimal gland.METHODS: We collected affected lacrimal gland tissues from 9 patients who underwent dacryoadenectomy in the Capital Medical University Beijing Tongren Hospital Eye Center between August 2010 and March 2013 and were confirmed to have lacrimal gland BLEL by histopathological analysis. Tumor tissues from 9 patients with orbital cavernous hemangioma were also collected and used as control. Whole genome gene expression microarray was used to compare gene expression profiles of affected lacrimal gland tissues from patients with lacrimal gland BLEL to those from of orbital cavernous hemangiomas. Differential expression of TCR pathway genes between these tissues was confirmed by polymerase chain reaction (PCR) and immunohistochemistry.RESULTS: Microarray analysis showed that in lacrimal glands with BLEL, 32 signaling pathways were enriched in the upregulated genes, while 25 signaling pathways were enriched in the downregulated genes. In-depth analysis of the microarray data showed that the expression of 27 genes of the TCR signaling pathway increased significantly. To verify the differential expression of three of these genes, CD3, CD4, and interleukin (IL)-10, reverse transcription-PCR (RT-PCR) and immunohistochemistry assays were performed. RT-PCR analysis showed that CD3 and CD4 were expressed in the lacrimal glands with BLEL, but IL-10 was not expressed. Immunohistochemistry confirmed that CD3 and CD4 proteins were also present, but IL-10 protein was not. CD3, CD4, or IL-10 expression was not found in the orbital cavernous hemangiomas with either RT-PCR or immunohistochemistry.CONCLUSION: TCR signaling pathway might be involved in the pathogenesis of lacrimal gland BLEL.

Dectin-1 agonist curdlan modulates innate immunity to Aspergillus fumigatus in human corneal epithelial cells

2015/7/27 0:00:00
AIM: To explore the immunomodulatory effects of curdlan on innate immune responses against Aspergillus fumigatus (A. fumigatus) in cultured human corneal epithelial cells (HCECs), and whether C-type lectin receptor Dectin-1 mediates the immunomodulatory effects of curdlan.METHODS:The HCECs were stimulated by curdlan in different concentrations (50, 100, 200, 400 μg/mL) for various time. Then HCECs pretreated with or without laminarin (Dectin-1 blocker, 0.3 mg/mL) and curdlan were stimulated by A. fumigatus hyphae. The mRNA and protein production of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) were determined by real-timequantitative polymerase chain reaction and enzyme-linked immunosorbent assay, respectively. The protein level of Dectin-1 was measured by Western blot.RESULTS: Curdlan stimulated mRNA expression of TNF-α and IL-6 in a dose and time dependent manner in HCECs. Curdlan pretreatment before A. fumigatus hyphae stimulation significantly enhanced the expression of TNF-α and IL-6 at mRNA and protein levels compared with A. fumigatus hyphae stimulation group (P<0.05). Both curdlan and A. fumigatus hyphae up-regulated Dectin-1 protein expression in HCECs, and Dectin-1 expression was elevated to 1.5- to 2-fold by curdlan pretreatment followed hyphaestimulation. The Dectin-1 blocker laminarin suppressed the mRNA expression and protein production of TNF-α and IL-6 induced by curdlan and hyphae (P<0.05).CONCLUSION:These findings demonstrated that curdlan pretreatment enhanced the inflammatory response induced by A. fumigatus hyphae in HCECs. Dectin-1 is essential for the immunomodulatory effects of curdlan. Curdlan may have high clinical application values in fungal keratitis treatment.

Evaluating the safety of intracameral bevacizumab application using oxidative stress and apoptotic parameters in corneal tissue

2015/7/27 0:00:00
AIM:To investigate the possible effects of intracameral bevacizumab on oxidative stress parameters and apoptosis in corneal tissue.METHODS:In total, 30 rats were assigned randomly into the following three groups of 10 rats each:a sham group (Group 1; n=10), a control group [Group 2; balanced salt solution (BSS) was administered at 0.01 mL; n=10], and a treatment group (Group 3; bevacizumab was administered at 0.25 mg/0.01 mL; n=10). The total antioxidant status (TAS) and the total oxidant status (TOS) in the corneal tissue and blood samples were measured, and the oxidative stress index (OSI) was calculated. Additionally, corneal tissue histopathology was evaluated for caspase-3 and -8 staining and apoptotic activity.RESULTS:In the blood samples, the TAS, TOS, and OSI levels were not significantly different (all P>0.05). Compared with the sham and control groups, the TOS and OSI levels in the corneal tissues were significantly different in the bevacizumab group (all P<0.05). No statistically significant differences were observed between the sham and control groups (all P>0.05). However, compared with the sham and control groups, greater immunohistochemical staining for caspases-3 and -8 and an elevated level of apoptotic activity were observed in the bevacizumab group.CONCLUSION:This study revealed that intracameral bevacizumab injections seemed to be systemically safe but may have elicited local toxic effects in the corneal tissue, as indicated by the oxidative stress parameters and histopathological evaluations.

Fungus induces the release of IL-8 in human corneal epithelial cells, via Dectin-1-mediated protein kinase C pathways

2015/6/9 0:00:00
AIM: To identify whether Aspergillus fumigatus (A. fumigatus) hyphae antigens induced the release of interleukin-8 (IL-8) in anti-fungal innate immunity of cultured human corneal epithelial cells (HCECs) and determine the involvement of intracellular signalling pathways.METHODS: HCECs were treated with A. fumigatus hyphae antigens with different concentrations and time. The cytoplasmic calcium of HCECs were assessed by fluorescence imaging. Western blot was used to detect the expression of Ca²⁺-dependent protein kinase C (PKC). The IL-8 levels were determined by specific human IL-8 enzyme-linked immunosorbent assay (ELISA) and reverse transcriptase polymerase chain reaction (RT-PCR). Using a series of pharmacological inhibitors, we examined the upstream signalling pathway responsible for IL-8 expression in response to A. fumigatus hyphae antigens.RESULTS: Cells exposed to A. fumigatus hyphae antigens showed higher level of IL-8 mRNA expression and protein production. We demonstrated here that stimulation of HCECs with A. fumigatus hyphae triggers an intracellular Ca²⁺ flux and results in the activation of Ca²⁺-dependent PKC (α, βⅠand βⅡ) which can be attenuated by pre-treatment of cells with laminarin, suggesting that Dectin-1 signals pathway induced cytoplasmic calcium and influence the activation of PKC in HCECs. Inhibitors of Ca²⁺-dependent PKC (Ro-31-8220 and Go6976) significantly abolished hyphae-induced expression of IL-8.CONCLUSION: Our findings suggest that A. fumigatus hyphae-induced IL-8 expression was regulated by the activation of Dectin-1-mediated Ca²⁺-dependent PKC in HCECs.

Effects of nuclear factor κB expression on retinal neovascularization and apoptosis in a diabetic retinopathy rat model

Ning Jiang,Xiao-Long Chen,Hong-Wei Yang and Yu-Ru Ma — 2015/6/9 0:00:00
AIM:To investigate the expression and role of nuclear factor κB (NF-κB) in diabetic retinopathy (DR) and its relationship with neovascularization and retinal cell apoptosis.METHODS: A total of 80 male Wistar rats were randomly assigned to control (4, 8, 12 and 16wk, n=10 in each group) and diabetes mellitus (DM) groups (4, 8, 12 and 16wk, n=10 in each group). A diabetic rat model was established by intraperitoneal injection of streptozotocin (60 mg/kg). After 4, 8, 12 and 16wk, rats were sacrificed. Retinal layers and retinal neovascularization growth were stained with hematoxylin-eosin and examined under light microscopy. Cell apoptosis in the retina was detected by TdT-mediated dUTP nick end labeling, and NF-κB distribution and expression in the retina was determined using immunohistochemistry.RESULTS: DM model success rate up to 100%. Diabetes model at each time point after the experimental groupcompared with the control group, the blood glucose was significantly increased, decreased body weight, each time point showed significant differences compared with the control group (P<0.01). After 12wk other pathological changes in the retina of diabetic rats were observed; after 16wk, neovascularization were observed. After 1mo, retinal cell apoptosis was observed. Compared with the control group, NF-κB expression in the DM group significantly increased with disease duration.CONCLUSION:With the prolonging of DM progression, the expression NF-κB increases. NF-κB may be related to retinal cell apoptosis and neovascularization.

Anthrax lethal toxin suppresses high glucose induced VEGF over secretion through a post-translational mechanism

Wei-Wei Zhang,Xin Wang,Ping Xie,Song-Tao Yuan and Qing-Huai Liu — 2015/6/9 0:00:00
AIM:To prove anthrax lethal toxin (LeTx) blocks the mitogen activated protein kinases (MAPKs) activation by degrading theMAPK/ERK kinases (MEKs) to suppress vascular endothelial growth factor (VEGF) secretion. METHODS:Human adult retinal pigmented epithelium (ARPE) cells were cultured and treated with normal glucose, high glucose or high glucose with LeTx for additional 24, 48 or 72h for viable cell count. Total RNA from the ARPE was isolated for reverse transcription polymerase chain reaction (RT-PCR). The conditioned medium of ARPE cells treated in different group for 48h was filtered and diluted to detect the concentration of VEGF by enzyme-linked immunosorbant assays. Evaluate the role of MEK/MAPK pathway in the secretion of VEGF by immunoblotting. RESULTS:In this study, we proved high glucose induced activation of the MAPK extracellular signal-regulated kinase (ERK1/2) and p38 in the ARPE cell line was blocked by anthrax LeTx. LeTx also inhibited high glucose induced ARPE cell over proliferation. CONCLUSION:LeTx suppressed high glucose induced VEGF over secretion in the ARPE cells, mainly through a post-translational mechanism.

Photopic negative response in diagnosis of glaucoma:an experimental study in glaucomatous rabbit model

Amal A. ElGohary and Laila Hassan M. Elshazly — 2015/6/9 0:00:00
AIM:To determine whether the photopic negative response (PhNR) elicited by transient white flash on white background is characterizing for glaucoma model in rabbits.METHODS:Glaucoma was induced in twelve rabbits by subconjunctival injection of 0.05 mL of betamethasone in right eyes (each 1 mL contain betamethasone dipropionate 5 mg and betamethasone sodium phosphate 2 mg).The intraocular pressure (IOP) , electroretinogram (ERG) and visual evoked potential (VEP) were measured successively prior and on the 3, 7d, two weeks and four weeks postglaucoma induction. After four weeks, the animals were sacrificed and the globes were histopathologically examined.RESULTS:The IOP increased significantly after one week (P=0.0001), then it gradually returned to the control level . In ERG examination, the means of a and b wave amplitude and latency were not affected significantly. PhNR amplitude decreased significantly within one week (P=0.0001), but its latency was not affected significantly (P=0.132). The means of VEP latency and amplitude were significantly affected after two weeks and four weeks of glaucoma induction (P=0.0001 and 0.02, respectively). The histopathologic examination of the globes showed reduced number of cells in the retinal ganglion cell layer with multiple vacuoles in the retinal nerve fibre layer.There was significant positive correlation between ganglion cell layer cells and PhNR amplitude (r=0.8, P=0.002).CONCLUSION:The rise in IOP resulted in irreversible changes or incomplete recovery of VEP and PhNR amplitude. Both PhNR and VEP represented good additional tools in early diagnosis of glaucoma.

Novel CYP4V2 mutations associated with Bietti crystalline corneoretinal dystrophy in Chinese patients

Rong Tian,Shu-Ran Wang,Jing Wang and You-Xin Chen — 2015/6/9 0:00:00
AIM: To analyze the CYP4V2 mutations in five unrelated Chinese patients with Bietti crystalline corneoretinal dystrophy (BCD) and to provide clinical features of these patients. BCD is a rare monogenic autosomal recessively inherited disorder characterized by the presence of crystals in the retina and retinal pigment epithelium atrophy. Mutations in the CYP4V2 gene have been found to be causative for BCD.METHODS:Ophthalmic examinations were carried out in the affected individuals. Peripheral blood samples were collected and genomic DNA was extracted. All exons and flanking intronic regions of the CYP4V2 gene were amplified with polymerase chain reaction and screened for mutations by direct DNA sequencing. One hundred control chromosomes were also screened to exclude nonpathogenic polymorphisms.RESULTS: Fundus examination revealed the presence of tiny yellowish-sparkling crystals at the posterior pole of the fundus and atrophy of the retinal pigment epithelium in all patients. Choroid neovascularization was noted in one patient. Five different CYP4V2 mutations were identified, including two missense mutations (p.F73L, p.R400H), two splice site mutations (c.802-8_810del17insGC, c.1091-2A>G), and one single base-pair deletion (p.T479TfsX7 or c.1437delC). The two splice site mutations were identified in three of the patients with BCD. Mutation p.T479TfsX7 was a novel mutation not observed in any of 100 ethnically matched control chromosomes.CONCLUSION: Mutation c.802-8_810del17insGC and c.1091-2A>G are common mutations in Chinese patients with BCD. Our results expand the allelic heterogeneity of BCD.

Riboflavin concentration in corneal stroma after intracameral injection

Na Li,Xiu-Jun Peng,Zheng-Jun Fan,Xu Pang,Yu Xia and Teng-Fei Wu — 2015/6/9 0:00:00
AIM:To evaluate the enrichment of riboflavin in the corneal stroma after intracameral injection to research the barrier ability of the corneal endothelium to riboflavin in vivo.METHODS:The right eyes of 30 New Zealand white rabbits were divided into three groups. Different concentrations riboflavin-balanced salt solutions (BSS) were injected into the anterior chamber (10 with 0.5%, 10 with 1%, and 10 with 2%). Eight corneal buttons of 8.5 mm in diameter from each group were dissected at 30min after injection and the riboflavin concentrations in the corneal stroma were determined using high-performance liquid chromatography (HPLC) after removing the epithelium and endothelium. The other two rabbits in every group were observed for 24h and sacrificed. As a comparison, the riboflavin concentrations from 16 corneal stromal samples were determined using HPLC after instillation of 0.1% riboflavin-BSS solution for 30min on the corneal surface (8 without epithelium and 8 with intact epithelium).RESULTS: The mean riboflavin concentrations were 11.19, 18.97, 25.08, 20.18, and 1.13 μg/g for 0.5%, 1%, 2%, de-epithelialzed samples, and the transepithelial groups, respectively. The color change of the corneal stroma and the HPLC results showed that enrichment with riboflavin similar to classical de-epithelialized corneal collagen crosslinking (CXL) could be achieved by intracameral1% riboflavin-BSS solution after 30min; the effect appeared to be continuous for at least 30min.CONCLUSION:Riboflavin can effectively penetrate the corneal stroma through the endothelium after an intracameral injection in vivo, so it could be an enhancing method that could improve the corneal riboflavin concentration in transepithelial CXL.

Comparison of cytotoxicity and wound healing effect of carboxymethylcellulose and hyaluronic acid on human corneal epithelial cells

Jong Soo Lee,Seung Uk Lee,Cheng-ye Che and Ji-Eun Lee — 2015/4/16 0:00:00
Abstract AIM: To investigate the cytotoxic effect on human corneal epithelial cells (HCECs) and the ability to faciliate corneal epithelial wound healing of carboxymethylcellulose (CMC) and hyaluronic acid (HA). METHODS: HCECs were exposed to 0.5% CMC (Refresh plus?, Allergan, Irvine, California, USA) and 0.1% and 0.3% HA (Kynex?, Alcon, Seoul, Korea, and Hyalein mini?, Santen, Osaka, Japan) for the period of 30min, and 4, 12, and 24h. Methyl thiazolyl tetrazolium (MTT)-based calorimetric assay was performed to assess the metabolic activity of cellular proliferation and lactate dehydrogenase (LDH) leakage assay to assess the cytotoxicity. Apoptotic response was evaluated with flow cytometric analysis and fluorescence staining with Annexin V and propiodium iodide. Cellular morphology was evaluated by inverted phase-contrast light microscopy and electron microscopy. The wound widths were measured 24h after confluent HCECs were scratch wounded. RESULTS: The inhibitory effect of human corneal epithelial proliferation and cytotoxicity showed the time-dependent response but no significant effect. Apoptosis developed in flow cytometry and apoptotic cells were demonstrated in fluorescent micrograph. The damaged HCECs were detached from the bottom of the dish and showed the well-developed vacuole formations. Both CMC and HA stimulated reepithehlialization of HCECs scratched, which were more observed in CMC. CONCLUSION: CMC and HA, used in artificial tear formulation, could be utilized without any significant toxic effect on HCECs. Both significantly stimulated HCEC reepithelialization of corneal wounds.

TREM-1 expression in rat corneal epithelium with Aspergillus fumigatus infection

2015/4/16 0:00:00
AIM: To investigate the expression of triggering receptor expressed on myeloid cells-1 (TREM-1) in the aberrant inflammation within the corneal epithelium at early period of fungal infection. METHODS: A total of 65 Wistar rats were randomly divided into control group, sham group and fungal keratitis (FK) group, in which the cornea was infected by Aspergillus fumigatus (A. fumigatus). After executed randomly at 8, 16, 24, 48 and 72h after experimental model being established, the severity of keratomycosis in rats was scored visually with the aid of a dissecting microscope and slit lamp. Then corneas in three groups were collected to assess the expression of TREM-1 through quantitative reverse transcription-polymerase chain reaction (RT-PCR), immunofluorescence technique and Western blot analysis. The correlation between FK inflammation and expression of TREM-1 was also analyzed. RESULTS: Corneal inflammation scores increased with time after fungal infection (F=49.74, P=0.000). The inflammation scores in FK group were obviously higher than those in sham group on the whole (F=137.78, P=0.000). Levels of TREM-1 in the infected rat corneal epithelium had elevated at 8h and peaked at 48h (P<0.001, compared with control group). Western blot analysis also showed an obviously elevated TREM-1 level in rat corneal epithelium at 24h and 48h after fungal infection. Immunofluorescence?technique showed that TREM-1 mainly existed in corneal epithelium and infected corneal stoma of rat. TREM-1 protein expression was enhanced after fungal infection. Moreover, severity of FK inflammation was significantly related to TREM-1 expression in FK (r=0.942, P=0.000). CONCLUSION: TREM-1 may contribute to amplify the inflammation in the cornea infected with A. fumigatus and play critical roles in the battle against A. fumigatus in the innate immune responses.

Therapeutic effects of topical netrin-4 in a corneal acute inflammatory model

Yun Han,Yi Shao,Ting-Ting Liu,Sang-Ming Li,Wei Li and Zu-Guo Liu — 2015/4/16 0:00:00
AIM: To evaluate the therapeutic effect of netrin-4 on the early acute phase of inflammation in the alkali-burned eye. METHODS: Eye drops containing netrin-4 or phosphate buffered saline (PBS) were administered to a alkali-burn-induced corneal acute inflammatory model four times daily. The clinical evaluations, including fluorescein staining and inflammatory index, were performed on day 1, 4 and 7 using slit lamp microscopy. Global specimens were collected on day 7 and processed for immunofluorescent staining. The levels of inflammatory mediators in the corneas were determined by real-time polymerase chain reaction (PCR). RESULTS: Exogenous netrin-4 administered on rat ocular surfaces showed more improvements in decreasing fluorescein staining on day 4 and 7, and resolved alkali burn-induced corneal inflammation index on day 7 (P<0.01). The levels of IL-1β, IL-6, intercellular cell adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), monocyte chemotactic protein-1 (MCP-1) and macrophage inflammatory protein-1 (MIP-1) in corneas were decreased in netrin-4-treated groups (P<0.05). In addition, netrin-4 significantly reduced the expression of leukocyte common antigen 45 (CD45) in the alkali-burn cornea (P<0.001). CONCLUSION: Topical netrin-4 accelerated wound healing and reduced the inflammation on alkali-burn rat model, suggesting a potential as an anti-inflammatory agent in the clinical to treat the acute inflammation.

Inhibitory effect of polysulfated heparin endostatin onalkali burn induced corneal neovascularization in rabbits

2015/4/16 0:00:00
AIM: To investigate anti-angiogenic effects of polysulfated heparin endostatin (PSH-ES) on alkali burn induced corneal neovascularization (NV) in rabbits. METHODS: An alkali burn was made on rabbit corneas to induce corneal NV in the right eye of 24 rabbits. One day after burn creation, a 0.2 mL subconjunctival injection of 50 μg/mL PSH-ES, 50 μg/mL recombinant endostatin (ES), or normal saline was administered every other day for a total of 14d (7 injections). Histology and immunohistochemisty were used to examine corneas. Corneal NV growth was evaluated as microvessel quantity and corneal vascular endothelial growth factor (VEGF) expression was measured by immunohistochemical assay. RESULTS: Subconjunctival injection of ES and PSH-ES resulted in significant corneal NV suppression, but PSH-ES had a more powerful anti-angiogenic effect than ES. Mean VEGF concentration in PSH-ES treated corneas was significantly lower than in ES treated and saline treated corneas. Histological examination showed that corneas treated with either PSH-ES or ES had significantly fewer microvessels than eyes treated with saline. Additionally corneas treated with PSH-ES had significantly fewer microvessels than corneas treated with ES. CONCLUSION: Both PSH-ES and recombinant ES effectively inhibit corneal NV induced by alkali burn. However, PSH-ES is a more powerful anti-angiogenic agent than ES. This research has the potential to provide a new treatment option for preventing and treating corneal NV.

Neuroprotective effect of edaravone in experimental glaucoma model in rats: a immunofluorescence and biochemical analysis

Arzu Toruk Aksar,Nursen Yuksel,Mustafa Gok,Mustafa Cekmen and Yusuf Caglar — 2015/4/16 0:00:00
AIM: To evaluate the neuroprotective activity of systemically administered edaravone in early and late stage of experimental glaucoma in rats. METHODS: In this study, 60 Wistar albino rats were used. Experimental glaucoma model was created by injecting hyaluronic acid to the anterior chamber once a week for 6wk in 46 of 60 subjects. Fourteen subjects without any medication were included as control group. Edaravone administered intraperitoneally 3 mg/kg/d to the 15 of 30 subjects starting at the onset of glaucoma induction and also administered intraperitoneally 3 mg/kg/d to the other 15 subjects starting at three weeks after the onset of glaucoma induction. The other 16 subjects who underwent glaucoma induction was administered any therapy. Retinal ganglion cells (RGCs) have been marked with dextran tetramethylrhodamine (DTMR) retrograde at the end of the sixth week and after 48h, subjects were sacrificed by the method of cardiac perfusion. Alive RGC density was assessed in the whole-mount retina. Whole-mount retinal tissues homogenized and nitric oxide (NO), malondialdehyde (MDA) and total antioxidant capacity (TAC) values were measured biochemically. RESULTS: RGCs counted with Image-Pro Plus program, in the treatment group were found to be statistically significantly protected, compared to the glaucoma group (Bonferroni, P<0.05). The neuroprotective activity of edaravone was found to be more influential by administration at the start of the glaucoma process. Statistically significant lower NO levels were determined in the glaucoma group comparing treatment groups (Bonferroni, P<0.05). MDA levels were found to be highest in untreated glaucoma group, TAC levels were found to be lower in the glaucoma induction groups than the control group (Bonferroni, P<0.05). CONCLUSION: Systemic administration of Edaravone in experimental glaucoma showed potent neuroprotective activity. The role of oxidative stress causing RGC damage in glaucoma was supported by this study results.

Bevacizumab modulates retinal pigment epithelial-to-mesenchymal transition via regulating Notch signaling

Jing-Jing Zhang,San-Jun Chu,Xiao-Lei Sun,Ting Zhang and Wei-Yun Shi — 2015/4/16 0:00:00
AIM: To investigate the effect of bevacizumab treatment on Notch signaling and the induction of epithelial-of-mesenchymal transition (EMT) in human retinal pigment epithelial cells (ARPE-19) in vitro. METHODS: In vitro cultivated ARPE-19 cells were treated with 0.25 mg/mL bevacizumab for 12, 24, and 48h. Cell morphology changes were observed under an inverted microscope. The expression of zonula occludens-1 (ZO-1), vimentin and Notch-1 intracellular domain (NICD) was examined by immunofluorescence. The mRNA levels of ZO-1, α-SMA, Notch-1, Notch-2, Notch-4, Dll4, Jagged-1, RBP-Jk and Hes-1 expression were evaluated with quantitative real-time polymerase chain reaction (qRT-PCR). The protein levels of α-SMA, NICD, Hes-1 and Dll-4 expression were examined with Western blot. RESULTS: Bevacizumab stimulation increased the expression of α-SMA and vimentin in ARPE-19 cells which changed into spindle-shaped fibroblast-like cells. Meanwhile, the mRNA expression of Hes-1 increased and the protein expression of Hes-1 and NICD also increased, which Notch signaling was activated. The mRNA expression of Notch-1, Jagged-1 and RBP-Jk increased at 48h, and while Dll4 mRNA and protein expression did not change after bevacizumab treatment. CONCLUSION: Jagged-1/Notch-1 signaling may play a critical role in bevacizumab-induced EMT in ARPE-19 cells, which provides a novel insight into the pathogenesis of intravitreal bevacizumab-associated complication.

In vitro induction and differentiation of umbilical cord mesenchymal stem cells into neuron-like cells by all-trans retinoic acid

Wei Jin,Yao-Peng Xu,An-Huai Yang and Yi-Qiao Xing — 2015/4/16 0:00:00
AIM: To determine the optimal concentration for inducing the differentiation of human umbilical cord-derived mesenchymal stem cells (hUC-MSCs) into neuron-like cells, although it is understood that all-trans retinoic acid (ATRA) regulates cell proliferation in the nervous system by modulating the balance between mitosis and apoptosis. METHODS: The abilities of ATRA to promote apoptosis as well as neural differentiation were assessed in cultured hUC-MSCs by morphological observation, MTT assay, annexin V-FITC/PI flow cytometry and immunocytochemistry. RESULTS: The data showed that low concentrations of ATRA (0.5 μmol, 0.25 μmol) had no effect on the number of cells. However, treatment with 1.0 μmol or 2.0 μmol ATRA induced a 24.16% and 52.67% reduction in cell number, respectively, compared with vehicle-treated cultures. Further, 4.0 μmol ATRA had a potent effect on cell number, with almost no adherent cells recovered after 24h. We further showed that 0.5 μmol ATRA caused these cells to express characteristic markers of neuronal progenitor cells. CONCLUSION: Taken together, we conclude that ATRA has a dose-dependent influence on the neural differentiation and apoptosis of hUC-MSCs. These findings have implications on the use of ATRA-differentiated hUC-MSCs for the study of neural degeneration diseases.

A comparative study on the transplantation of different concentrations of human umbilical mesenchymal cells into diabetic rats

2015/4/16 0:00:00
AIM: To observe the effects of intravitreal injections of different concentrations of human umbilical mesenchymal stem cells on retinopathy in rats with diabetes mellitus. METHODS: Healthy and adult male Sprague-Dawley (SD) rats were randomly assigned to a normal control group (group A), a diabetic retinopathy (DR) blank control group (group B), a high-concentration transplantation group (group C), a low-concentration transplantation group (group D) and a placebo transplantation group (group E). The expression of nerve growth factor (NGF) protein in the retinal layers was detected by immunohistochemical staining at 2, 4, 6 and 8wk. RESULTS: The expression of NGF was positive in group A and most positive in the retinal ganglion cell layer. In groups B and E, the expression of NGF was positive 2wk after transplantation and showed an increase in all layers. However, the level of expression had decreased in all layers at 4wk and was significantly reduced at 8wk. In groups C and D, the expression of NGF had increased at 2wk and continued to increase up to 8wk. The level of expression in group C was much higher than that in group D. CONCLUSION: DR can be improved by intravitreal injection of human umbilical mesenchymal stem cells. High concentrations of human umbilical mesenchymal stem cells confer a better protective effect on DR than low concentrations.

Comparison of pre-treatment and post-treatment use of selenium in retinal ischemia reperfusion injury

2015/4/16 0:00:00
AIM: To investigate the effects of selenium in rat retinal ischemia reperfusion (IR) model and compare pre-treatment and post-treatment use. METHODS: Selenium pre-treatment group (n=8) was treated with intraperitoneal (i.p.) selenium 0.5 mg/kg for 7d and terminated 24h after the IR injury. Selenium post-treatment group (n=8) was treated with i.p. selenium 0.5 mg/kg for 7d after the IR injury with termination at the end of the 7d period. Sham group (n=8) received i.p. saline injections identical to the selenium volume for 7d with termination 24h after the IR injury. Control group (n=8) received no intervention. Main outcome measures were retina superoxide dismutase (SOD), glutathione (GSH), total antioxidant status (TAS), malondialdehyde (MDA), DNA fragmentation levels, and immunohistological apoptosis evaluation. RESULTS: Compared to the Sham group, selenium pre-treatment had a statistical difference in all parameters except SOD. Post-treatment selenium also resulted in statistical differences in all parameters except the MDA levels. When comparing selenium groups, the pre-treatment selenium group had a statistically higher success in reduction of markers of cell damage such as MDA and DNA fragmentation. In contrast, the post-selenium treatment group had resulted in statistically higher levels of GSH. Histologically both selenium groups succeeded to limit retinal thickening and apoptosis. Pre-treatment use was statistically more successful in decreasing apoptosis in ganglion cell layer compared to post-treatment use. CONCLUSION: Selenium was successful in retinal protection in IR injuries. Pre-treatment efficacy was superior in terms of prevention of tissue damage and apoptosis.

Identify the signature genes for diagnose of uveal melanoma by weight gene co-expression network analysis

2015/4/16 0:00:00
AIM: To identify and understand the relationship between co-expression pattern and clinic traits in uveal melanoma, weighted gene co-expression network analysis (WGCNA) is applied to investigate the gene expression levels and patient clinic features. Uveal melanoma is the most common primary eye tumor in adults. Although many studies have identified some important genes and pathways that were relevant to progress of uveal melanoma, the relationship between co-expression and clinic traits in systems level of uveal melanoma is unclear yet. We employ WGCNA to investigate the relationship underlying molecular and phenotype in this study. METHODS: Gene expression profile of uveal melanoma and patient clinic traits were collected from the Gene Expression Omnibus (GEO) database. The gene co-expression is calculated by WGCNA that is the R package software. The package is used to analyze the correlation between pairs of expression levels of genes. The function of the genes were annotated by gene ontology (GO). RESULTS: In this study, we identified four co-expression modules significantly correlated with clinic traits. Module blue positively correlated with radiotherapy treatment. Module purple positively correlates with tumor location (sclera) and negatively correlates with patient age. Module red positively correlates with sclera and negatively correlates with thickness of tumor. Module black positively correlates with the largest tumor diameter (LTD). Additionally, we identified the hug gene (top connectivity with other genes) in each module. The hub gene RPS15A, PTGDS, CD53 and MSI2 might play a vital role in progress of uveal melanoma. CONCLUSION: From WGCNA analysis and hub gene calculation, we identified RPS15A, PTGDS, CD53 and MSI2 might be target or diagnosis for uveal melanoma.

Semaphorin 3A controls allergic and inflammatory responses in experimental allergic conjunctivitis

2015/2/13 0:00:00
AIM: To assess the efficacy of topical Semaphorin-3A (SEMA3A) in the treatment of allergic conjunctivitis. METHODS: Experimental allergic conjunctivitis (EAC) mice model induced by short ragweed pollen (SRW) in 4-week-old of BALB/c mice, mice were evaluated using haematoxylin and eosin (H&E) staining, immunofluorescence and light microscope photographs. Early phase took the samples in 24h after instillation and late phase took the samples between 4 to 14d after the start of treatment. The study use of topical SEMA3A (10 U, 100 U, 1000 U) eye drops and subconjunctival injection of SEMA3A with same concentration. For comparison, five types of allergy eyedrops were quantified using clinical characteristics. RESULTS: Clinical score of composite ocular symptoms of the mice treated with SEMA3A were significantly decreased both in the immediate phase and the late phase compared to those treated with commercial ophthalmic formulations and non-treatment mice. SEMA3A treatment attenuates infiltration of eosinophils entering into conjunctiva in EAC mice. The score of eosinophil infiltration in the conjunctiva of SEMA3A 1000 U-treated group were significantly lower than low-concentration of SEMA3A treated groups and non-treated group. SEMA3A treatment also suppressed T-cell proliferation in vitro and decreased serum total IgE levels in EAC mice. Moreover, Treatment of SEMA3A suppressed Th2-related cytokines (IL-5, IL-13 and IL-4) and pro-inflammatory cytokines (IFN-γ, IL-17 and TNF-α) release, but increased regulatory cytokine IL-10 concentration in the conjunctiva of EAC mice. CONCLUSIONS: SEMA3A as a biological agent, showed the beneficial activity in ocular allergic processes with the less damage to the intraocular tissue. It is expected that SEMA3A may be contributed in patients with a more severe spectrum of refractory ocular allergic diseases including allergic conjunctivitis in the near future.

Lycium barbarum polysaccharides protected human retinal pigment epithelial cells against oxidative stress-induced apoptosis

Lian Liu,Wei Lao,Qing-Shan Ji,Zhi-Hao Yang,Guo-Cheng Yu and Jing-Xiang Zhong — 2015/2/13 0:00:00
AIM: To investigate the protective effect and its mechanism of lycium barbarum polysaccharides (LBP) against oxidative stress-induced apoptosis in human retinal pigment epithelial cells. METHODS: ARPE-19 cells, a human retinal pigment epithelial cell lines, were exposed to different concentrations of H2O2 for 24h, then cell viability was measured by Cell Counting Kit-8 (CCK-8) assay to get the properly concentration of H2O2 which can induce half apoptosis of APRE-19. With different concentrations of LBP pretreatment, the ARPE-19 cells were then exposed to appropriate concentration of H2O2, cell apoptosis was detected by flow cytometric analysis. Expression levels of Bcl-2 and Bax were measured by real time quantitative polymerase chain reaction (RT-PCR) technique. RSULTS: LBP significantly reduced the H2O2-induced ARPE-19 cells’ apoptosis. LBP inhibited the H2O2-induced down-regulation of Bcl-2 and up-regulation of Bax. CONCLUSION: LBP could protect ARPE-19 cells from H2O2-induced apoptosis. The Bcl-2 family had relationship with the protective effects of LBP.

Activated complement classical pathway in a murine model of oxygen-induced retinopathy

Xue-Ying Tao,Shi-Jie Zheng and Bo Lei — 2015/2/13 0:00:00
AIM: To investigate whether the complement system is involved in a murine model of oxygen-induced retinopathy (OIR). METHODS: Forty C57BL/6J newborn mice were divided randomly into OIR group and control group. OIR was induced by exposing mice to 75%±2% oxygen from postnatal 7d (P7) to P12 and then recovered in room air. For the control group, the litters were raised in room air. At the postnatal 17d (P17), gene expressions of the complement components of the classical pathway (CP), the mannose-binding lectin (MBL) pathway and the alternative pathway (AP) in the retina were determined by quantitative real-time polymerase chain reaction (RT-PCR). Retinal protein expressions of the key components in the CP were examined by Western blotting. RESULTS: Whole mounted retina in the OIR mice showed area of central hypoperfusion in both superficial and deep layers and neovascular tufts in the periphery. The expressions of C1qb and C4b genes in the OIR retina were significantly higher than those of the controls. The expression of retinal complement factor B (CFB) gene in OIR mice was significantly lower than those of the controls. However, the expressions of C3 and complement factor H (CFH) genes were higher. The protein synthesis of the key components involved in the CP (C1q, C4 and C3) were also significantly higher in OIR mouse retina. Although MBL-associated serine protease 1 (MASP1) and MASP2 were detected in both the OIR and the control groups, the expressions were weak and the difference between the two groups was not significant. CONCLUSION: Our data suggest that the complement system CP is activated during the pathogenesis of murine model of OIR.

A novel mutation of sgk-1 gene in central serous chorioretinopathy

2015/2/13 0:00:00
AIM: To investigate the association of serum glucocorticoid kinase gene-1 (SGK-1) DNA variants with chronic central serous chorioretinopathy (CSC). METHODS: We enrolled 32 eyes of 32 patients who were diagnosed with chronic CSC and composed 32 normal eyes as a control group. Peripheral blood was used for DNA extraction and polymerase chain reaction (PCR) amplification. SGK1 gene was sequenced by using BigDye? Terminator v3.1 cycle sequencing KIT (Applied Biosystems, Foster City, CA, USA). The SGK1 gene and its variants were investigated in CSC patient group and control group. RESULTS: We identified a new polymorphism M32V in two person in the patient group (Minor allele frequency (MAF)=0.009) on the region of 1-60 amino acids. The rs1057293 was located in the encoder region of the SGK 1 gene but not associated with CSC (P=0.68). An intrinsic rs1743966 is also not associated (P=0.28). CONCLUSIONS: The new polymorphism M32V is located on the region of 1-60 amino acids which is necessary for localization to the mitochondria in CSC patient. This mutation is probably important for the energy metabolism and plays an important role in the cellular response to hyperosmotic stress and other stress stimuli. Both rs1057293 and rs1743966 are not associated with CSC.

Clinical outcomes of amniotic membrane loaded with 5-FU PLGA nanoparticles in experimental trabeculectomy

Fang Hu,Xiang-Yun Zeng,Zhao-Lian Xie,Lin-Lin Liu and Liang Huang — 2015/2/13 0:00:00
AIM: To evaluate the effect of amniotic membrane loaded with 5-fluorouracil poly (lactic-co-glycolic acid) (PLGA) nanoparticles (5-FU-NPs) in the surgical outcomes of experimental trabeculectomy in rabbits. METHODS: Thirty-two New Zealand white rabbits were randomly categorized into four groups with 8 rabbits in each group. Group 1, the control group, performed traditional trabeculectomy without adjuvant treatment. While the experimental groups performed compound trabeculectomy with different implantations including amniotic membrane (group 2), 5-FU-NPs (group 3) and amniotic membrane loaded with 5-FU-NPs (group 4). Clinical evaluations including IOP measurement and filtration bleb analysis were performed in all groups postoperatively. RESULTS: There is no significant difference of mean IOP in all groups at first 7d after surgery. While at P14, mean IOPs of experimental group 2 (9.8±2.1 mm Hg), groups 3 (8.9±2.8 mm Hg) and group 4 (7.6±2.3 mm Hg) were significantly reduced compared to control group (12.4±2.6 mm Hg; n=8, P<0.05). At P21, mean IOPs of groups 3 (11.7±3.2 mm Hg) and group 4 (9.9±1.6 mm Hg) were significantly decreased compare to control group (17.9±1.6 mm Hg) and group 2 (16.6±2.8 mm Hg; n=8, P<0.05). At P28, mean IOPs of groups 3 (13.8±3.3 mm Hg) and group 4 (10.6±2.0 mm Hg) were also significantly reduced compare to control group (19.4±2.3 mm Hg) and group 2 (18.5±2.4 mm Hg; n=8, P<0.05). Meanwhile mean IOP of group 4 is significantly decreased compared to group 3 at P28 (n=8, P<0.05). Survival analysis of functional filtration blub in all groups revealed the longest survival time in group 4 (24.9±5.1d) compared to that in group 3 (20.6±4.3d), group 2 (15.0±5.2d) and control group (10.1±5.7d). CONCLUSION: Amniotic membrane loaded with 5-Fu-NPs may function as an effective anti-scarring implant and provides improved long-term surgical outcomes for experimental trabeculectomy in rabbits.

Early expression of mannose-binding lectin 2 during Aspergillus fumigatus infection in human corneal epithelial cells

2015/2/13 0:00:00
AIM: To evaluate the early expression of mannose-binding lectin 2 (MBL2) in human corneal epithelial cells (HCECs) infected by Aspergillus fumigatus (AF). METHODS: HCECs cultured in vitro with AF antigens and sampled at 0, 0.5, 1, 2, 4, 6 and 8h. The expression of MBL2 mRNA was evaluated by semiquantitative reverse transcription-polymerase chain reaction (RT-PCR). The expression of MBL2 protein in supernatant fluid was shown by enzyme linked immunosorbent assay (ELISA). MBL2 protein in HCECs was detected by immunocytochemistry at 0 and 24h. RESULTS: MBL2 mRNA and protein are expressed in normal HCECs. The expression of MBL2 mRNA and protein in supernatant fluid begin to increase after being stimulated with AF antigens. The most significantly peak of MBL2 mRNA is in 2h. The protein of MBL2 in supernatant fluid decrease gradually after 0.5h. The protein in HCECs expression increase after stimulation of 24h. CONCLUSION: MBL2 receptor expressed in normal HCECs in vitro. The stimulation by AF antigens can increase the early expression of it.

Form-deprivation myopia induces decreased expression of bone morphogenetic protein-2, 5 in guinea pig sclera

Qing Wang,Mei-Lan Xue,Gui-Qiu Zhao,Mei-Guang Liu and Yu-Na Ma — 2015/2/13 0:00:00
AIM: To identify the presence of various bone morphogenetic proteins (BMPs) and their receptors in normal sclera of human, rat and guinea pigs, and to determine whether their expression changed with form-deprivation myopia (FDM) in guinea pig sclera. METHODS: The expression of BMPs and BMP receptors were detected using reverse transcription polymerase chain reaction (RT-PCR) and immunofluorescence. Two-week-old guinea pigs were monocularly form-deprived with a translucent lens. After fourteen days induction of FDM, total RNA was isolated and subjected to RT-PCR to examine the changes of BMPs and BMP receptors in tissues from the posterior sclera. Western blotting analysis was used to investigate their changes in protein levels. RESULTS: Human sclera expressed mRNAs for BMP-2, -4, -5, -7, -RIA, -RIB and BMP-RII. Conversely, rat sclera only expressed mRNA for BMP-7 and BMP-RIB, while the expression of BMPs and BMP receptors in guinea pigs were similar to that of humans. Human sclera also expresses BMP-2, -4, -5,-7 in protein level. Fourteen days after the induction of myopia, significant decreased expressions for BMP-2 and BMP-5 in the posterior sclera of FDM-affected eyes (P<0.05 vs internal control eyes). CONCLUSION: Various BMPs were expressed in human and guinea pig sclera. In the posterior sclera, expressions of BMP-2 and BMP-5 significantly decreased in FDM eyes. This finding indicates that various BMPs as components of the scleral cytokines regulating tissue homeostasis and provide evidence that alterations in the expression of BMP-2 and BMP-5 are associated with sclera remodeling during myopia induction.

Herpes simplex virus-1 infection or Simian virus 40-mediated immortalization of corneal cells causes permanent translocation of NLRP3 to the nuclei

2015/2/13 0:00:00
AIM: To investigate into the potential involvement of pyrin containing 3 gene (NLRP3), a member of the nucleotide-binding oligomerization domain-like receptors with cytosolic pattern recognition, in the host defense of corneas against viruses. METHODS: The herpes viral keratitis model was utilized in BALB/c mice with inoculation of herpes simplex virus-1 (HSV-1). Corneal tissues removed during therapy of patients with viral keratitis as well as a Simian vacuolating virus 40 (SV40)-immortalized human corneal epithelial cell line were also examined. Immunohistochemistry was used to detect NLRP3 in these subjects, focusing on their distribution in tissue or cells. Western blot was used to measure the level of NLRP3 and another two related molecules in NLPR3 inflammasome, namely caspase-1 and IL-1β. RESULTS: The NLRP3 activation induced by HSV-1 infection in corneas was accompanied with redistribution of NLRP3 from the cytoplasm to the nucleus in both murine and human corneal epithelial cells. Furthermore, in the SV40-immortalized human corneal epithelial cells, NLRP3 was exclusively located in the nucleus, and treatment of the cells with high concentration of extracellular potassium (known as an inhibitor of NLRP3 activation) effectively drove NLRP3 back to the cytoplasm as reflected by both immunohistochemistry and Western blot. CONCLUSION: It is proposed that herpes virus infection activates and causes redistribution of NLRP3 to nuclei. Whether this NLRP3 translocation occurs with other viral infections and in other cell types merit further study.

Expression of peroxisome proliferator-activated receptor γ in rat retina during development

Ju-Ming Zhu and Nan Hu — 2015/2/13 0:00:00
AIM: To evaluate the spatiotemporal expression pattern of PPARγ in embryonic and early postnatal stages of rat retina. METHODS: Fetal rats were collected at 13-18d of gestation (GD) from pregnant females and postnatal rats at 1d (P1) and 5d (P5) after birth were also used. We used RT-PCR to detect PPARγ mRNA and immunohistochemical to observe PPARγ protein. And at last, we chose HE staining showed the structural changes of rat retina during development. RESULTS: RT-PCR analysis showed that PPARγ mRNA was expressed as early as GD13 and gradually decreased as maturation continued. However, the PPARγ gene expression significantly increased after birth, especially in P5. Immunohistochemical analysis showed PPARγ protein was expressed throughout the retinal neuroepithelium at GD13 and GD14, and then decreased during late embryogenesis but remained relatively high in the predicted ganglion cell zone. During postnatal development, PPARγ protein was remarkably increased and the positive signals were mainly located in nerve fiber layer (NFL), ganglion cell layer (GCL) and outer layers of the retina. CONCLUSION: The spatiotemporal changes of PPARγ expression demonstrated that PPARγ might play a role in regulating the differentiation and maturation of retinal cells.

Influence of bone morphogenetic protein type IA receptor conditional knockout in lens on expression of bone morphogenetic protein 4 in lens

Qi Zhao,Jiang-Yue Zhao and Jin-Song Zhang — 2015/2/13 0:00:00
AIM: To investigate the influence of bone morphogenetic protein type IA receptor [BMPR-IA (ALK3)] conditional knockout in lens on expression of bone morphogenetic protein 4 (BMP4) in lens during the development of the vertebrate eye. METHODS: Cre-positive mice were mated with Cre-negative mice to generate 50% Cre-positive (conditional knockout, CKO) 4 embryos, 8 eyes and 50% Cre-negative offspring (wild type, WT) 4 embryos, 8 eyes. The embryos were fixed in 4% paraformaldehyde, embedded in paraffin, and sectioned to a thickness of 4 μm. Removal of paraffin wax and dehydrating for sections, and then the procedure of in situ hybridization was processed, BMP4 MK1784-m (BOSTER) was used, and observed the expression of BMP4 in the lens in experimental group and control group. We selected SPSS11.0 software for statistical analysis, P<0.05 showed that the difference was statistically significant. RESULTS: Four embryos of each genotype were examined, totally we had 8 embryos, 16 eyes. We got the uniform outcomes in all the embryos. We found ALK3 was required during lens growing, but was not essential for the formation of lens. We observed that the expression of Bmp4 in the lens was significantly reduced in all 8 ALK3 CKO lens, BMP4 expression was normal in all the 8 WT lens, P<0.01. This phenomenon became increasingly visible in accordance with embryo development. The most apparent alteration was present at stage E15.5. CONCLUSION: ALK3 is essential for lens growth. The influence of ALK3 on the expression of BMP4 is present during the development of mice lens.

[THIS ARTICLE HAS BEEN RETRACTED] The association of LOXL1 polymorphisms with exfoliation syndrome/glaucoma: Meta-analysis

2015/2/13 0:00:00
[THIS ARTICLE HAS BEEN RETRACTED] AIM: To investigate the association of lysyl oxidase-like 1 (LOXL1) single nucleotide polymorphisms (SNPs) with exfoliation syndrome (XFS)/exfoliation glaucoma (XFG). METHODS: Published manuscripts from PubMed and EMBASE were identified until May 2014. Summary odds ratios (ORs) and 95% confidence intervals (CIs) for LOXL1 (rs1048661, rs2165241 and rs3825942) polymorphisms and the risk of XFS/XFG were estimated using random- or fixed- effect model. RESULTS: The three LOXL1 polymorphisms (rs1048661, rs3825942, and rs2165241) were associated with an increased risk for XFS/XFG among Caucasians, with OR 2.19(1.96-2.45), 8.8 (6.05-12.79) and 3.41 (3.11-3.73), respectively. On the contrast, the rs1048661 and rs2165241, but not rs3825942 polymorphism, have a potential protective effect on XFS/XFG in Asians, with OR 0.06 (0.02-0.18), 0.15 (0.09-0.25), respectively. CONCLUSION: There is strong evidence that LOXL1 polymorphisms are associated with XFS/XFG risk. The strength of risk might be ethnicity-dependent.

The role of LOX-1 on innate immunity against Aspergillus keratitis in mice

2016/9/12 0:00:00
AIM: To explore the effects of lectin-like ox-LDL receptor (LOX-1) on innate immunity against Aspergillus fumigatus (A. fumigatus ) in mice cornea. METHODS: The mRNA levels of LOX-1 were tested in normal and A. fumigatus infected corneas of C57BL/6 and BALB/c mice. The expression of LOX-1, pro-inflammatory cytokines TNF-α, CXCL1 and IL-6, anti-inflammatory cytokines IL-10, and matrix metalloproteinase 9 (MMP9) were tested with treatment with LOX-1 neutralizing antibody or control IgG in A. fumigatus infected corneas of C57BL/6. Macrophages and neutrophils were extracted from susceptible C57BL/6 mice, and pretreated with LOX-1 neutralizing antibody or IgG, then stimulated with A. fumigatus. The mRNA levels of LOX-1, TNF-α, CXCL1, IL-6, IL-10 and MMP9 were evaluated by polymerase chain reaction. RESULTS: The expression of LOX-1 was significantly increased in C57BL/6 mice corneas after A. fumigatus infection compared with BABL/c mice. After treatment with LOX-1 neutralizing antibody, the expression of LOX-1, TNF-α, CXCL1, IL-6, MMP9 and IL-10 in C57BL/6 corneas were significantly decreased compared with treatment with control IgG; the expression of LOX-1, CXCL1, IL-6 and IL-10 were significantly decreased in macrophages, while TNF-α and MMP9 expressions had no change; LOX-1, TNF-α, CXCL1, IL-6, MMP9 and IL-10 expressions were significantly decreased in neutrophils. CONCLUSION: The expression of LOX-1 can affect the expression of pro-inflammatory and anti-inflammatory cytokines in fungal infected corneas, macrophages and neutrophils of C57BL/6. LOX-1 inhibition rebalances the inflammatory response of fungal keratitis in mice.

Inhibiting the effect of ⁹⁰Sr-⁹⁰Y ophthalmic applicators on rat corneal neovascularization induced by sutures

Hong-Yan Zhou, Shuang Wang, Hong Zhang, Ling Wang and Wen-Song Zhang — 2016/9/12 0:00:00
AIM: To investigate a practical technique used to inhibit corneal angiogenesis with a 90Sr-90Y ophthalmic applicator. METHODS: A 90Sr-90Y ophthalmic applicator was detected with a radioactive nuclide application treatment healthy protection standard. The applicator used was produced through medical dosimetry research; it had a concave applicator add measured the applicator temperature, serviceable humidity range, applicator appearance status, applicator radiation homogeneity, radioautography, and radiological safety of the original applicator surface. A vessel model was established using newborn rats, with sutures around the corneal limbus. Corneal neovascularization (CNV) were observed with a slit lamp. The new vessel length and response area were measured. RESULTS: Low-dose radiation can inhibit CNV after corneal sutures. The absorbed dose of the applicator (0.046 Gy/s) was safe for the treatment of it. The lengths of new vessels and the areas of new vessels were lower than the new born vessel rat group (P<0.01). CONCLUSION: The optimal radiation dose emitting from the applicator can be safe and potentially used in humans.

Attenuation of corneal neovascularization by topical low-molecular-weight heparin-taurocholate 7 without bleeding complication

2016/9/12 0:00:00
AIM: To investigate the antiangiogenic effects and safety of topically administered low-molecular-weight heparin-taurocholate 7 (LHT7) on corneal neovascularization (CoNV). METHODS: Twenty-four Sprague-Dawley rats were randomly distributed into four groups of six rats each. The central corneas were cauterized using a silver/potassium nitrate solution. From 2d after cauterization, 12.5 mg/mL (low LHT7 group) or 25 mg/mL (high LHT7 group) LHT7 was topically administered three times daily; 12.5 mg/mL bevacizumab was topically administered as positive control (bevacizumab) group, with normal saline (NS) administered as negative control (NS group). The corneas were digitally photographed to calculate the CoNV percentage from the neovascularized corneal area at 1 and 2wk. RESULTS: The 4 study groups did not have different CoNV percentages at 1wk after injury (P>0.05). However, the low LHT, high LHT, and bevacizumab groups had significantly lower CoNV percentages than the NS group at 2wk (all P<0.05). No significant differences in CoNV percentage were found among the low LHT, high LHT, and bevacizumab groups (all P>0.05). All groups except the NS group had lower CoNV percentages at 2wk post-injury than the levels observed at 1wk (all P<0.05). CONCLUSION: Topically-administered LHT7 inhibited CoNV without complication after chemical cauterization in the rat.

Comprehensive analysis of genetic variations in strictly-defined Leber congenital amaurosis with whole-exome sequencing in Chinese

Shi-Yuan Wang, Qi Zhang, Xiang Zhang and Pei-Quan Zhao — 2016/9/12 0:00:00
AIM: To make a comprehensive analysis of the potential pathogenic genes related with Leber congenital amaurosis (LCA) in Chinese. METHODS: LCA subjects and their families were retrospectively collected from 2013 to 2015. Firstly, whole-exome sequencing was performed in patients who had underwent gene mutation screening with nothing found, and then homozygous sites was selected, candidate sites were annotated, and pathogenic analysis was conducted using softwares including Sorting Tolerant from Intolerant (SIFT), Polyphen-2, Mutation assessor, Condel, and Functional Analysis through Hidden Markov Models (FATHMM). Furthermore, Gene Ontology function and Kyoto Encyclopedia of Genes and Genomes pathway enrichment analyses of pathogenic genes were performed followed by co-segregation analysis using Fisher exact Test. Sanger sequencing was used to validate single-nucleotide variations (SNVs). Expanded verification was performed in the rest patients. RESULTS: Totally 51 LCA families with 53 patients and 24 family members were recruited. A total of 104 SNVs (66 LCA-related genes and 15 co-segregated genes) were submitted for expand verification. The frequencies of homozygous mutation of KRT12 and CYP1A1 were simultaneously observed in 3 families. Enrichment analysis showed that the potential pathogenic genes were mainly enriched in functions related to cell adhesion, biological adhesion, retinoid metabolic process, and eye development biological adhesion. Additionally, WFS1 and STAU2 had the highest homozygous frequencies. CONCLUSION: LCA is a highly heterogeneous disease. Mutations in KRT12, CYP1A1, WFS1, and STAU2 may be involved in the development of LCA.

A novel model of retinopathy of prematurity in normobaric hyperoxic conditions

2016/9/12 0:00:00
AIM: To examine changes in retinal vasculature after treatment with different oxygen concentrations from common retinopathy of prematurity (ROP) models and to determine a novel and practical ROP model. METHODS: A sample of 14 newborn Sprague-Dawley rats was used. The study group (n=7) was exposed to 95% oxygen for 4h per day followed by normoxic laboratory conditions for 20h. This cycle was repeated for 14d. The control group (n=7) was subjected to normobaric normoxic conditions. On postnatal day 14 (P14), the two groups were placed in room air for 7d. On P21, the two groups were examined using indirect ophthalmoscopy. All eyes were enucleated for immunofluorescence (IF) staining of the vasculature of retinas and analysis of vascular endothelial growth factor (VEGF), hypoxia inducible factor-1 alpha (HIF-1α), placental growth factor (PLGF) in vitreous humor, and then the rats were sacrificed by decapitation. All procedures were repeated using another litter of 14 pups. RESULTS: In the study group and under normobaric hyperoxic conditions, retinal neovascularization and peripheral avascular retina were determined in 85% of the rats through indirect ophthalmoscopic examination. Also IF staining of retina of the study group showed retarded peripheral vascular growth. The difference between the two groups for VEGF, HIF-1α and PLGF concentrations of vitreous humor was statistically significant (P=0.003, 0.007, 0.027 respectively). CONCLUSION: Fluctuating oxygen concentrations are primarily responsible for retinal neovascularization. Our new ROP model is practical and applicable for all retinal neovascularization studies, considering the laboratory procedures.

Construction of adenovirus vectors encoding the lumican gene by gateway recombinant cloning technology

Gui-Fang Wang, Bing Qi, Lei-Lei Tu, Lian Liu, Guo-Cheng Yu and Jing-Xiang Zhong — 2016/9/12 0:00:00
AIM: To construct adenovirus vectors of lumican gene by gateway recombinant cloning technology to further understand the role of lumican gene in myopia. METHODS: Gateway recombinant cloning technology was used to construct adenovirus vectors. The wild-type (wt) and mutant (mut) forms of the lumican gene were synthesized and amplified by polymerase chain reaction (PCR). The lumican cDNA fragments were purified and ligated into the adenovirus shuttle vector pDown-multiple cloning site (MCS)-/internal ribozyme entry site (IRES)/enhanced green fluorescent protein (EGFP). Then the desired DNA fragments were integrated into the destination vector pAV.Des1d yielding the final expression constructs pAV.Ex1d-cytomegalovirus (CMV)>wt-lumican/IRES/EGFP and pAV.Ex1d-CMV>mut-lumican/IRES /EGFP, respectively. RESULTS: The adenovirus plasmids pAV.Ex1d-CMV>wt-lumican/IRES/EGFP and pAV.Ex1d-CMV>mut-lumican/IRES/EGFP were successfully constructed by gateway recombinant cloning technology. Positive clones identified by PCR and sequencing were selected and packaged into recombinant adenovirus in HEK293 cells. CONCLUSION: We construct adenovirus vectors containing the lumican gene by gateway recombinant cloning technology, which provides a basis for investigating the role of lumican gene in the pathogenesis of high myopia.

Analysis of the effective dose of ultraviolet light in corneal cross-linking

Yong Zhang, Kuan-ChenWang, Chao-Kai Chang and Jui-Teng Lin — 2016/8/15 0:00:00
AIM: To analyze the efficacy of ultraviolet (UV) light initiating corneal cross-linking (CXL). METHODS: The time-dependent absorption of UV light due to the depletion of the initiator (riboflavin) was calculated. The effective dose of CXL with corneal surface covered by a thin layer of riboflavin was derived analytically. The cross linking time was calculated by the depletion level of the riboflavin concentration. A comprehensive method was used to derive analytic formulas. RESULTS: The effective dose of CXL was reduced by a factor (R) which was proportional to the thickness (d) and concentrations (C0) of the riboflavin surface layer. Our calculations showed that the conventional dose of 5.4 J/cm2 had a reduced effective dose of 4.3 and 3.45 J/cm2, for d was 100 and 200 μm, respectively, and C0=0.1%. The surface cross linking time was calculated to be T*=10.75s, for a depletion level of 0.135 and UV initial intensity of 30 mW/cm2. The volume T* was exponentially increasing and proportional to exp (bdC0), with b being the steady state absorption coefficient. CONCLUSION: The effective dose of CXL is reduced by a factor proportional to the thickness and concentrations of the riboflavin surface layer. The wasted dose should be avoided by washing out the extra riboflavin surface layer prior to the UV light exposure.

Novel mutations in PDE6B causing human retinitis pigmentosa

2016/8/15 0:00:00
AIM: To identify the genetic defects of a Chinese patient with sporadic retinitis pigmentosa (RP). METHODS: Ophthalmologic examinations were performed on the sporadic RP patient, 144 genes associated with retinal diseases were scanned with capture next generation sequencing (CNGS) approach. Two heterozygous mutations in PDE6B were confirmed in the pedigree by Sanger sequencing subsequently. The carrier frequency of PDE6B mutations of reported PDE6B mutations based on the available two public exome databases (1000 Genomes Project and ESP6500 Genomes Project) and one in-house exome database was investigated. RESULTS: We identified compound heterozygosity of two novel nonsense mutations c.1133G>A (p.W378X) and c.2395C>T (p.R799X) in PDE6B, one reported causative gene for RP. Neither of the two mutations in our study was presented in three exome databases. Two mutations (p.R74C and p.T604I) in PDE6B have relatively high frequencies in the ESP6500 and in-house databases, respectively, while no common dominant mutation in each of the database or across all databases. CONCLUSION: We demonstrates that compound heterozygosity of two novel nonsense mutations in PDE6B could lead to RP. These results collectively point to enormous potential of next-generation sequencing in determining the genetic etiology of RP and how various mutations in PDE6B contribute to the genetic heterogeneity of RP.

Phosphorylation of alphaB-crystallin in epiretinal membrane of human proliferative diabetic retinopathy

2016/8/15 0:00:00
AIM: To examine phosphorylation of alphaB-crystallin (p-?BC), a vascular endothelial growth factor (VEGF) chaperone, and immunohistochemically investigate relationship between p-?BC, VEGF and phosphorylated p38-mitogen-activated protein kinase (p-p38 MAPK) in the epiretinal membrane of human proliferative diabetic retinopathy (PDR). METHODS: Eleven epiretinal membranes of PDR surgically excised were included in this study. Two normal retinas were also collected from enucleation tissues due to choroidal melanoma. Paraformaldehyde-fixed, paraffin-embedded tissue sections were processed for immunohistochemistry with anti-p-?BC, VEGF, CD31, and p-p38 MAPK antibodies. RESULTS: Immunoreactivity for p-?BC was observed in all of the epiretinal membranes examined, where phosphorylation on serine (Ser) 59 showed strongest immunoreactivity in over 70% of the membranes. The immunolocalization of p-?BC was detected in the CD31-positive endothelial cells, and co-localized with VEGF and p-p38 MAPK in PDR membranes. Immunoreactivity for p-?BC, however, was undetectable in endothelial cells of the normal retinas, where p-p38 MAPK immunoreactivity was less marked than PDR membranes. CONCLUSION: Phosphorylation of ?BC, in particular, phosphorylation on Ser59 by p-p38 MAPK may play a potential role as a molecular chaperon for VEGF in the pathogenesis of epiretinal membranes in PDR.

Association of vascular endothelial growth factor -634G/C and receptor for advanced glycation end products G82S gene polymorphisms with diabetic retinopathy

Asmaa Kamal, Khaled Abu Eleinen and Ibrahem Siam — 2016/8/15 0:00:00
AIM: To investigate the association of receptor for advanced glycation end products (RAGE) G82S and vascular endothelial growth factor (VEGF) -634 G/C gene polymorphisms with diabetic retinopathy (DR). METHODS: Our cross-sectional study included 61 diabetic patients, 12 of them had proliferative diabetic retinopathy (PDR), 15 had non proliferative diabetic retinopathy (NPDR), 34 had no diabetic retinopathy (NDR) and 61 healthy controls. Participants were tested for RAGE G82S and VEGF -634 G/C polymorphisms by polymerase chain reaction-restriction fragment length polymorphism. RESULTS: We found a significant association between VEGF -634 G/C polymorphism and PDR as PDR patients had increased incidence of VEGF -634 CC genotype compared to NDR patients [odds ratio for CC vs (GC+GG)=6.5, 95% CI=1.5-27.8, P=0.021]. Also VEGF -634 CC genotype and C allele were significantly higher in the PDR than in NPDR patients, which is a novel finding in our study (P=0.024, 0.009 respectively). The mean triglycerides level was significantly higher in diabetic patients with CC genotype (P=0.01) as compared to patients with other genotypes. All cases and control subjects were of the same heterozygous RAGE 82G/S genotype. CONCLUSION: Patients carrying VEGF -634 C polymorphism have a higher risk of PDR development, so VEGF -634 G/C polymorphism could be used as a predictive marker for PDR in diabetic patients. We could not find a significant association between RAGE G82S polymorphism and DR.

Inhibition of choroidal neovascularization by lentivirus-mediated PEDF gene transfer in rats

Ya-Jie Yu, Bin Mo, Lu Liu, Yan-Kun Yue, Chang-Li Yue and Wu Liu — 2016/8/15 0:00:00
AIM: To evaluate the effects of lentivirus-mediated pigment epithelium-derived factor (PEDF) gene transfer performed in treatment of rats with established choroidal neovascularization (CNV), and investigates the mechanism by which PEDF inhibits CNV in rats. METHODS: Brown Norway (BN) rats (n=204) were induced by exposure to a laser, and then randomly assigned to 3 groups: no treatment; treatments with intravitreal injection of lentivirus-PEDF-green fluorescent protein (GFP) or lentivirus-control GFP (free fluorescent protein). Following induction and treatment, the CNV tissue was assessed for form, size and vessel leakage by fluorescein fundus angiography (FFA), optical coherence tomography (OCT), histopathology, and examination of choroidal flat mounts. VEGF, Flk-1, and PEDF expression were evaluated by real-time polymerase chain reaction (PCR) and Western blot. RESULTS: A stable laser-induced rat model of CNV was successfully established, and used to demonstrate lentivirus-mediated PEDG gene transfer by intravitreal injection. Expression of green fluorescence labelled PEDF was observed in the retina up to 28d after injection. An intravitreal injection of lentivirus-PEDF-GFP at 7d led to a significant reduction in the size, thickness and area of CNV showed by FFA, OCT and choroidal flat mounts. PEDF was up-regulated while VEGF and Flk-1 were down-regulated in the lentivirus-PEDF-GFP group. The differences in VEGF and Flk-1 expression in the control and lentivirus-PEDF groups at 7, 14, 21 and 28d after laser induction were all statistically significant. CONCLUSION: Lentivirus-mediated PEDF gene transfer is effective for use in treatment of laser-induced CNV, and PEDF exerts its therapeutic effects by inhibiting expression of VEGF and Flk-1.

The involvement of proline-rich protein Mus musculus predicted gene 4736 in ocular surface functions

Xia Qi, Sheng-Wei Ren, Feng Zhang and Yi-Qiang Wang — 2016/8/15 0:00:00
AIM: To research the two homologous predicted proline-rich protein genes, Mus musculus predicted gene 4736 (MP4) and proline-rich protein BstNI subfamily 1 (Prb1) which were significantly upregulated in cultured corneal organs when encountering fungal pathogen preparations. This study was to confirm the expression and potential functions of these two genes in ocular surface. METHODS: A Pseudomonas aeruginosa keratitis model was established in Balb/c mice. One day post infection, mRNA level of MP4 was measured using real-time polymerase chain reaction (PCR), and MP4 protein detected by immunohistochemistry (IHC) or Western blot using a customized polyclonal anti-MP4 antibody preparation. Lacrimal glands from normal mice were also subjected to IHC staining for MP4. An online bioinformatics program, BioGPS, was utilized to screen public data to determine other potential locations of MP4. RESULTS: One day after keratitis induction, MP4 was upregulated in the corneas at both mRNA level as measured using real-time PCR and protein levels as measured using Western blot and IHC. BioGPS analysis of public data suggested that the MP4 gene was most abundantly expressed in the lacrimal glands, and IHC revealed that normal murine lacrimal glands were positive for MP4 staining. CONCLUSION: MP4 and Prb1 are closely related with the physiology and pathological processes of the ocular surface. Considering the significance of ocular surface abnormalities like dry eye, we propose that MP4 and Prb1 contribute to homeostasis of ocular surface, and deserve more extensive functional and disease correlation studies.

Human β-NGF gene transferred to cat corneal endothelial cells

2016/7/12 0:00:00
AIM: To transfect the cat corneal endothelial cells (CECs) with recombinant human β-nerve growth factor gene adeno-associated virus (AAV-β-NGF) and to observe the effect of the expressed β-NGF protein on the proliferation activity of cat CECs. METHODS: The endothelium of cat cornea was torn under the microscope and rapidly cultivated in Dulbecco’s modified Eagle's medium (DMEM) to form single layer CECs and the passage 2 endothelial cells were used in this experiment. The recombinant human AAV-β-NGF was constructed. The recombinant human AAV-β-NGF was transferred into cat CECs directly. Three groups were as following: normal CEC control group, CEC-AAV control group and recombinant CEC-AAV-β-NGF group. Forty-eight hours after transfection, the total RNA was extracted from the CEC by Trizol. The expression of the β-NGF target gene detected by fluorescence quantitative polymerase chain reaction; proliferation activity of the transfected CEC detected at 48h by MTT assay; the percentage of G1 cells among CECs after transfect was detected by flow cytometry method (FCM); cell morphology was observed under inverted phase contrast microscope. RESULTS: The torn endothelium culture technique rapidly cultivated single layer cat corneal endothelial cells. The self-designed primers for the target gene and reference gene were efficient and special confirmed through electrophoresis analysis and DNA sequencing. Forty-eight hours after transfect, the human β-NGF gene mRNA detected by fluorescence quantitative polymerase chain reaction showed that there was no significant difference between normal CEC control group and CEC-AAV control group (P>0.05); there was significant difference between two control groups and recombinant CEC-AAV-β-NGF group (P<0.05). MTT assay showed that transfect of recombinant AAV-β-NGF promoted the proliferation activity of cat CEC, while there was no significant difference between normal CEC control group and CEC-AAV control group (P>0.05). FCM result showed that the percentage of G1cells in CEC-AAV-NGF group was 76.8% while that in normal CEC control group and CEC-AAV control group was 46.6% and 49.8%. CONCLUSION: Recombinant AAV-β-NGF promotes proliferation in cat CECs by expressing bioactive β-NGF protein in high efficiency and suggests that its modulation can be used to treat vision loss secondary to corneal endothelial dysfunction.

Anterior segment dysgenesis correlation with epithelial-mesenchymal transition in Smad4 knockout mice

2016/7/12 0:00:00
AIM: To explore the molecular mechanisms in lens development and the pathogenesis of Peters anomaly in Smad4 defective mice. METHODS: Le-Cre transgenic mouse line was employed to inactivate Smad4 in the surface ectoderm selectively. Pathological techniques were used to reveal the morphological changes of the anterior segment in Smad4 defective eye. Immunohistochemical staining was employed to observe the expression of E-cadherin, N-cadherin and α-SMA in anterior segment of Smad4 defective mice and control mice at embryonic (E) day 16.5. Real-time quantitative polymerase chain reaction (qPCR) was performed to detect the expression of Snail, Zeb1, Zeb2 and Twist2 in lens of Smad4 defective mice and control mice at E16.5. Statistical evaluations were performed using the unpaired Student’s t-test (two-tailed) by SPSS 11.0 software. RESULTS: Conditional deletion of Smad4 on eye surface ectoderm resulted in corneal dysplasia, iridocorneal angle closure, corneolenticular adhesions and cataract resembling Peters anomaly. Loss of Smad4 function inhibited E-cadherin expression in the lens epithelium cells and corneal epithelium cells in Smad4 defective eye. Expression of N-cadherin was up-regulated in corneal epithelium and corneal stroma. Both E-cadherin and N-cadherin were down-regulated at the future trabecular meshwork region in mutant eye. The qPCR results showed that the expression of Twist2 was increased significantly in the mutant lens (P<0.01). CONCLUSION: Smad4 is essential to eye development and likely a candidate pathogenic gene to Peters anomaly by regulating epithelial-mesenchymal transition. Twist2 can be regulated by Smad4 and plays an essential role in lens development.

Promotion on the differentiation of retinal Müller cells into retinal ganglion cells by Brn-3b

Zhen-Kai Wu, Lan Cao, Xue-Yong Zhang, Wei-Tao Song and Xiao-Bo Xia — 2016/7/12 17:34:43
AIM: To investigate the role of Brn-3b in differentiation process of stem cells derived from retinal Müller cells into the ganglion cell. METHODS: The passage culture method of Müller cells from retina of newborn Sprague Dawley rats was carried out by repeated incomplete pancreatic enzyme digestion method. The cells were detected by fluorescence-activated cell sorter (FACS), immunohistochemistry technology and reverse transcription-polymerase chain reaction (RT-PCR) to determine the purity. The third passage of cells was induced in the serum-free dedifferentiation medium. The expression of the specific markers Ki-67 and nestin of retinal stem cells was measured by RT-PCR and Western blot. The cell proliferation of retinal stem cells was detected by 5-ethynyl-2'-deoxyuridine (Edu) staining. The cells were randomly divided into 5 groups as follows: group A: Brn-3bsiRNA group; group B: Brn-3b control siRNA group; group C: pGC-Brn-3b-green fluorescent protein (GFP) group; group D: pGC-GFP group; group E: control group (without any handling). The purified Müller cells were cultured for 3-7d, then, the percentage of ganglion cells was counted by immunofluorescence staining. RESULTS: FACS demonstrated the purity of retinal Müller cells was more 97.44%. A few spherical cell spheres appeared. Immunofluorescence staining showed that stem cells within the spheres were positive for retinal stem cell-specific markers nestin (red fluorescence, 92.94%±6.48%) and Ki-67 (green fluorescence, 85.96%±6.04%). Meanwhile, RT-PCR analysis showed cell spheres in the culture to have expressed a battery of transcripts characteristic of stem cells such as nestin and Ki-67, which were absent in the Müller cells. Western blot analysis further confirmed the expression of nestin and Ki-67 in the cell spheres but not in the Müller cells. Edu staining showed most of the nuclei within the cell spheres were stained red (82.80%±6.65%), suggesting the new cell spheres had the capacity for effective proliferation. The statistics result showed the difference between Brn-3bsiRNA group and Brn-3b control siRNA group or the control group was significant (F=15, P＜0.05), while the difference between Brn-3b control siRNA group or the control group was not statistically significant (P＞0.05). CONCLUSION: The repeated incomplete pancreatic enzyme digestion method is an efficient and practical method to purify retinal Müller cells. Retinal stem cells were successfully cloned in the dedifferentiational medium. Retinal Müller cells are accessible sources of retinal stem cells. Brn-3b is an important regulatory gene in stem cells differentiated into retinal ganglion cell.

Promotion of axon regeneration and inhibition of astrocyte activation by alpha A-crystallin on crushed optic nerve

Wei-Yang Shao, Xiao Liu, Xian-Liang Gu, Xi Ying, Nan Wu, Hai-Wei Xu and Yi Wang — 2016/7/12 0:00:00
AIM: To explore the effects of αA-crystallin in astrocyte gliosis after optic nerve crush (ONC) and the mechanism of α-crystallin in neuroprotection and axon regeneration. METHODS: ONC was established on the Sprague-Dawley rat model and αA-crystallin (10-4 g/L, 4 μL) was intravitreously injected into the rat model. Flash-visual evoked potential (F-VEP) was examined 14d after ONC, and the glial fibrillary acidic protein (GFAP) levels in the retina and crush site were analyzed 1, 3, 5, 7 and 14d after ONC by immunohistochemistry (IHC) and Western blot respectively. The levels of beta Tubulin (TUJ1), growth-associated membrane phosphoprotein-43 (GAP-43), chondroitin sulfate proteoglycans (CSPGs) and neurocan were also determined by IHC 14d after ONC. RESULTS: GFAP level in the retina and the optic nerve significantly increased 1d after ONC, and reached the peak level 7d post-ONC. Injection of αA-crystallin significantly decreased GFAP level in both the retina and the crush site 3d after ONC, and induced astrocytes architecture remodeling at the crush site. Quantification of retinal ganglion cell (RGC) axons indicated αA-crystallin markedly promoted axon regeneration in ONC rats and enhanced the regenerated axons penetrated into the glial scar. CSPGs and neurocan expression also decreased 14d after αA-crystallin injection. The amplitude (N1-P1) and latency (P1) of F-VEP were also restored. CONCLUSION: Our results suggest α-crystallin promotes the axon regeneration of RGCs and suppresses the activation of astrocytes.

Expression of microRNAs in fibroblast of pterygium

Joon H. Lee, Sun-Ah Jung, Young-A Kwon, Jae-Lim Chung and Ungsoo Samuel Kim — 2016/7/12 0:00:00
AIM: To screen microRNAs (miRNAs) and set up target miRNAs in pterygium. METHODS: Primary fibroblasts were isolated from pterygium and Tenon's capsule and cultured. Immunocytochemical analysis and Western blotting were performed to confirm the culture of fibroblasts. In all, 1733 miRNAs were screened in the first step by using GeneChip® miRNA3.0 Array. Specific miRNAs involved in the pathogenesis of pterygium were subsequently determined using the following criteria: 1) high reproducibility in a repetitive test; 2) base log value of >7.0 for both control and pterygial fibroblasts; and 3) log ratio of >1.0 between pterygial fibroblasts and control fibroblasts. RESULTS: Primary screening showed that 887/1733 miRNAs were up-regulated and 846/1733 miRNAs were down-regulated in pterygial fibroblasts compared with those in control fibroblasts. Of the 1733 miRNAs screened, 4 miRNAs, namely, miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p and miRNA-411a-5p, met the above-mentioned criteria. Primary screening showed that these 4 miRNAs were up-regulated in pterygial fibroblasts compared with control fibroblasts and that miRNA-143a-3p had the highest mean ratio compared with the miRNAs in control fibroblasts. CONCLUSION: miRNA-143a-3p, miRNA-181a-2-3p, miRNA-377-5p and miRNA-411a-5p are up-regulated in pterygial fibroblasts compared with control fibroblasts, suggesting their involvement in the pathogenesis of pterygium.

Endothelial nitric oxide synthase deficiency influences normal cell cycle progression and apoptosis in trabecular meshwork cells

Qiong Liao, Yan-Ming Huang, Wei Fan, Chan Li and Hong Yang — 2016/6/16 0:00:00
AIM: To clarify how the endothelial nitric oxide synthase (eNOS, NOS3) make effect on outflow facility through the trabecular meshwork (TM). METHODS: Inhibition of NOS3 gene expression in human TM cells were conducted by three siRNAs. Then the mRNA and protein levels of NOS3 in siRNA-treated and negative control (NC) cells were determined, still were the collagen, type IV, alpha 1 (COL4A1) and fibronectin 1 by real-time PCR and Western blot analysis. In addition, NOS3 concentrations in culture supernatant fluids of TM cells were measured. Cell cycle and cell apoptosis analysis were performed using flow cytometry. RESULTS: The mRNA level of NOS3 was decreased by three different siRNA interference, similar results were obtained not only of the relative levels of NOS3 protein, but also the expression levels of COL4A1 and fibronectin 1. The number of cells in S phase was decreased, while contrary result was obtained in G2 phase. The number of apoptotic cells in siRNA-treated groups were significant increased compared to the NC samples. CONCLUSION: Abnormal NOS3 expression can make effects on the proteins levels of extracellular matrix component (e.g. fibronectin 1 and COL4A1). Reduced NOS3 restrains the TM cell cycle progression at the G2/M-phase transition and induced cell apoptosis.

Matrix metalloproteinase-9 and vascular endothelial growth factor expression change in experimental retinal neovascularization

Yu Di, Qing-Zhu Nie and Xiao-Long Chen — 2016/6/16 0:00:00
AIM: To investigate the signal transduction mechanism of matrix metalloproteinase-9 (MMP-9) mediated- vascular endothelial growth factor (VEGF) expression and retinal neovascularization (RNV) in oxygen-induced retinopathy (OIR) model. METHODS: C57BL/6J mice were divided into four groups: control group, OIR group, OIR control group (phosphate-buffered saline by intravitreal injection) and treated group [tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) by intravitreal injection]. OIR model was established in C57BL/6J mice exposed to 75%±2% oxygen for 5d. mRNA level and protein expression of MMP-9, TIMP-1 and VEGF were measured by real-time polymerase chain reaction and Western blotting, and located by immunohistochemistry. RESULTS: Levels of MMP-9 and VEGF in retina were significantly increased in animals with OIR and OIR control group. Levels of TIMP-1 in retina was significantly reduced in animals with OIR and OIR control group. Furthermore, a significant correlation was found between MMP-9 and VEGF. Intravitreal injection of TIMP-1 significantly reduced MMP-9 and VEGF expression of the OIR mouse model (all P<0.05). CONCLUSION: These results demonstrate that MMP-9-mediated up-regulation of VEGF promotes RNV in retinopathy of prematurity (ROP). TIMP-1 may be a potential target for the prevention and treatment of ROP.

Repression of retinal microvascular endothelial cells by transthyretin under simulated diabetic retinopathy conditions

Jun Shao and Yong Yao — 2016/6/16 0:00:00
AIM: To investigate biological effects of transthyretin (TTR) on the development of neovascularization under simulated diabetic retinopathy (DR) condition associated with high glucose and hypoxia. METHODS: Human retinal microvascular endothelial cells (hRECs) were cultured in normal and simulated DR environments with high glucose and hypoxia. The normal serum glucose concentration is approximately 5.5 mmol/L; thus, hyperglycemia was simulated with 25 mmol/L glucose, while hypoxia was induced using 200 μmol/L CoCl2. The influence of TTR on hRECs and human retinal pigment epithelial cells (hRPECs) was determined by incubating the cells with 4 μmol/L TTR in normal and abnormal media. A co-culture system was then employed to evaluate the effects of hRPECs on hRECs. RESULTS: Decreased hRECs and hRPECs were observed under abnormal conditions, including high-glucose and hypoxic media. In addition, hRECs were significantly inhibited by 4 μmol/L exogenous TTR during hyperglycemic culture. During co-culture, hRPECs inhibited hRECs in both the normal and abnormal environments. CONCLUSION: hREC growth is inhibited by exogenous TTR under simulated DR environments with high-glucose and hypoxic, particularly in the medium containing 25 mmol/L glucose. hRPECs, which manufacture TTR in the eye, also represses hRECs in the same environment. TTR is predicted to inhibit the proliferation of hRECs and neovascularization.

Histopathological changes in retinas and F-ERG features of streptozotocin-induced diabetic rats treated with ozone

Ting-Yu Xie, Qin Li and Xue-Yi Chen — 2016/6/16 0:00:00
AIM: To study the histopathological changes in the retina and flash electroretinogram (F-ERG) features of ozone-treated streptozotocin (STZ)-induced diabetic rats. METHODS: Seventy male Sprague Dawley rats were grouped as follows: blank group (GB, n=10), model control group (GM, n=18), ozone group (GO3, n=19), and oxygen group (GO2, n=18). The model was induced by single intraperitoneal injection of STZ. Ozone or oxygen enteroclysm was given twice per week for 4wk. F-ERG and histopathological examinations were performed one month after treatment. RESULTS: Under dark adaption, as compared to GB, the other groups each had differential decreases in the a-wave amplitudes (P<0.05); the latencies were delayed in GM, GO2, and GO3 rats (P<0.05). Similar results were observed under light adaption, with the exception that the a-wave of the amplitudes (F=0.28, P>0.05). There were significant differences in the apoptosis index among the groups (P<0.05). Under ozone treatment, apoptosis was decreased in GO3 as compared to GM and GO2. CONCLUSION: Ozone administration alleviates nerve damage and reduces pathology and apoptosis in the retinas of diabetic rats.

Effect of periocular injection of celecoxib and propranolol on ocular level of vascular endothelial growth factor in a diabetic mouse model

2016/6/16 0:00:00
AIM: To investigate the effects of periocular injection of propranolol and celecoxib on ocular levels of vascular endothelial growth factor (VEGF) in a diabetic mouse model. METHODS: Forty 4-6wk BALB-C male mice weighing 20-25 g were used. The study groups included: non-diabetic control (group 1), diabetic control (group 2), diabetic propranolol (group 3), and diabetic celecoxib (group 4). After induction of type 1 diabetes by streptozotocin, propranolol (10 μg) and celecoxib (200 μg dissolved in carboxymethylcellulose 0.5%) were injected periocularly. The ocular level of VEGF was measured in all the study groups using enzyme-linked immuno sorbent assay (ELISA) method. RESULTS: Ocular VEGF level was significantly increased (1.25 fold) in the diabetic control group when compared to the non-diabetic group one week after induction with streptozotocin (P=0.002). Both periocular propranolol and celecoxib significantly reduced ocular VEGF levels (P=0.047 and P<0.001, respectively). The effect was more pronounced with celecoxib. CONCLUSION: The periocular administration of propranolol and celecoxib can significantly reduce ocular VEGF levels in a diabetic mouse model.

Effect of long-term weightlessness on retina and optic nerve in tail-suspension rats

2016/6/16 0:00:00
AIM: To evaluate the effect of long-term weightlessness on retina and optic nerve in tail-suspension (TS) rats. METHODS: A stimulated weightlessness model was established by suspending rats’ tail. After 12wk, the ultrastructure and the number of optic nerve axons were observed by transmission electron microscope. The number of survival retinal ganglion cells (RGCs) was calculated by fluorescent gold retrograde labeling. Retina cells apoptosis was detected by TUNEL staining. The function of optic nerve and retina was evaluated by the visual evoked potential (VEP) and oscillatory potentials (Ops). RESULTS: The optic nerve axons were swollen and sparsely aligned, and the lamellar separation and myelin disintegration occurred after 12wk in TS rats. The density of optic nerve axons was 32.23±3.92 (vs 37.43±4.13, P=0.0145), the RGCs density was 1645±46 cells/mm2 (vs 1867±54 cells/mm2 P=0.0000), the incidence rate of retinal cells apoptosis was 5.38%±0.53% (vs 4.75%±0.54%, P=0.0238), the amplitude of VEP-P100 was 15.43±2.14 µV (vs 17.67±2.17 µV, P=0.0424), the latency of VEP-P100 was 69.05±5.34ms (vs 62.43±4.87ms P=0.0143) and the sum amplitude of Ops was 81.05±8.34 µV (vs 91.67±10.21 µV, P=0.0280) in TS group and the control group, respectively. CONCLUSION: Long-term weightlessness can induce the ultrastructural changes and functional depress of the optic nerve, as well as retinal cell damages in TS rats.

Role of tumor necrosis factor-alpha in zebrafish retinal neurogenesis and myelination

Xu-Dan Lei, Yan Sun, Shi-Jiao Cai, Yang-Wu Fang, Jian-Lin Cui and Yu-Hao Li — 2016/6/16 0:00:00
AIM: To investigate the role of tumor necrosis factor-alpha (TNF-α) in zebrafish retinal development and myelination. METHODS: Morpholino oligonucleotides (MO), which are complementary to the translation start site of the wild-type embryonic zebrafish TNF-α mRNA sequence, were synthesized and injected into one- to four-cell embryos. The translation blocking specificity was verified by Western blotting using an anti-TNF-α antibody, whole-mount in situ hybridization using a hepatocyte-specific mRNA probe ceruloplasmin (cp), and co-injection of TNF-α MO and TNF-α mRNA. An atonal homolog 7 (atoh7) mRNA probe was used to detect neurogenesis onset. The retinal neurodifferentiation was analyzed by immunohistochemistry using antibodies Zn12, Zpr1, and Zpr3 to label ganglion cells, cones, and rods, respectively. Myelin basic protein (mbp) was used as a marker to track and observe the myelination using whole-mount in situ hybridization. RESULTS: Targeted knockdown of TNF-α resulted in specific suppression of TNF-α expression and a severely underdeveloped liver. The co-injection of TNF-α MO and mRNA rescued the liver development. Retinal neurogenesis in TNF-α morphants was initiated on time. The retina was fully laminated, while ganglion cells, cones, and rods were well differentiated at 72 hours post-fertilization (hpf). mbp was expressed in Schwann cells in the lateral line nerves and cranial nerves from 3 days post-fertilization (dpf) as well as in oligodendrocytes linearly along the hindbrain bundles and the spinal cord from 4 dpf, which closely resembled its endogenous profile. CONCLUSION: TNF-α is not an essential regulator for retinal neurogenesis and optic myelination.

Histopathologic effects of a low molecular weight heparin on bone healing in rats: a promising adjuvant in dacryocystorhinostomy

Mehmet Numan Alp, Ozdamar Fuad Oken, Mustafa Fevzi Sargon and Ahmet Ucaner — 2016/6/16 0:00:00
AIM: To investigate the effect of short-term prophylactic dose of a low molecular weight heparin (LMWH) drug on the bone healing process in an animal model simulating the osteotomy obtained in dacryocystorhinostomy. METHODS: Forty male Wistar albino rats were divided into 2 groups. Subcutaneous injections of enoxaparin 1 mg/kg (enoxaparin-treated group) and saline solution (control group) were performed once daily for 4d, beginning on the first preoperative day. The osteotomy was created at the femoral diaphysis in all animals by using a Kirschner wire. Each group was further divided into 2 subgroups depending on the timing of the second operation, 14 or 21d following initial osteotomy. Patent osteotomy area on the second and the third weeks in each group were calculated by using a computer software on digital micrographs. RESULTS: The patent osteotomy areas at the second and the third weeks were significantly larger in the enoxaparin-treated group than those of the control group (P<0.001 for each time-period). In the control group, the patent osteotomy area at the third week of healing was significantly smaller than that of the second week (P=0.003), whereas there was no significant difference between these two measurements in the enoxaparin-treated group (P=0.185). CONCLUSION: Short-term administration of enoxaparin resultes in a significant alteration in bone healing at 14 and 21d after injury. LMWHs can be regarded as promising alternative adjuvants in dacryocystorhinostomy after being evaluated with further clinical and animal studies.

Sustained-release genistein from nanostructured lipid carrier suppresses human lens epithelial cell growth

2016/5/23 0:00:00
AIM: To design and investigate the efficacy of a modified nanostructured lipid carrier loaded with genistein (Gen-NLC) to inhibit human lens epithelial cells (HLECs) proliferation. METHODS: Gen-NLC was made by melt emulsification method. The morphology, particle size (PS), zeta potentials (ZP), encapsulation efficiency (EE) and in vitro release were characterized. The inhibition effect of nanostructured lipid carrier (NLC), genistein (Gen) and Gen-NLC on HLECs proliferation was evaluated by cell counting kit-8 (CCK-8) assay, gene and protein expression of the proliferation marker Ki67 were evaluated with real-time quantitative polymerase chain reaction (RT-qPCR) and immunofluorescence analyses. RESULTS: The mean PS of Gen-NLC was 80.12±1.55 nm with a mean polydispersity index of 0.11±0.02. The mean ZP was -7.14±0.38 mV and the EE of Gen in the nanoparticles was 92.3%±0.73%. Transmission electron microscopy showed that Gen-NLC displayed spherical-shaped particles covered by an outer-layer structure. In vitro release experiments demonstrated a prolonged drug release for 72h. The CCK-8 assay results showed the NLC had no inhibitory effect on HLECs and Gen-NLC displayed a much more prominent inhibitory effect on cellular growth compared to Gen of the same concentration. The mRNA and protein expression of Ki67 in LECs decreased significantly in Gen-NLC group. CONCLUSION: Sustained drug release by Gen-NLCs may impede HLEC growth.

Use of high-throughput targeted exome sequencing in genetic diagnosis of Chinese family with congenital cataract

Ming-Fu Ma,Lian-Bing Li,Yun-Qi Pei and Zhi Cheng — 2016/5/23 0:00:00
AIM: To identify disease-causing mutation in a congenital cataract family using enrichment of targeted genes combined with next-generation sequencing. METHODS: A total of 371 known genes related to inherited eye diseases of the proband was selected and captured, followed by high-throughput sequencing. The sequencing data were analyzed by established bioinformatics pipeline. Validation was performed by Sanger sequencing. RESULTS: A recurrent heterozygous non-synonymous mutation c.130G>A (p.V44M) in the GJA3 gene was identified in the proband. The result was confirmed by Sanger sequencing. The mutation showed co-segregation with the disease phenotype in the family but was not detected in unaffected controls. CONCLUSION: Targeted exome sequencing is a rapid, high-throughput and cost-efficient method for screening known genes and could be applied to the routine gene diagnosis of congenital cataract.

Human melanopsin-AAV2/8 transfection to retina transiently restores visual function in rd1 mice

2016/5/23 0:00:00
AIM: To explore whether ectopic expression of human melanopsin can effectively and safely restore visual function in rd1 mice. METHODS: Hematoxylin-eosin staining of retinal sections from rd1 mice was used to detect the thickness of the outer nuclear layer to determine the timing of surgery. We constructed a human melanopsin-AAV2/8 viral vector and injected it into the subretinal space of rd1 mice. The Phoenix Micron IV system was used to exclude the aborted injections, and immunohistochemistry was used to validate the ectopic expression of human melanopsin. Furthermore, visual electrophysiology and behavioral tests were used to detect visual function 30 and 45d after the injection. The structure of the retina was compared between the human melanopsin-injected group and phosphate buffer saline (PBS)-injected group. RESULTS: Retinas of rd1 mice lost almost all of their photoreceptors on postnatal day 28 (P28). We therefore injected the human melanopsin-adeno-associated virus (AAV) 2/8 viral vector into P30 rd1 mice. After excluding aborted injections, we used immunohistochemistry of the whole mount retina to confirm the ectopic expression of human melanopsin by co-expression of human melanopsin and YFP that was carried by a viral vector. At 30d post-injection, visual electrophysiology and the behavioral test significantly improved. However, restoration of vision disappeared 45d after human melanopsin injection. Notably, human melanopsin-injected mice did not show any structural differences in their retinas compared with PBS-injected mice. CONCLUSION: Ectopic expression of human melanopsin effectively and safely restores visual function in rd1 mice.

In silico analysis of a disease-causing mutation in PCDH15 gene in a consanguineous Pakistani family with Usher phenotype

Shamim Saleha,Muhammad Ajmal,Muhammad Jamil,Muhammad Nasir and Abdul Hameed — 2016/5/23 0:00:00
AIM: To map Usher phenotype in a consanguineous Pakistani family and identify disease-associated mutation in a causative gene to establish phenotype-genotype correlation. METHODS: A consanguineous Pakistani family in which Usher phenotype was segregating as an autosomal recessive trait was ascertained. On the basis of results of clinical investigations of affected members of this family disease was diagnosed as Usher syndrome (USH). To identify the locus responsible for the Usher phenotype in this family, genomic DNA from blood sample of each individual was genotyped using microsatellite Short Tandem Repeat (STR) markers for the known Usher syndrome loci. Then direct sequencing was performed to find out disease associated mutations in the candidate gene. RESULTS: By genetic linkage analysis, the USH phenotype of this family was mapped to PCDH15 locus on chromosome 10q21.1. Three different point mutations in exon 11 of PCDH15 were identified and one of them, c.1304A>C was found to be segregating with the disease phenotype in Pakistani family with Usher phenotype. This, c.1304A>C transversion mutation predicts an amino-acid substitution of aspartic acid with an alanine at residue number 435 (p.D435A) of its protein product. Moreover, in silico analysis revealed conservation of aspartic acid at position 435 and predicated this change as pathogenic. CONCLUSION: The identification of c.1304A>C pathogenic mutation in PCDH15 gene and its association with Usher syndrome in a consanguineous Pakistani family is the first example of a missense mutation of PCDH15 causing USH1 phenotype. In previous reports, it was hypothesized that severe mutations such as truncated protein of PCDH15 led to the Usher I phenotype and that missense variants are mainly responsible for non-syndromic hearing impairment.

Anti-proliferative effect of olmesartan on Tenon's capsule fibroblasts

Xuan Wang,Ya-Zhi Fan,Liang Yao and Jian-Ming Wang — 2016/5/23 0:00:00
AIM: To evaluate the inhibitive effect of olmesartan to fibroblast proliferation and the anti-scarring effect in Tenon’s capsule, both in vitro and in vivo. METHODS: Human primary Tenon’s capsule fibroblasts were cultured in vitro, treated with up titrating concentrations of olmesartan. The rate of inhibition was tested with methyl thiazol tetrazolium (MTT) method. Real-time PCR was performed to analyze changes in mRNA expressions of the fibrosis-related factors: matrix metalloproteinase-2 (MMP-2), tissue inhibitor of metalloproteinase (TIMP-1,2) and proliferating cell nuclear antigen (PCNA). Thirty rabbits were divided into 5 groups (3, 7, 14, 21, and 28d). A rabbit conjunctiva flap model was created in each eye. Olmesartan solution was injected subconjunctivally and then evaluated its anti-proliferation and anti-fibrosis effects through the histological morphology and immunohistochemistry of MMP-2 and PCNA in each group. Only the 7d group was treated with Masson’s trichrome to compare the neovascularization in the subconjunctiva area. RESULTS: In vitro, cultured Tenon's capsule human fibroblasts showed a dose dependent inhibition by olmesartan in MTT. Olmesartan reduced mRNA expressions of MMP-2 and PCNA but increased mRNA expressions of TIMP-1 and TIMP-2. In vivo, the rabbit eyes treated with olmesartan at 3rd, 7th, 14th and 21st days demonstrated a significant reduced expressions of MMP-2 and PCNA compared with control eye, no significant difference observed in 28th day group. The cellular proliferation and neovascularization was suppressed by olmesartan in Masson’s trichrome observation. CONCLUSION: By inhibiting fibroblasts in vitro and in vivo, olmesartan prevents the proliferation and activity of fibroblasts in scar tissue formation, which might benefit glaucoma filtering surgery.

Effect of sodium tungstate on visual evoked potentials in diabetic rats

2016/5/23 0:00:00
AIM: To evaluate the effect of sodium tungstate on visual evoked potentials (VEPs) in diabetic rats. METHODS: Wistar rats were randomly divided into three groups as normal control, diabetic control and diabetic rats treated with sodium tungstate. Diabetes was induced by single intraperitoneal injection of streptozotocin (50 mg/kg). Sodium tungstate [40 mg/(kg·d)] was administered for 12wk and then VEPs were recorded. Additionally, thiobarbituric acid reactive substance (TBARS) levels were measured in brain tissues. RESULTS: The latencies of P1, N1, P2, N2 and P3 waves were significantly prolonged in diabetic rats compared with control group. Diabetes mellitus caused an increase in the lipid peroxidation process that was accompanied by changes in VEPs. However, prolonged latencies of VEPs for all components returned to control levels in sodium tungstate-treated group. The treatment of sodium tungstate significantly decreased brain TBARS levels and depleted the prolonged latencies of VEP components compared with diabetic control group. CONCLUSION: Sodium tungstate shows protective effects on visual pathway in diabetic rats, and it can be worthy of further study for potential use.

Observation on ultrastructure and histopathology of cornea following femtosecond laser-assisted deep lamellar keratoplasty for acute corneal alkaline burns

2016/4/15 0:00:00
AIM: To demonstrate the changes in ultrastructure and histopathology of the cornea in acute corneal alkaline burns after femtosecond laser-assisted deep lamellar keratoplasty. METHODS: The New Zealand white rabbits treated with alkaline corneal burn were randomized into two groups, Group A (16 eyes) with femtosecond laser-assisted deep lamellar keratoplasty 24h after burn and Group B (16 eyes) without keratoplasty as controls. All eyes were evaluated with transmission electron microscopy (TEM) at 1, 2, 3, and 4wk follow-up, then all corneas were tested by hematoxylin and eosin staining histology. RESULTS: The corneal grafts in Group A were transparent, while those in Group B showed corneal stromal edema and loosely arranged collagen fibers. One week after treatment, TEM revealed the intercellular desmosomes in the epithelial layers and intact non-dissolving nuclei in Group A. At week 4, the center of the corneas in Group A was transparent with regularly arranged collagen fibers and fibroblasts in the stroma. In Group B, squamous cells were observed on the corneal surface and some epithelial cells were detached. CONCLUSION: Femtosecond laser-assisted deep lamellar keratoplasty can suppress inflammatory responses, prevent toxic substance-induced injury to the corneal endothelium and inner tissues with quicker recovery and better visual outcomes.

Research on mouse model of grade II corneal alkali burn

Jun-Qiang Bai,Hai-Feng Qin and Shi-Hong Zhao — 2016/4/15 0:00:00
AIM: To choose appropriate concentration of sodium hydroxide (NaOH) solution to establish a stable and consistent corneal alkali burn mouse model in grade II. METHODS: The mice (n=60) were randomly divided into four groups and 15 mice each group. Corneal alkali burns were induced by placing circle filter paper soaked with NaOH solutions on the right central cornea for 30s. The concentrations of NaOH solutions of groups A, B, C, and D were 0.1 mol/L, 0.15 mol/L , 0.2 mol/L, and 1.0 mol/L respectively. Then these corneas were irrigated with 20 mL physiological saline (0.9% NaCl). On day 7 postburn, slit lamp microscope was used to observe corneal opacity, corneal epithelial sodium fluorescein staining positive rate, incidence of corneal ulcer and corneal neovascularization, meanwhile pictures of the anterior eyes were taken. Cirrus spectral domain optical coherence tomography was used to scan cornea to observe corneal epithelial defect and corneal ulcer. RESULTS: Corneal opacity scores () were not significantly different between the group A and group B (P=0.097). Incidence of corneal ulcer in group B was significantly higher than that in group A (P=0.035). Incidence of corneal ulcer and perforation rate in group B was lower than that in group C. Group C and D had corneal neovascularization, and incidence of corneal neovascularization in group D was significantly higher than that in group C (P=0.000). CONCLUSION: Using 0.15 mol/L NaOH can establish grade II mouse model of corneal alkali burns.

Expression of indoleamine 2,3-dioxygenase in a murine model of Aspergillus fumigatus keratitis

2016/4/15 0:00:00
AIM: To observe the presence and expression of indoleamine 2,3-dioxygenase (IDO) during the corneal immunity to Aspergillus fumigatus (A. fumigatus) in the murine models. METHODS: The murine model of fungal keratitis was established by smearing with colonies of A. fumigatus after scraping central epithelium of cornea and covering with contact lenses in C57BL/6 mice. The mice were randomly divided into control group, sham group and A. fumigatus keratitis group. The cornea was monitored daily using a slit lamp and recorded disease score after infection. Corneal lesion was detected by immunofluorescence staining. IDO mRNA and protein were also detected by quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and Western blot. RESULTS: The disease score and slit lamp photography indicated that disease severity was consistent with corneal inflammation in the murine models, and the disease scores in A. fumigatus keratitis group were obviously higher than those in the sham group. By immunofluorescence staining, IDO was mainly localized in corneal epithelium and stroma in the murine corneal tissues with A. fumigatus keratitis. Compared with the sham group, IDO mRNA expression was significantly enhanced in corneal epithelium infected by A. fumigatus. Furthermore, IDO protein expression detected by Western blot was in accord with transcript levels of IDO mRNA measured by qRT-PCR. IDO protein expression was enhanced after A. fumigatus infection compared with the sham group. CONCLUSION: IDO is detected in corneal epithelium and stroma locally, which indicates IDO takes part in the pathogenesis of A. fumigatus keratitis and plays a key role in immune regulation at the early stage.

Cytotoxic effect and possible mechanisms of Tetracaine on human corneal epithelial cells in vitro

Xin Pang and Ting-Jun Fan — 2016/4/15 0:00:00
AIM: To demonstrate the cytotoxic effect and possible mechanisms of Tetracaine on human corneal epithelial (HCEP) cells in vitro. METHODS: In vitro cultured HCEP cell were treated with Tetracaine hydrochloride at different doses for different times, and their morphology, viability, and plasma membrane permeability were detected by light microscopy, methyl thiazolyl tetrazolium (MTT) assay, and acridine orange (AO)/ethidium bromide (EB) staining, respectively. Their cell cycle progression, phosphatidylserine orientation in plasma membrane, and mitochondrial membrane potential (MTP) were assessed by flow cytometry. DNA fragmentation, ultrastructure, caspase activation, and the cytoplasmic apoptosis inducing factor (AIF) and cytochrome c (Cyt. c) along with the expression of B-cell lymphoma-2 (Bcl-2) family proteins were examined by gel electrophoresis, transmission electron microscope, enzyme linked immunosorbent assay (ELISA), and Western blot, respectively. RESULTS: After exposed to Tetracaine at doses from 10.0 to 0.3125 g/L, the HCEP cells showed dose- and time-dependent morphological abnormality and typical cytopathic effect, viability decline, and plasma membrane permeability elevation. Tetracaine induced phosphatidylserine externalization, DNA fragmentation, G1 phase arrest, and ultrastructural abnormality and apoptotic body formation. Furthermore, Tetracaine at a dose of 0.3125 g/L also induced caspase-3, -9 and -8 activation, MTP disruption, up-regulation of the cytoplasmic amount of Cyt. c and AIF, the expressions of Bax and Bad, and down-regulation of the expressions of Bcl-2 and Bcl-xL. CONCLUSION: Tetracaine above 0.3125 g/L (1/32 of its clinical applied dosage) has a dose- and time-dependent cytotoxicity to HCEP cells in vitro, with inducing cell apoptosis via a death receptor-mediated mitochondrion-dependent pathway.

Cytotoxicity of pilocarpine to human corneal stromal cells and its underlying cytotoxic mechanisms

Xiao-Long Yuan,Qian Wen,Meng-Yu Zhang and Ting-Jun Fan — 2016/4/15 0:00:00
AIM: To examine the cytotoxic effect of pilocarpine, an anti-glaucoma drug, on human corneal stromal (HCS) cells and its underlying cytotoxic mechanisms using an in vitro model of non-transfected HCS cells. METHODS: After HCS cells were treated with pilocarpine at a concentration from 0.15625 g/L to 20.0 g/L, their morphology and viability were detected by light microscopy and MTT assay. The membrane permeability, DNA fragmentation and ultrastructure were examined by acridine orange (AO)/ethidium bromide (EB) double-staining. DNA electrophoresis and transmission electron microscopy (TEM), cell cycle, phosphatidylserine (PS) orientation and mitochondrial transmembrane potential (MTP) were assayed by flow cytometry (FCM). And the activation of caspases was checked by ELISA. RESULTS: Morphology observations and viability assay showed that pilocarpine at concentrations above 0.625 g/L induced dose- and time-dependent morphological abnormality and viability decline of HCS cells. AO/EB double-staining, DNA electrophoresis and TEM noted that pilocarpine at concentrations above 0.625 g/L induced dose- and/or time-dependent membrane permeability elevation, DNA fragmentation, and apoptotic body formation of the cells. Moreover, FCM and ELISA assays revealed that 2.5 g/L pilocarpine also induced S phase arrest, PS externalization, MTP disruption, and caspase-8, -9 and -3 activation of the cells. CONCLUSION: Pilocarpine at concentrations above 0.625 g/L (1/32 of its clinical therapeutic dosage) has a dose- and time-dependent cytotoxicity to HCS cells by inducing apoptosis in these cells, which is most probably regulated by a death receptor-mediated mitochondrion-dependent signaling pathway.

Time-dependent matrix metalloproteinases and tissue inhibitor of metalloproteinases expression change in fusarium solani keratitis

Qian Li,Xin-Rui Gao,Hong-Ping Cui,Li-Li Lang,Xiu-Wen Xie and Qun Chen — 2016/4/15 0:00:00
AIM: To investigate matrix metalloproteinases (MMPs) and tissue inhibitor of metalloproteinases (TIMPs) expression during the progress of fusarium solani (F.solani) keratitis in a rat model. METHODS: A rat model of F.solani keratitis was produced using corneal scarification and a hand-made contact lens. MMPs and TIMPs expressiond were explored in this rat model of F.solani keratitis using real-time polymerase chain reaction (PCR) and DIF. GM6001 (400 μmol/mL) was used to treat infected corneas. The keratitis duration, amount and area of corneal neovascularization (CNV) were evaluated. RESULTS: MMP-3 expression was 66.3 times higher in infected corneas compared to normal corneas. MMP-8, -9, and -13 expressions were significantly upregulated in the mid-period of the infection, with infected-to-normal ratios of 4.03, 39.86, and 5.94, respectively. MMP-2 and -7 expressions increased in the late period, with the infected-to-normal ratios of 5.94 and 16.22, respectively. TIMP-1 expression was upregulated in the early period, and it was 43.17 times higher in infected compared to normal corneas, but TIMP-2, -3, and -4 expressions were mildly downregulated or unchanged. The results of DIF were consistent with the result of real-time PCR. GM6001, a MMPs inhibitor, decreased the duration of F.solani infection and the amount and area of CNV. CONCLUSION: MMPs and TIMPs contributed into the progress of F.solani keratitis.

In vivo bioluminescence imaging of hyperglycemia exacerbating stem cells on choroidal neovascularization in mice

2016/4/15 0:00:00
AIM: To investigate the influence of hyperglycemia on the severity of choroidal neovascularization (CNV), especially the involvement of bone marrow-derived cells (BMCs) and underlying mechanisms. METHODS: BMCs from firefly luciferase (Fluc)/green fluorescent protein (GFP) double transgenic mice were transplanted into C57BL/6J wide-type mice. The recipient mice were injected intraperitoneally with streptozotocin (STZ) daily for 5 consecutive days to induce diabetes mellitus (DM), followed by CNV laser photocoagulation. The BMCs recruitment in CNV exposed to hyperglycemia was firstly examined in Fluc/GFP chimeric mice by in vivo optical bioluminescence imaging (BLI) and in vitro Fluc assays. The CNV severity was evaluated by H&E staining and choroidal flatmount. The expression of vascular endothelial growth factor (VEGF) and stromal cell derived factor-1 (SDF-1) was detected by Western Blot. RESULTS: BLI showed that the BMCs exerted dynamic effects in CNV model in Fluc/GFP chimeric mice exposed to hyperglycemia. The signal intensity of transplanted Fluc+GFP+ BMCs in the DM chimeric mice was significantly higher than that in the control chimeric mice with CNV induction at days 5, 7, 14 and 21 (121861.67±9948.81 vs 144998.33±13787.13 photons/second/cm2/sr for control and DM mice, P5d<0.05; 178791.67±30350.8 vs 240166.67±22605.3, P7d<0.05; 124176.67±16253.52 vs 196376.67±18556.79, P14d<0.05; 97951.60±10343.09 vs 119510.00±14383.76, P21d<0.05), which was consistent with in vitro Fluc assay at day 7 [relative light units of Fluc (RLU1)], 215.00±52.05 vs 707.33±88.65, P<0.05; RLU1/ relative light units of renilla luciferase (RLU2), 0.90±0.17 vs 1.83±0.17, P<0.05]. The CNVs in the DM mice were wider than those in the control group at days 5, 7, 14 and 21 (147.83±17.36 vs 220.33±20.17 μm, P5d<0.05; 212.17±24.63 vs 326.83±19.49, P7d<0.05; 163.17±18.24 vs 265.17±20.55, P14d<0.05; 132.00±10.88 vs 205.33±12.98, P21d<0.05). The average area of CNV in the DM group was larger at 7d (20688.67±3644.96 vs 32218.00±4132.69 μm2, P<0.05). The expression of VEGF and SDF-1 was enhanced in the DM mice. CONCLUSION: Hyperglycemia promots the vasculogenesis of CNV, especially the contribution of BMCs, which might be triggered by VEGF and SDF-1 production.

Anti-inflammatory effect of Heliotropium indicum Linn on lipopolysaccharide-induced uveitis in New Zealand white rabbits

2016/4/15 0:00:00
AIM: To investigate the anti-inflammatory effect of an aqueous whole plant extract of Heliotropium indicum (HIE) on endotoxin-induced uveitis in New Zealand white rabbits. METHODS: Clinical signs of uveitis including flares, iris hyperemia and miosis, were sought for and scored in 1.0 mg/kg lipopolysaccharide (LPS) -induced uveitic rabbits treated orally with HIE (30-300 mg/kg), prednisolone (30 mg/kg), or normal saline (10 mL/kg). The number of polymorphonuclear neutrophils infiltrating, the protein concentration, as well as levels of tumor necrosis factor-α (TNF-α), prostaglandin E2 (PGE2), and monocyte chemmoattrant protein-1 (MCP-1) in the aqueous humor after the various treatments were also determined. A histopathological study of the anterior uveal was performed. RESULTS: The extract and prednisolone-treatment significantly reduced (P≤0.001) both the clinical scores of inflammation (1.0-1.8 compared to 4.40±0.40 in the normal saline-treated rabbits) and inflammatory cells infiltration. The level of protein, and the concentrations of TNF-α, PGE2 and MCP-1 in the aqueous humor were also significantly reduced (P≤0.001). Histopathological studies showed normal uveal morphology in the HIE and prednisolone-treated rabbits while normal saline-treated rabbits showed marked infiltration of inflammatory cells. CONCLUSION: The HIE exhibits anti-inflammatory effect on LPS-induced uveitis possibly by reducing the production of pro-inflammatory mediators.

Acellular ostrich corneal stroma used as scaffold for construction of tissue-engineered cornea

2016/3/11 0:00:00
AIM: To assess acellular ostrich corneal matrix used as a scaffold to reconstruct a damaged cornea. METHODS: A hypertonic saline solution combined with a digestion method was used to decellularize the ostrich cornea. The microstructure of the acellular corneal matrix was observed by transmission electron microscopy (TEM) and hematoxylin and eosin (H&E) staining. The mechanical properties were detected by a rheometer and a tension machine. The acellular corneal matrix was also transplanted into a rabbit cornea and cytokeratin 3 was used to check the immune phenotype. RESULTS: The microstructure and mechanical properties of the ostrich cornea were well preserved after the decellularization process. In vitro, the methyl thiazolyl tetrazolium results revealed that extracts of the acellular ostrich corneas (AOCs) had no inhibitory effects on the proliferation of the corneal epithelial or endothelial cells or on the keratocytes. The rabbit lamellar keratoplasty showed that the transplanted AOCs were transparent and completely incorporated into the host cornea while corneal turbidity and graft dissolution occurred in the acellular porcine cornea (APC) transplantation. The phenotype of the reconstructed cornea was similar to a normal rabbit cornea with a high expression of cytokeratin 3 in the superficial epithelial cell layer. CONCLUSION: We first used AOCs as scaffolds to reconstruct damaged corneas. Compared with porcine corneas, the anatomical structures of ostrich corneas are closer to those of human corneas. In accordance with the principle that structure determines function, a xenograft lamellar keratoplasty also confirmed that the AOC transplantation generated a superior outcome compared to that of the APC graft.

Effects of corneal stromal cell- and bone marrow-derived endothelial progenitor cell-conditioned media on the proliferation of corneal endothelial cells

2016/3/11 0:00:00
AIM: To explore the effects of conditioned media on the proliferation of corneal endothelial cells (CECs) and to compare the efficiency of different conditioned media (CM). METHODS: Rat CECs, corneal stromal cells (CSCs), bone marrow-derived endothelial progenitor cells (BEPCs), and bone marrow-derived mesenchymal stem cells (BMSCs) were isolated and cultured in vitro. CM was collected from CSCs, BEPCs, and BMSCs. CECs were cultivated in different culture media. Cell morphology was recorded, and gene and protein expression were analyzed. RESULTS: After grown in CM for 5d, CECs in each experimental group remained polygonal, in a cobblestone-like monolayer arrangement. Immunocytofluorescence revealed positive expression of Na+/K+-ATP, aquaporin 1 (AQP1), and zonula occludens 1 (ZO-1). Based on quantitative polymerase chain reaction (qPCR) analysis, Na+/K+-ATP expression in CSC-CM was notably upregulated by 1.3-fold (±0.036) (P<0.05, n=3). The expression levels of ZO-1, neuron specific enolase (NSE), Vimentin, paired homebox 6 (PAX6), and procollagen type Ⅷ (COL8A1) were notably upregulated in each experimental group. Each CM had a positive effect on CEC proliferation, and CSC-CM had the strongest effect on proliferation. CONCLUSION: CSC-CM, BEPC-CM, and BMSC-CM not only stimulated the proliferation of CECs, but also maintained the characteristic differentiated phenotypes necessary for endothelial functions. CSC-CM had the most notable effect on CEC proliferation.

Neuroprotective effect of systemic and/or intravitreal rosuvastatin administration in rat glaucoma model

2016/3/11 0:00:00
AIM: To evaluate the neuroprotective effect of rosuvastatin, in a rat experimental glaucoma model. METHODS: Ocular hypertension was induced in right eyes of Long-Evans rats (n=30) by cauterization of three episcleral veins. Left eyes were defined as controls. Rats were divided into five groups: oral rosuvastatin, intravitreal rosuvastatin, oral+intravitreal rosuvastatin, intravitreal sham and glaucoma without intervention. Rats were sacrificed at day 14. Retinal ganglion cell (RGC) number was assessed by histopathological analysis. Terminal deoxynucleotidyl transferase-mediated dUTP-nick end-labeling (TUNEL) staining and the expression of glial fibrillary acidic protein (GFAP) in RGC layer was also examined. RESULTS: A significant intraocular pressure (IOP) elevation was seen (P=0.002). Elevated IOP resulted in a significant decrease in number of RGCs in group 5 (70.33±8.2 cells/mm²) when compared with controls (92.50±13.72 cells/mm²; P=0.03). The RGC number in group 1 (92.4±7.3 cells/mm²) was significantly higher than group 5 (P=0.03). The numbers of RGC in groups 2, 3 (57.3±8.2 cells/mm², 60.5±12.9 cells/mm²) were comparable with that of group 5 (P=0.18 and P=0.31). The apoptosis rates with TUNEL staining were also parallel to RGC number. Animals with experimentally induced glaucoma showed an increase in retinal GFAP immunoreactivity. CONCLUSION: Decrease in RGC loss and apoptosis suggest the neuroprotective potential of oral rosuvastatin treatment in a rat model of ocular hypertension. However intravitreal rosuvastatin showed a contrary effect and further studies are required.

Safety and efficacy of photodynamic therapy using BCECF-AM compared to mitomycin C in controlling post-operative fibrosis in a rabbit model of subscleral trabeculectomy

2016/3/11 0:00:00
AIM: To evaluate the safety and efficacy of cellular photoablation using BCECF-AM [2’, 7’-bis-(2-carboxyethyl)-5-(and-6)-carboxyfluorescein, acetoxymethyl ester mixed isomers] as a method to control postoperative fibrosis in subscleral trabeculectomy (SST) compared to mitomycin C (MMC) in a rabbit model. METHODS: A comparative prospective case-control animal study was conducted. Fourteen rabbits were subjected to SST with intraoperative use of wound modulating agents (MMC or BCECF-AM) of the right eye (study groups I and II respectively) and SST without use of intraoperative wound modulating agents for the left eye (control group II). Two rabbits 4 eyes were considered as control group I with no surgical intervention. BCECF-AM was injected subconjunctivally 30min before surgery followed by intraoperative illumination with diffuse blue light for 10min. Antifibrotic efficacy was established by clinical response and histological examination. Clinical response was assessed by measuring intraocular pressure (IOP) at day 1, 3, 5, 7, 14, 21 postoperatively. Success was defined by ＞20.0% reduction in IOP from the preoperative values without anti-glaucoma medications. RESULTS: The mean percentage of reduction was 35.0% in the study group I with only one eye (14.3%) had 12.5% reduction. The mean percentage of reduction was 28.0 % in the study group II with two eyes (28.6%) in study group II had 14.2% reduction each. Regarding the control group II, the mean percentage of reduction was 14.3 % with 64.3% eyes had ＜20.0% reduction. There was a highly statistically significant difference between each of the study groups (right eyes) and the corresponding control group II (left eyes) as regards the mean postoperative IOP values started from day 5 in both study groups and this highly significant difference remained so till the end of the follow up period. Histologically, MMC treated blebs showed thinning of conjunctival epithelium with marked reduction of the goblet cells relative to control. Marked sub-epithelial edema was seen along with variable collagen dispersion. Mild cellularity was noted in sub-epithelial tissue. BCECF-AM treated blebs showed normal conjunctival epithelial thickness with abundant goblet cells. Mild sub-epithelial edema was noted along with moderate collagen dispersion. No histological abnormality was noted in the ciliary body or the cornea in any of the studied groups. CONCLUSION: Cellular photoablation using BCECF-AM is a safe and effective wound modulating agent to control postoperative fibrosis in trabeculectomy. However MMC considered as a more potent adjuvant to trabeculectomy than BCECF-AM in promoting IOP reduction.

Expression and effect of proline hydroxylase domain 2 in retina of diabetic rats

Zhen Li,Yi-Qiao Xing,Wei Cui and Qiang Lu — 2016/3/11 0:00:00
AIM: To observe the expression of proline hydroxylase domain 2 (PHD2) in the retina of diabetic rats and investigate the relationship between PHD2 and relevant intraocular vascular proliferation factors. METHODS: Sixty male specific pathogen free (SPF) Sprague-Dawley (SD) rats were randomly divided into two groups: the diabetic group and the control group. The rats in the diabetic group were intraperitoneally injected with 60 mg/kg (0.60 mL/100g) of streptozotocin to induce a diabetic rat model. The rats in the control group were injected with an equal volume of sodium citrate buffer solution by the same method. Hematoxylin-eosin (HE) staining and immumofluorescence (IF) method were adopted to observe the pathological changes of retinal tissues and the expression of PHD2, glial fibrillary acidic protein (GFAP), vascular endothelial growth factor (VEGF) by 8wk. RT-PCR method was applied to detect the expressions of mRNA of PHD2, VEGF and GFAP. The relationship between PHD2 and other vascular proliferation factors was analyzed. RESULTS: HE staining showed that there was the retinal tissue edema in the diabetic group, and the arrangement was in disorder, and proliferation could be seen. IF staining: in the retina of normal rats, PHD2 was not expressed, GFAP and VEGF were mainly expressed in astrocytes; while in the diabetic rats, PHD2, GFAP and VEGF staining showed strong positivity in all retinal layers, mainly in neurogliocytes. PHD2 was co-expressed with VEGF and GFAP. The mRNA expression levels of PHD2, GFAP and VEGF in the diabetic group were obviously higher than that in the control group,respectively 1.83 times, 1.75 times and 2.08 times. The difference had statistical significance (P<0.01). CONCLUSION: The high expression of PHD2 in the retina of early-stage diabetic rats might result from secretion of neurogliocytes induced by local high-concentration blood glucose, thus promoting the expression of VEGF and GFAP. PHD2 plays an important role during the occurrence of diabetic retinopathy.

Effect of cytokeratin 17 on retinal pigment epithelium degeneration and choroidal neovascularization

Yi Shen,Pei Zhuang,Tao Xiao and George CY Chiou — 2016/3/11 0:00:00
AIM: To study the effects of cytokeratin 17 (CK17) on sodium iodate (NaIO3) induced rat retinal pigment epithelium (RPE) degeneration, laser induced rat choroidal neovascularization (CNV), and oxidative stress of human retinal pigment epithelium cells (ARPE-19) and human umbilical vein endothelial cell (HUVEC). METHODS: Thirty 8-week-old male Brown Norway rats were randomly divided into 3 groups, 10 rats in control group treated with solvent alone; 10 rats in NaIO3 group treated with solvent and 35 mg/kg NaIO3 injection through hypoglossal vein and 10 rats in CK17+NaIO3 group treated with 1% CK17 eye drop 3 times a day for 1wk before and 4wk after NaIO3 injection. RPE function was measured with c-wave of electroretinogram (ERG). Another 20 rats were randomly divided into 2 groups. Of them 10 rats in CK17 group were anesthetized to receive Nd:YAG laser and given 1% CK17 eye drop before same as above; 10 rats in control were received Nd:YAG and treated with solvent. The development of choroidal neovascularization (CNV) was determined by fundus fluorescein angiography (FFA) performed on 4wk after laser. Methylthiazoly tetrazolium (MTT) assay was used to study effect of CK17 on various oxidants induced injury in ARPE-19 and HUVEC in vitro. RESULTS: Four weeks after NaIO3 injection, the c-wave amplitude of ERG was 0.393±0.02 V in the control group, 0.184±0.018 V in NaIO3 group and 0.3±0.01 V in CK17+NaIO3 group. There was a significant reversal of the c-wave by CK17 as compared to NaIO3 group (P<0.01). Four weeks after laser, the size of the CNV lesion was 2.57±0.27 mm2 in control group and 1.64±0.08 mm2 in CK17 group. The lesion size significantly diminished in CK17 group (P<0.01). The in vitro results showed CK17 also reversed the various oxidants induced injuries in ARPE-19 at the dose of 100 μg/mL and enhanced the injury in HUVECs at different concentrations. CONCLUSION: CK17 can significantly protect RPE from NaIO3 induced degeneration in vivo and in vitro and also could reverse the various oxidants induced injuries in vitro. It inhibits the development of CNV in rat model, interfered with vascular endothelial cell proliferation in vitro.

Safety of intravitreal quinupristin/dalfopristin in an animal model

2016/3/11 0:00:00
AIM: To determine whether different intravitreal doses of quinupristin/dalfopristin lead to electroretinographic or histological changes in the rabbit retina over one month period after injection. METHODS: Eighteen New Zealand white rabbits were divided into three treatment groups (groups 1 to 3) and different intravitreal doses of quinupristin/dalfopristin were tested in each group. The right eye was injected with the drug and the left eye received intravitreal injection of 5% dextrose water and served as control eye. The doses delivered to each group were 0.1 mg/0.1 mL, 1 mg/0.1 mL and 10 mg/0.1 mL. Simultaneous, bilateral, dark-adapted electroretinography and clinical images of both eyes were obtained in all groups before injection (baseline) and after 7, 14, 21 and 28d, followed by enucleation for histological examination. RESULTS: Subjects in the group 1 showed no signs of toxicity in the electroretinogram when compared with groups 2 and 3 (Kruskall-Wallis test, P=0.000). By day 7, no electrical response to light stimuli was recorded in the treated eyes in groups 2 and 3, consistent with severe damage due to retinal toxicity. Light microscopy revealed no significant histopathological changes in the group 1, while rabbits in groups 2 and 3 had signs of granulomatous inflammation in most cases. CONCLUSION: Intravitreal 0.1 mg/0.1 mL doses of quinupristin/dalfopristin do not lead to electroretinographic or histological signs of retinal toxicity compared with 1 mg/0.1 mL and 10 mg/0.1 mL in this rabbit model.

Co-regulation of Dectin-1 and TLR2 in inflammatory response of human corneal epithelial cells induced by Aspergillus fumigates

Gui-Qiu Zhao,Xue-Yan Qiu,Jing Lin,Qing Li,Li-Ting Hu,Qian Wang and Hui Li — 2016/2/4 0:00:00
AIM: To investigate the co-regulation of dendritic cell-associated C-type lectin-1 (Dectin-1), Toll-like receptor 2 (TLR2), and relative chemotactic factors in the Telomease-immortalized human corneal epithelial (THCE) cells after exposure to Aspergillus fumigatus (Af) hyphae. METHODS: The normal THCE cells were investigated as control. After cultured in vitro with Af hyphae, with or without laminarin and anti-TLR2 antibody for 4, 8, 16 and 24h, THCE cells were harvested. The expression of Dectin-1, TLR2, CXCL1 and CXCL8 mRNA were measured by real-time quantitative polymerase chain reaction at the stimulation of 4, 8 and 16h separately. The protein expression of Dectin-1 and TLR2 were analyzed at 8, 16, and 24h by Western blot. RESULTS: The mRNA expression of CXCL1 and CXCL8 increased in THCE cells after stimulated by Af hyphae. The stimulatory effects on these inflammatory chemokines were shown in a dose-dependent manner and reached the peak at 8h. Af hyphae significantly stimulated the production of Dectin-1 and TLR2 in THCE cells at both mRNA and protein levels. The protein of Dectin-1 and TLR2 gradually increased till 16h. While pretreated with laminarin (a Dectin-1 inhibitor), the expression of TLR2, CXCL1 and CXCL8 all decreased dramatically at the peak point. Interestingly, when pretreated with TLR2 neutralizing antibody, the expression of Dectin-1, CXCL1 and CXCL8 also decreased dramatically at the peak point. CONCLUSION: These findings suggest that Dectin-1 and TLR2 co-regulated with each other after treated with inactive Af hyphae in the THCE cells, and they contribute together to the inflammatory responses by induction of chemokines CXCL1 and CXCL8.

Expression of S100B during the innate immune of corneal epithelium against fungi invasion

2016/2/4 0:00:00
AIM: To explore the expression of S100B in corneal epithelial cells under Aspergillus stimulation both in vivo and in vitro. METHODS: Immortalized human corneal epithelial cells (HCECs) were exposed to inactive Aspergillus fumigatus (A. fumigatus) conidia at 0, 4, 8, 12, 16, and 24h respectively. The corneas of Wistar rats were exposed to active A. fumigatus at 0, 12, 24, 48h and the normal rat corneas were used for normal control. The mRNA level of S100B was evaluated by real time quantitative reverse transcription-polymerase chain reaction (qRT-PCR). S100B protein expression in cornea epithelium was detected by immunohistochemical/immunocytochemical staining (IHC/ICC). RESULTS: Histopathology revealed a significant inflammatory cell infiltration in fungal keratitis human and rat cornea. Corneal epithelial cells didn’t express or rarely express S100B at baseline. A. fumigatus significantly induced S100B mRNA expression in cultured corneal epithelial cells in a time depended manner in vitro, the mRNA began to rise significantly at 8h in vitro (P<0.05) and continue to rise as time prolonged (P<0.01). In vivo, S100B mRNA level was low in the normal corneas. However, it was increased in keratitis corneas from 12h after infection (P<0.05) and reached to a peak at 24h (P<0.001). Immunochemistry revealed an obvious staining in fungal keratitis corneas as well as immortalized HCECs compared to the normal ones respectively, indicating an increased expression of S100B protein. CONCLUSION: S100B exists in corneal epithelial cells and is over-expressed under A. fumigatus stimulation. S100B may play an important role in the innate immune response of the corneal epithelium during A. fumigatus infection.

Uncovering the profile of mutations of transforming growth factor beta-induced gene in Chinese corneal dystrophy patients

Xiao-Dan Hao,Yang-Yang Zhang,Peng Chen,Su-Xia Li and Ye Wang — 2016/2/4 0:00:00
AIM: To uncover the mutations profile of transforming growth factor beta-induced (TGFBI) gene in Chinese corneal dystrophy patients and further investigate the characteristics of genotype-phenotype correlations. METHODS: Forty-two subjects (6 unrelated families including 15 patients and 8 unaffected members, and 19 sporadic patients) of Chinese origin were subjected to phenotypic and genotypic characterization. The corneal phenotypes of patients were documented by slit lamp photography. Mutation screening of the coding regions of TGFBI was performed by direct sequencing. RESULTS: We detected four corneal dystrophy types. The most frequent phenotypes were granular corneal dystrophy (GCD) (including 3 families and 8 sporadic patients) and lattice corneal dystrophy (LCD) (including 2 families and 9 sporadic patients). The next phenotypes were corneal dystrophy of Bowman layer (CDB) (1 family and 1 sporadic patient) and epithelial basement membrane dystrophy (EBMD) (1 sporadic patient). Six distinct mutations responsible for TGFBI corneal dystrophies were identified in 30 individuals with corneal dystrophies. Those were, p.R124H mutation in 1 family and 2 sporadic patients with GCD, p.R555W mutation in 2 families and 3 sporadic patients with GCD, p.R124C mutation in 2 families and 7 sporadic patients with LCD, p.A620D mutation in 1 sporadic patient with LCD, p.H626R mutation in 1 sporadic patient with LCD, and p.R555Q in 1 family and 1 sporadic patient with CDB. No mutation was detected in the remaining 3 atypical GCD patients and 1 EBMD patient. CONCLUSION: GCD and LCD are the most frequent phenotypes in Chinese population. R555W was the most common mutation for GCD; R124C was the most common mutation for LCD. Our findings extend the mutational spectrum of TFGBI, and this is the extensively delineated TGFBI mutation profile associated with the various corneal dystrophies in the Chinese population.

Effect of vasoactive intestinal peptide on the wound healing of alkali-burned corneas

2016/2/4 0:00:00
AIM: To study the effect of vasoactive intestinal peptide (VIP) on wound healing in experimental alkali burns of the cornea. METHODS: Twenty-seven albino rabbits, weighing 3.2±0.75 kg were used. Alkali burns were induced on corneas by applying 10 mm Whatman paper No:50 soaked in 1 mol/L NaOH. They have further classified into 5 groups as follows: 1) control group given no treatment (n=5); 2) VIP given subconjunctivally (n=6); 3) VIP injected into anterior chamber (n=6); 4) NaCl 0.9% given subconjunctivally (n=5); 5) NaCl 0.9% given into the anterior chamber (n=5). All treatment protocols except control group were followed by topical eye drops composed of VIP at two hourly intervals for one week from 8 a.m. to 6 p.m. RESULTS: VIP treated groups of rabbits with alkali burns were found to have better wound healing findings histo-pathologically when compared to those of control group who have received no treatment on day 30. No differences were observed between groups in respect to degree of polymorphonuclear leukocytes (PMNL) infiltration and degree of loss of amorphous substrate on day 15. However, PMNL infiltration and degree of loss of amorphous substrate were lower in Groups 2 and 3 when compared to that of control group on day 30 (P(0.05). CONCLUSION: We have shown that VIP has positive effects on alkali induced corneal burns. VIP may inhibit PMNL migration to cornea through an immunomodulatory effect. Inhibition of PMNL migration might reduce the release of collagenases and this might prevent the extracellular amorphous substance loss.

Characterization of intraocular pressure pattern and changes of retinal ganglion cells in DBA2J glaucoma mice

Jing Wang and Yu Dong — 2016/2/4 0:00:00
AIM: To characterize the pattern of intraocular pressure (IOP) change and the deficit of retinal ganglion cells (RGCs) in DBA2J, which is most wellcharacterized chronic glaucoma mouse model and wild type (WT) C57bl/6 mice, and to study the relationship between IOP change and RGCs deficit. METHODS: IOP was monitored with a rebound tonometer in WT C57bl/6 and DBA2J mice from 3 to 15-monthold. Retinal function was evaluated by dark-adapted electroretinogram (ERG) in DBA2J and WT mice of 15monthold. A dye (Neurobiotin) was applied to optic nerve stump to retrograde label RGCs. TO-PRO-3 visualized all nuclei of cells in the RGC layer. RESULTS: The IOP in WT mice was 9.03±0.6 mm Hg on average and did not increase significantly as aging. The IOP in DBA2J mice, arranging from 7.2 to 28 mm Hg, was increasing significantly as aging, and it was normal at 3monthold compared with WT mice, slightly increased from 7-monthold and increased in 50% animals at 11monthold and in 38% animals at 15-monthold. The RGCs density in DBA2J mice started reducing by 7month-old, continuously decreased until reached about 20% of RGC in WT retina by 15monthold. RGC density was not linearly correlated with IOP in 15-monthold DBA2J mice. The amplitude of positive scotopic threshold response, and negative scotopic threshold response of ERG were significantly reduced in DBA2J mice of 15-monthold than that in agepaired WT mice. CONCLUSION: The present study found that DBA2J mice display pathological and functional deficits of the retina that was not linearly correlated with IOP.

Comparison of postoperative corneal changes between dry eye and non-dry eye in a murine cataract surgery model

2016/2/4 0:00:00
AIM: To compare the effects of the surgical insult of cataract surgery on corneal inflammatory infiltration, neovascularization (NV) and lymphangiogenesis (LY) between the dry eye and non-dry eye in murine cataract surgery models. METHODS: We established two groups of animals, one with normal eyes (non-dry eye) and the second with induced dry eyes. In both groups, we used surgical insults to mimic human cataract surgery, which consisted of lens extraction, corneal incision and suture. After harvesting of corneas on the 9th postoperative day and immunohistochemical staining, we compared NV, LY and CD11b+ cell infiltration in the corneas. RESULTS: Dry eye group had significantly more inflammatory infiltration (21.75%±7.17% vs 3.65%±1.49%; P=0.049). The dry eye group showed significantly more NV (48.21%±4.02% vs 26.24%±6.01%; P=0.016) and greater levels of LY (9.27%±0.48% vs 4.84%±1.15%; P=0.007). In corneas on which no surgery was performed, there was no induction of NV in both the dry and non-dry group, but dry eye group demonstrated more CD11b+ cells infiltration than the non-dry eye group (0.360%±0.160% vs 0.023%±0.006%; P=0.068). Dry eye group showed more NV than non-dry eye group in both topical PBS application and subconjunctival PBS injection (P=0.020 and 0.000, respectively). CONCLUSION: In a murine cataract surgery model, preexisting dry eye can induce more postoperative NV, LY, and inflammation in corneal tissue.

Acellular porcine corneal matrix as a carrier scaffold for cultivating human corneal epithelial cells and fibroblasts in vitro

Ju Zhang,Can-Wei Zhang,Li-Qun Du and Xin-Yi Wu — 2015/12/29 0:00:00
AIM: To investigate the feasibility of corneal anterior lamellar reconstruction with human corneal epithelial cells and fibroblasts, and an acellular porcine cornea matrix (APCM) in vitro. METHODS: The scaffold was prepared from fresh porcine corneas which were treated with 0.5% sodium dodecyl sulfate (SDS) solution and the complete removal of corneal cells was confirmed by hematoxylin-eosin (HE) staining and 4’, 6-diamidino-2-phenylindole (DAPI) staining. Human corneal fibroblasts and epithelial cells were cultured with leaching liquid extracted from APCM, and then cell proliferative ability was evaluated by MTT assay. To construct a human corneal anterior lamellar replacement, corneal fibroblasts were injected into the APCM and cultured for 3d, followed by culturing corneal epithelial cells on the stroma construction surface for another 10d. The corneal replacement was analyzed by HE staining, and immunofluorescence staining. RESULTS: Histological examination indicated that there were no cells in the APCM by HE staining, and DAPI staining did not detect any residual DNA. The leaching liquid from APCM had little influence on the proliferation ability of human corneal fibroblasts and epithelial cells. At 10d, a continuous 3 to 5 layers of human corneal epithelial cells covering the surface of the APCM was observed, and the injected corneal fibroblasts distributed within the scaffold. The phenotype of the construction was similar to normal human corneas, with high expression of cytokeratin 12 in the epithelial cell layer and high expression of vimentin in the stroma. CONCLUSION: Corneal anterior lamellar replacement can be reconstructed in vitro by cultivating human corneal epithelial cells and fibroblasts with an acellular porcine cornea matrix. This laid the foundation for the further transplantation in vivo.

Inhibition of zymosan-induced cytokine and chemokine expression in human corneal fibroblasts by triptolide

Yang Liu,Jing Li,Ye Liu,Ping Wang and Hui Jia — 2015/12/29 0:00:00
AIM: To investigate the effects of triptolide on proinflammatory cytokine and chemokine expression induced by the fungal component zymosan in cultured human corneal fibroblasts (HCFs). METHODS: HCFs were cultured in the absence or presence of zymosan or triptolide. The release of interleukin (IL)-6, IL-8, and monocyte chemoattractant protein-1 (MCP-1) into culture supernatants was measured with enzyme-linked immunosorbent assays. The cellular abundance of the mRNAs for these proteins was determined by reverse transcription and real-time polymerase chain reaction analysis. The phosphorylation of mitogen-activated protein kinases (MAPKs) and the endogenous nuclear factor-κB (NF-κB) inhibitor IκB-α was examined by immunoblot analysis. The release of lactate dehydrogenase (LDH) activity from HCFs was measured with a colorimetric assay. RESULTS: Triptolide inhibited the zymosan-induced release of IL-6, IL-8, and MCP-1 from HCFs in a concentration- and time-dependent manner. It also inhibited the zymosan-induced up-regulation of IL-6, IL-8, and MCP-1 mRNA abundance in these cells. Furthermore, triptolide attenuated zymosan-induced phosphorylation of the MAPKs extracellular signal-regulated kinase (ERK), c-Jun NH2-terminal kinase (JNK), and p38 as well as the phosphorylation and degradation of IκB-α. Triptolide did not exhibit cytotoxicity for HCFs. CONCLUSION: Triptolide inhibited proinflammatory cytokine and chemokine production by HCFs exposed to zymosan, with this action likely being mediated by suppression of MAPK and NF-κB signaling pathways. This compound might thus be expected to limit the infiltration of inflammatory cells into the cornea associated with fungal infection.

Aquaporin-1 down regulation associated with inhibiting cell viability and inducing apoptosis of human lens epithelial cells

Hong-Hua Zheng,Guo-Xing Xu,Jian Guo,Li-Cheng Fu and Yao Yao — 2015/12/29 0:00:00
AIM: To investigate the role of Aquaporin-1 (AQP-1) in lens epithelial cells (LECs) and its potential target genes. AQP-1 is specifically expressed in LECs of eyes and is significant for lens homeostasis and transparency maintenance. Herein, AQP-1 expression in LECs was investigated to evaluate its influence on cell survival in association with its potential role in cataract formation. METHODS: LECs were transfected with lentivirus carrying AQP-1 small interfering RNA (siRNA). Real-time polymerase chain reaction (PCR) and Western blotting were conducted to detect AQP-1 expression in LECs from different groups. Meanwhile, cell counting kit-8 (CCK-8) assay and flow cytometry were performed to measure LEC proliferation and apoptosis, respectively. RESULTS: AQP-1 expression was significantly reduced in LECs, both at mRNA and protein levels (P<0.05), after siRNA treatment. Decreased cell viability was detected by CCK-8 assay in LECs with siRNA interference, compared to control cells (P<0.05). The apoptosis rate significantly increased in cells after siRNA interference (P<0.05). CONCLUSION: The decreased cell viability following AQP-1 down regulation is largely due to its induction of apoptosis of LECs. AQP-1 reduction might lead to changes of physiological functions in LECs, which might be associated with the occurrence and development of cataracts.

Effects of lentiviral RNA interference-mediated downregulation of integrin-linked kinase on biological behaviors of human lens epithelial cells

2015/12/29 0:00:00
AIM: To investigate the effects of lentivirus (LV) mediated integrin-linked kinase (ILK) RNA interference (RNAi) on biological behaviors of human lens epithelial cells (LECs). METHODS: Human cataract LECs and immortalized human LEC line, human lens epithelial (HLE) B-3 cells were transfected by lentiviral vector expressing ILK-specific short hairpin RNA (shRNA) and then stimulated by transforming growth factor-? (TGF-??, the silencing of ILK gene and protein was identified by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot methods; biological behaviors including cell cycle and apoptosis, cell morphology, ?-smooth muscle actin (SMA) stress fiber formation and cell migration were examined. RESULTS: Remarkable decreases of ILK protein expression were detected in LECs carrying lentiviral ILK-shRNA vector; flow cytometry revealed arresting of cell cycle progression through the G1/S transition and higher apoptosis rate in ILK-RNAi-LV transfected cells. Less ?-SMA stress fiber formation and migration was observed in ILK-RNAi-LV transfected LECs. CONCLUSION: The present study demonstrated that ILK was an important regulator for LECs proliferation and migration. LV mediated ILK RNAi is an effective way to decrease ILK-regulated cell growth by arresting cell cycle progression and increasing cell apoptosis, as well as, to prevent cell migration by inhibiting TGF-? induced ?-SMA stress fiber formation. Thus, LV mediated ILK RNAi might be useful to prevent posterior capsular opacification.

Effect of NF-κB p65 antisense oligodeoxynucleotide on transdifferentiation of normal human lens epithelial cells induced by transforming growth factor-β2

Chao Liu,Xiao-Li Wu,Xin-Yi Wu,Zhen-Hua Zhang and Xiao-Hua Liu — 2015/12/29 0:00:00
METHODS: NF-κB p65 ASODN and NF-κB p65 missense oligodeoxynucleotide (MSODN) were designed and synthesized. Human lens epithelial cell line (HLE B-3) cells were prepared for study and divided into 7 groups. Control group was HLE B-3 cells cultured in vitro in dulbecco's modified eagle medium (DMEM). T1, T2, and T3 group were HLE B-3 cells cultured in vitro in DMEM with 10 ng/mL TGF-β2 for 6h, 12h, 24h respectively. A+T group was HLE B-3 cells cultured with 10 ng/mL TGF-β2 for 24h after transfected by NF-κB p65 ASODN for 24h. M+T group was HLE B-3 cells cultured with 10 ng/mL TGF-β2 for 24h after transfected by NF-κB p65 MSODN for 24h. The negative control group was HLE B-3 cells cultured with 10 ng/mL TGF-β2 for 24h after cultured with transfer agent (HiPerFect) for 24h. Cell morphology was observed at different time points using an inverted microscope. The expression of NF-κB p65 mRNA was detected with reverse transcription-polymerase chain reaction (RT-PCR), and the expression of α-smooth muscle actin (α-SMA) protein was assayed with ELISA. RESULTS: With the TGF-β2 stimulation prolongation, the expression of NF-κB p65 mRNA and α-SMA protein increased in T1, T2, T3 groups compared with the control group, and the difference was statistically significant (P<0.05). NF-κB p65 ASODN lowered the expression of NF-κB p65 mRNA and α-SMA protein induced by TGF-β2. NF-κB p65 MSODN and HiPerFect did not lower the expression of NF-κB p65 mRNA and α-SMA protein induced by TGF-β2. The difference between control group and A+T group was not statistically significant (P>0.05), but the difference among A+T group and other groups was statistically significant (P<0.05). CONCLUSION: NF-κB p65 ASODN could lower the expression of NF-κB p65 mRNA and α-SMA protein induced by TGF-β2, and antagonized TGF-β2-induced transdifferentiation of HLE B-3 in vitro. NF-κB p65 ASODN could be used as a new biological therapeutic target of posterior capsular opacification.

Involvement of microRNA-181a and Bim in a rat model of retinal ischemia-reperfusion injury

Yu He,Jin-Nan Liu,Jun-Jun Zhang and Wei Fan — 2015/12/29 0:00:00
AIM: To investigate the changes in the expression of microRNA-181a (miR-181a) and Bim in a rat model of retinal ischemia-reperfusion (RIR), to explore their target relationship in RIR and their involvement in regulating apoptosis of retinal ganglion cells (RGCs). METHODS: Target gene prediction for miR-181a was performed with the aid of bioinformatics and Bim was identified as a potential target gene of miR-181a. A rat model of RIR was created by increasing the intraocular pressure. RGCs in the flatmounted retinas were labeled with Brn3, a marker for alive RGCs, by immunofluorescent staining. The changes in the number of RGCs after RIR were recorded. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) was used to determine the expression level of miR-181a in the retina. Bim/Brn3 double immunofluorescence was used to detect the localization of Bim. The expression of Bim in the retina was determined with the aids of Western blot and qRT-PCR. RESULTS: Compared with the negative control group, the density of RGCs was significantly lower in the ischemia/reperfusion (I/R)-24h and I/R-72h groups (P<0.001). The expression level of miR-181a started to decrease at 0h after RIR, and further decreased at 24h and 72h compared with the negative control group (P<0.001). Bim was significantly upregulated at 12h after RIR (P<0.05) and reached peak at 24, 72h compared with the negative control group (P<0.01). Pearson correlation analysis showed that the expression level of Bim was negatively correlated with the expression level of miR-181a and the density of RGCs. CONCLUSION: Bim may be a potential target gene of miR-181a. Both miR-181a and Bim are involved in RGCs death in RIR. RIR may promote RGCs apoptosis in the retina via downregulation of miR-181a and its inhibition on Bim expression.

Differentiation of isolated human umbilical cord mesenchymal stem cells into neural stem cells

2015/12/29 0:00:00
AIM: To investigate whether umbilical cord human mesenchymal stem cell (UC-MSC) was able to differentiate into neural stem cell and neuron in vitro. METHODS: The umbilical cords were obtained from pregnant women with their written consent and the approval of the Clinic Ethnics Committee. UC-MSC were isolated by adherent culture in the medium contains 20% fetal bovine serum (FBS), then they were maintained in the medium contain 10% FBS and induced to neural cells in neural differentiation medium. We investigated whether UC-MSC was able to differentiate into neural stem cell and neuron in vitro by using flow cytometry, reverse transcriptase-polymerase chain reaction (RT-PCR) and immunofluorescence (IF) analyzes. RESULTS: A substantial number of UC-MSC was harvested using the tissue explants adherent method at about 2wk. Flow cytometric study revealed that these cells expressed common markers of MSCs, such as CD105 (SH2), CD73 (SH3) and CD90. After induction of differentiation of neural stem cells, the cells began to form clusters; RT-PCR and IF showed that the neuron specific enolase (NSE) and neurogenic differentiation 1-positive cells reached 87.3%±14.7% and 72.6%±11.8%, respectively. Cells showed neuronal cell differentiation after induced, including neuron-like protrusions, plump cell body, obviously and stronger refraction. RT-PCR and IF analysis showed that microtubule-associated protein 2 (MAP2) and nuclear factor-M-positive cells reached 43.1%±10.3% and 69.4%±19.5%, respectively. CONCLUSION: Human umbilical cord derived MSCs can be cultured and proliferated in vitro and differentiate into neural stem cells, which may be a valuable source for cell therapy of neurodegenerative eye diseases.

Immune oppression array elucidating immune escape and survival mechanisms in uveal melanoma

Fang Hou, Qi-Ming Huang, Dan-Ning Hu, Jost B. Jonas and Wen-Bin Wei — 2016/12/7 0:00:00
AIM: To examine the genetic profile of primary uveal melanoma (UM) as compared to UM in immune escape. METHODS: Dendritic cells (DC) loaded with lysates of UM cells of high metastatic potential were used to stimulate CTLs(CTLs). When CTLs co-cultured with the UM cells, most UM cells could be eliminated. Survival UM cells grew slowly and were considered to be survival variants and examined by a microarray analysis. These differential genes were analyzed further with Venn Diagrams and functions related to immune escape. We additionally examined transcriptional changes of manually selected survival variants of UM cells and of clinical UM samples by quantitative real-time polymerase chain reaction (qRT-PCR), and analyzed the correlation of these expressions and patients’ survival. RESULTS: Gene expression analyses revealed a marked up-regulation of SLAMF7 and CCL22 and a significant down-regulation of KRT10, FXYD3 and ABCC2. The expression of these genes in the relapsed UM was significantly greater than those in primary UM. UM patients with overexpression of these genes had a shorter survival period as compared with those of their underexpression. CONCLUSION: Gene expression, in particular of SLAMF7, CCL22, KRT10, FXYD3 and ABCC2, differed between primary UM cells and survival variants of UM cells.

Effects of retinoic acid receptor-γ on the Aspergillus fumigatus induced innate immunity response in human corneal epithelial cells

Xiao-Chen Wang, Gui-Qiu Zhao, Jing Lin, Cui Li, Nan Jiang and Jie Zhang — 2016/12/7 0:00:00
AIM: To explore the effects of retinoic acid receptor-γ (RARγ) on innate immune responses against Aspergillus fumigatus (A. fumigatus) in cultured human corneal epithelial cells (HCECs). METHODS: The HCECs were stimulated with A. fumigatus hyphae for 0, 2, 4, 8, 12 and 16h. RARγ mRNA and protein levels were tested by quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot. Then HCECs were pretreated with or without BMS961 (RARγ agonist, 1 μg/mL). The mRNA and protein expression of Dectin-1 and the downstream cytokines (TNF-α and IL-6) were determined by qRT-PCR, Western blot and enzyme-linked immunosorbent assay (ELISA). RESULTS: The expression of RARγ was upregulated after stimulation with A. fumigatus. RARγ mRNA began to rise at 4h and peaked at 8h (P<0.001). The protein of RARγ reached to the peak at 16h (P<0.001). Pretreated with BMS961 before A. fumigatus hyphae stimulation, expression of Dectin-1, TNF-α and IL-6 decreased dramatically at mRNA and protein levels. CONCLUSION: HCECs can express RARγ and A. fumigatus hyphae infection can increase RARγ expression. BMS961 can inhibit the expression of Dectin-1 and pro-inflammatory cytokines, and play an anti-inflammatory role in innate immune responses against A. fumigatus.

Expression and regulation of microRNA-29a and microRNA-29c in early diabetic rat cataract formation

Ying Sun, Chun-Mei Lu, Zhen Song, Ke-Ke Xu, Shu-Bin Wu and Zhi-Jian Li — 2016/12/7 0:00:00
AIM: To determine the role of microRNA (miRNA)-29a and miRNA-29c in the regulation of apoptosis in early rat diabetic cataract formation. METHODS: Streptozotocin (STZ)-induced diabetic Sprague-Dawley (SD) rats were used in the study. The expression level of miRNA-29a, miRNA-29c, and BCL2-modifying factor (BMF) in lens epithelial cells (LECs) samples were measured using quantitative real-time polymerase chain reaction. Prediction algorithms of miRanda, TargetScan 6.2, and mirRDB to perform a miRNA gene network analysis were used for the potential miRNA-29a and miRNA-29c targets. RESULTS: The miRNA-29a and miRNA-29c expression levels were all significantly lower in the control group compared to the 2 and 4wk diabetic samples (P<0.01). The network analysis indicated that one miRNA-29a and miRNA-29c targets was BMF. There was significantly higher expression of BMF mRNA compared to the normal controls (P<0.01). CONCLUSION: Apoptosis occurs in rat LECs following high blood glucose exposure. It is likely that apoptosis during diabetic cataract formation involves the decreased expression of miRNA-29a and miRNA-29c and the increased expression of BMF.

Effects of resveratrol on ARPE-19 cell proliferation and migration via regulating the expression of proliferating cell nuclear antigen, P21, P27 and p38MAPK/MMP-9

2016/12/7 0:00:00
AIM: To explore whether resveratrol (Res) can inhibit human retinal pigment epithelial cell (ARPE-19 cell) proliferation and migration, and to research the molecular mechanisms. METHODS: ARPE-19 cells were pretreated with various concentrations at 0, 50, 100, 150, 200 and 300 μmol/L of Res, and with 0 μmol/L Res as the control for 24, 48 and 72h. The cell proliferation, apoptosis and migration were measured with cell counting kit-8 (CCK-8), flow cytometry, and wound-healing and Transwell assays, respectively. The expression of proliferating cell nuclear antigen (PCNA), P21 and P27, as well as matrix metalloproteinase-9 (MMP-9) and p38 mitogen-activated protein kinases (p38MAPK) was identified by Western blot. RESULTS: Cell proliferation was effectively inhibited by Res (P<0.05). When pretreated with Res, cells arrested in S-phase increased remarkably (P<0.05), but the apoptosis ratios showed no significant difference between the treatment and control groups (P>0.05). Cell migration was suppressed by Res both in wound-healing assay and Transwell migration assay (P<0.05). Decreases of PCNA, MMP-9 and p38MAPK, as well as increases of P21 and P27 were detected by Western blot (P<0.05). CONCLUSION: Res can inhibit APRE-19 cell proliferation and migration in a concentration-dependent manner with up-regulation of the expression of P21 and P27, and down-regulation of PCNA, MMP-9 and p38MAPK.

Optic neuropathy and increased retinal glial fibrillary acidic protein due to microbead-induced ocular hypertension in the rabbit

2016/12/7 0:00:00
AIM: To characterize whether a glaucoma model with chronic elevation of the intraocular pressure (IOP) was able to be induced by anterior chamber injection of microbeads in rabbits. METHODS: In order to screen the optimal dose of microbead injection, IOP was measured every 3d for 4wk using handheld applanation tonometer after a single intracameral injection of 10 μL, 25 μL, 50 μL or 100 μL microbeads (5×106 beads/mL; n=6/group) in New Zealand White rabbits. To prolong IOP elevation, two intracameral injections of 50 μL microbeads or phosphate buffer saline (PBS) were made respectively at days 0 and 21 (n=24/group). The fellow eye was not treated. At 5wk after the second injection of microbeads or PBS, bright-field microscopy and transmission electron microscopy (TEM) were used to assess the changes in the retina. The expression of glial fibrillary acidic protein (GFAP) in the retina was evaluated by immunofluorescence, quantitative real-time polymerase chain reaction and Western blot at 5wk after the second injection of microbeads. RESULTS: Following a single intracameral injection of 10 μL, 25 μL, 50 μL or 100 μL microbead, IOP levels showed a gradual increase and a later decrease over a 4wk period after a single injection of microbead into the anterior chamber of rabbits. A peak IOP was observed at day 15 after injection. No significant difference in peak value of IOP was found between 10 μL and 25 μL groups (17.13±1.25 mm Hg vs 17.63±0.74 mm Hg; P=0.346). The peak value of IOP from 50 μL group (23.25±1.16 mm Hg) was significantly higher than 10 μL and 25 μL groups (all P<0.05). Administration of 100 μL microbead solution (23.00±0.93 mm Hg) did not lead to a significant increase in IOP compared to the 50 μL group (P=0.64). A prolonged elevated IOP duration up to 8wk was achieved by administering two injections of 50 μL microbeads (20.48±1.21 mm Hg vs 13.60±0.90 mm Hg in PBS-injected group; P<0.05). The bright-field and TEM were used to assess the changes of retinal ganglion cells (RGCs). Compared with PBS-injected group, the extended IOP elevation was associated with the degeneration of optic nerve, the reduction of RGC axons (47.16%, P<0.05) and the increased GFAP expression in the retina (4.74±1.10 vs 1.00±0.46, P<0.05). CONCLUSION: Two injections of microbeads into the ocular anterior chamber of rabbits lead to a prolonged IOP elevation which results in structural abnormality as well as loss in RGCs and their axons without observable ocular structural damage or inflammatory response. We have therefore established a novel and practical model of experimental glaucoma in rabbits.

Effect of dihydrotestosterone on the expression of mucin 1 and the activity of Wnt signaling in mouse corneal epithelial cells

Li Qin, Cheng Pei, Qian-Yan Kang, Zhao Liu and Li Li — 2016/11/9 0:00:00
AIM: To explore the effects of the androgen dihydrotestosterone on the expression of mucin 1 (MUC1) and the activity of Wnt signaling in mouse corneal epithelial cells. METHODS: Primary mouse corneal epithelial cells were isolated from the corneas of BALB/c mice. Quantitative real-time polymerase chain reaction, immunofluorescence and Western blot analysis were used to quantify the differential expression of selected genes. The androgen receptor was silenced by transfecting cells with androgen receptor shRNAs. TOP-Flash and FOP-flash reporter plasmids were used to measure β-catenin-driven transcription. RESULTS: Dihydrotestosterone treatment increased MUC1 expression and activated the Wnt signaling pathway and led to the translocation of β-catenin and upregulation of the Wnt downstream target gene TATA box binding protein and urokinase plasminogen activator. These effects were prevented by downregulating the androgen receptor. CONCLUSION: Androgens may protect against dry eye by regulating the expression of MUC1 which is stimulated by the activation of Wnt signaling via the androgen receptor. An understanding of the mechanisms associated with androgen-mediated protection against dry eye is an important step in developing new therapies for this disease.

Effect of trapping vascular endothelial growth factor-A in a murine model of dry eye with inflammatory neovascularization

2016/11/9 0:00:00
AIM: To evaluate whether trapping vascular endothelial growth factor A (VEGF-A) would suppress angiogenesis and inflammation in dry eye corneas in a murine corneal suture model. METHODS: We established two groups of animals, one with non-dry eyes and the other with induced dry eyes. In both groups, a corneal suture model was used to induce inflammation and neovascularization. Each of two groups was again divided into three subgroups according to the treatment; subgroup I (aflibercept), subgroup II (dexamethasone) and subgroup III (phosphate buffered saline, PBS). Corneas were harvested and immunohistochemical staining was performed to compare the extents of neovascularization and CD11b+ cell infiltration. Real-time polymerase chain reaction was performed to quantify the expression of inflammatory cytokines and VEGF-A in the corneas. RESULTS: Trapping VEGF-A with aflibercept resulted in significantly decreased angiogenesis and inflammation compared with the dexamethasone and PBS treatments in the dry eye corneas (all P<0.05), but with no such effects in non-dry eyes. The anti-inflammatory and anti-angiogenic effects of VEGF-A trapping were stronger than those of dexamethasone in both dry eye and non-dry eye corneas (all P<0.05). The levels of RNA expression of VEGF-A, TNF-alpha, and IL-6 in the aflibercept subgroup were significantly decreased compared with those in the PBS subgroup in the dry eye group. CONCLUSION: Compared with non-dry eye corneas, dry eye corneas have greater amounts of inflammation and neovascularization and also have a more robust response to anti-inflammatory and anti-angiogenic agents after ocular surface surgery. Trapping VEGF-A is effective in decreasing both angiogenesis and inflammation in dry eye corneas after ocular surface surgery.

Corneal collagen cross-linking and liposomal amphotericin B combination therapy for fungal keratitis in rabbits

2016/11/9 0:00:00
AIM: To observe the therapeutic effect of corneal collagen cross-linking (CXL) in combination with liposomal amphotericin B in fungal corneal ulcers. METHODS: New Zealand rabbits were induced fungal corneal ulcers by scratching and randomly divided into 3 groups, i.e. control, treated with CXL, and combined therapy of CXL with 0.25% liposomal amphotericin B (n=5 each). The corneal lesions were documented with slit-lamp and confocal microscopy on 3, 7, 14, 21 and 28d after treatment. The corneas were examined with transmission electron microscopy (TEM) at 4wk. RESULTS: A rabbit corneal ulcer model of Fusarium was successfully established. The corneal epithelium defect areas in the two treatment groups were smaller than that in the control group on 3, 7, 14 and 21d (P<0.05). The corneal epithelium defect areas of the combined group was smaller than that of the CXL group (P<0.05) on 7 and 14d, but there were no statistical differences on 3, 21 and 28d. The corneal epithelium defects of the two treatment groups have been healed by day 21. The corneal epithelium defects of the control group were healed on 28d. The diameters of the corneal collagen fiber bundles (42.960±7.383 nm in the CXL group and 37.040±4.160 nm in the combined group) were thicker than that of the control group (24.900±1.868 nm), but there was no difference between the two treatment groups. Some corneal collagen fiber bundles were distorted and with irregular arrangement, a large number of fibroblasts could be seen among them but no inflammatory cells in both treatment groups. CONCLUSION: CXL combined with liposomal amphotericin B have beneficial effects on fungal corneal ulcers. The combined therapy could alleviate corneal inflammattions, accelerate corneal repair, and shorten the course of disease.

MicroRNA-34a promoting apoptosis of human lens epithelial cells through down-regulation of B-cell lymphoma-2 and silent information regulator

2016/11/9 0:00:00
AIM: To investigate the role of microRNA-34a (miR-34a) in the induction of apoptosis of human lens epithelial (HLE-B3) cells. METHODS: The apoptosis of HLE-B3 cells was detected by Annexin V-PE apoptosis detection kit after the treatment with 200 μmol/L H2O2 for 24h and lentiviral miR-34a vector transfection. The expression of miR-34a in the cells was quantified by quantitative real time polymerase chain reaction (qRT-PCR) in response to H2O2 exposure and the vector transfection. The effects of overexpression of miR-34a on the expression of B-cell lymphoma-2 (Bcl-2) and silent information regulator 1 (SIRT1) was determined by qRT-PCR and Western blot. RESULTS: The expression of miR-34a was up-regulated by the treatment of H2O2 in HLE-B3 cells. The increased expression of miR-34a is accompanied with the cell apoptosis. Consistence with the H2O2 exposure, ectopic overexpression of miR-34a in HLE-B3 cells promoted cells apoptosis. Importantly the anti-apoptosis factors Bcl-2 and SIRT1 were reduced significantly by up-regulation of miR-34a in HLE-B3 cells. CONCLUSION: MiR-34a promotes the apoptosis of HLE-B3 cells by down-regulating Bcl-2 and SIRT1, suggesting that miR-34a may involve in the pathogenesis of cataract formation and targeting miR-34a may be a potentially therapeutic approach for treatment of cataract.

A novel mutation of p.F32I in GJA8 in human dominant congenital cataracts

2016/11/9 0:00:00
AIM: To identify a causative mutation in a three-generation family with autosomal dominant congenital total cataract and dissect the molecular consequence of the identified mutation. METHODS: Clinical and ophthalmological examinations were performed on the affected and unaffected family members. Mutation were screened in recruited family members by polymerase chain reaction (PCR) of the two reported genes (CRYAA and GJA8) which were linked to human total cataracts and direct sequencing of the PCR product. The molecular consequences of the identified mutation was dissected. The plasmids carrying wild-type and mutant mouse ORF of Gja8, coding for connexin 50 (Cx50), were generated and ectopic expressed in 293 cells. Recombinant protein expression and cellular localization of recombinated Cx50 were assessed by confocal microscopy. RESULTS: Clinical and ophthalmological examinations were performed on the affected and unaffected family members. Mutation were screened in recruited family members by PCR of the two reported genes (CRYAA and GJA8) which were linked to human total cataracts and direct sequencing of the PCR product. The molecular consequences of the identified mutation was dissected. The plasmids carrying wild-type and mutant mouse ORF of Gja8, coding for Cx50, were generated and ectopic expressed in 293 cells. Recombinant protein expression and cellular localization of recombinated Cx50 were assessed by confocal microscopy. CONCLUSION: This study has identified a novel cataract mutation in GJA8, which adds a novel mutation to the existing spectrum of Cx50 mutations with cataract. The molecular consequences of p.F32I mutation in GJA8 exclude instability and the mislocalization of mutant Cx50 protein.

Neuropathy optic glaucomatosa induced by systemic hypertension through activation endothelin-1 signaling pathway in central retinal artery in rats

2016/11/9 0:00:00
AIM: To evaluate effect of hypertension on retinal ganglion cell (RGC) apoptosis, intraocular pressure (IOP), and the activation of endothelin-1 (ET-1) signaling pathway in central retinal artery (CRA) in rats. METHODS: The experimental study was performed on 20 male Sprague Dawley rats that were divided into control group, and hypertension groups. The hypertension was induced by subcutaneous deoxycorticoacetate (DOCA) 10 mg/kg twice a week and administered 0.9% NaCl solution daily for 2, 6, and 10wk. Blood pressure (BP) was measured using animal BP analyzer. IOP was measured by handheld tonometry. Retinal tissue preparations by paraffin blocks were made after enucleation. The expression of ET-1, eNOS, ET-1 receptor A (ETRA), ET-1 receptor B (ETRB), and phosphorylated myosin light chain kinase (MLCK), and caldesmon (CaD) in CRA and RGC apoptosis were evaluated through immunofluorescent staining method then observed using laser scanning confocal microscopy. RESULTS: BP significantly increased in all of the hypertension groups compared to control (P=0.001). Peak IOP elevation (7.78±4.14 mm Hg) and RGC apoptosis (576.15±33.28 Au) occurred on 2wk of hypertension. ET-1 expression (1238.6±55.1 Au) and eNOS expression (2814.2±70.7 Au) were found highest in 2wk of hypertension, although the ratio of ET-1/eNOS decreased since 2wk. ETRA reached peak expression in 10wk of hypertension (1219.4±6.3 Au), while ETRB significantly increased only in 2 weeks group (1069.2±9.6 Au). The highest MLCK expression (1190.09±58.32 Au), CaD (1670.28±18.36 Au) were also found in 2wk of hypertension. CONCLUSION: Hypertension effects to activation of ET-1 signaling pathway significantly in CRA, elevation of IOP, and RGC apoptosis. The highest value was achieved at 2wk, which is the development phase of hypertension.

Effect of endothelial progenitor cells derived from human umbilical cord blood on oxygen-induced retinopathy in mice by intravitreal transplantation

2016/11/9 0:00:00
AIM: To investigate the effect of endothelial progenitor cells (EPCs) labeled by carboxy fluorescein diacetate succinimidyl ester (CFSE) on murine oxygen-induced retinopathy (OIR) by intravitreal transplantation. METHODS: After isolated from human umbilical cord blood mononuclear cells, EPCs were cultivated and then labeled with CFSE in vitro. C57BL/6J mice were placed to 75% hyperoxia chamber from P7 to P12 to establish OIR model. At P12, OIR mice were intravitreally injected with 1 μL suspension contained 2×105 EPCs (EPCs group) or isometric phosphate buffered saline (PBS group). The contralateral eye of each mice received no injection (OIR group). Evans blue angiography and frozen section were examined to track the labeled cells in OIR group at P15 and P19. Using retina paraffin sections and adenosinediphos phatase staining at P12 and P19, the effect of EPCs on OIR mice was evaluated quantitatively and qualitatively. RESULTS: The retinas from EPCs group with less non-perfusion area and fewer peripheral tufts were observed at P19, comparing with that from PBS or OIR group. The retinopathy in EPCs group receded earlier with less non-ganglion cells and neovascular nuclei, together with relatively regular distribution. The counts of the neovascular nuclei at P19 were reduced by 44% or 45%, compared with those of OIR group or PBS group respectively. Three days after EPCs injection, a large number of EPCs appeared in the vitreous cavity and adhered to the retinal surface. While at one week, the cells gathered between the internal plexiform layer and the inner limiting membrane, and some EPCs appeared in retinal vessels. CONCLUSION: EPCs transplantation can participate in the reparative procedure of the neovascularization in OIR.

Suppressive effect of microRNA-143 in retinoblastoma

Li-Lun Wang, Hai-Feng Hu and Yan-Qin Feng — 2016/11/9 0:00:00
AIM: To investigate microRNA-143 expression and effect on suppression of retinoblastoma (RB) cells. METHODS: The expression of microRNA-143 was investigated and compared in normal human retina tissue samples and in RB cell lines of Y79 and Weri1. The microRNA-143 mimics were transfected into the RB cell lines separately, and its effect on RB cell lines was detected using reverse-transcription quantitative polymerase chain reaction and Western blotting methods. RESULTS: The microRNA-143 expression was significantly suppressed in RB cell lines. Overexpression of microRNA-143 significantly lowered cell viability and invasion of the RB cell lines, and increased the number of apoptotic cells. Meanwhile, the Bax expression was up-regulated and much higher in the microRNA-143 mimics transfected group than that in the negative control and the microRNA-143 inhibitor groups. CONCLUSION: MicroRNA-143 exhibits suppressive effects in RB. The current study provides the perspective of a potential therapeutic treatment for RB.

Upregulated inflammatory associated factors and blood-retinal barrier changes in the retina of type 2 diabetes mellitus model

2016/11/9 0:00:00
AIM: To examine the expression of high mobility group box-1 (HMGB-1) and intercellular adhesion molecule-1 (ICAM-1) in the retina and the hippocampal tissues; and further to evaluate the association of these two molecules with the alterations of blood-retinal barrier (BRB) and blood-brain barrier (BBB) in a rat model of type 2 diabetes. METHODS: The type-2 diabetes mellitus (DM) model was established with a high-fat and high-glucose diet combined with streptozotocin (STZ). Sixteen weeks after DM induction, morphological changes of retina and hippocampus were observed with hematoxylin-eosin staining, and alternations of BRB and BBB permeability were measured using Evans blue method. Levels of HMGB-1 and ICAM-1 in retina and hippocampus were detected by Western blot. Serum HMGB-1 levels were determined by enzyme-linked immunosorbent assay (ELISA). RESULTS: A significantly higher serum fasting blood glucose level in DM rats was observed 2wk after STZ injection (P＜0.01). The serum levels of fasting insulin, Insulin resistance homeostatic model assessment (IRHOMA), total cholesterol (TC), total triglycerides (TG) and low density lipoprotein cholesterol (LDL-C) in the DM rats significantly higher than those in the controls (all P＜0.01). HMGB-1 (0.96±0.03, P＜0.01) and ICAM-1 (0.76±0.12, P＜0.05) levels in the retina in the DM rats were significantly higher than those in the controls. HMGB-1 (0.83±0.13, P＜0.01) and ICAM-1 (1.15±0.08, P＜0.01) levels in the hippocampal tissues in the DM rats were also significantly higher than those in the controls. Sixteen weeks after induction of DM, the BRB permeability to albumin-bound Evans blue dye in the DM rats was significantly higher than that in the controls (P＜0.01). However, there was no difference of BBB permeability between the DM rats and controls. When compared to the controls, hematoxylin and eosin staining showed obvious irregularities in the DM rats. CONCLUSION: BRB permeability increases significantly in rats with type-2 DM, which may be associated with the up-regulated retinal expression of HMGB-1 and ICAM-1.

The role of Dectin-1/Raf-1 signal cascade in innate immune of human corneal epithelial cells against Aspergillus fumigatus infection

Gui-Qiu Zhao, Jing Lin, Li-Ting Hu, Xiao-Ni Yin, Qian Wang, Qiang Xu and Hui Li — 2016/10/13 0:00:00
AIM: To investigate the expression of the v-raf-1 murine leukemia viral oncogene homolog 1 (Raf-1) and its role in the innate immune response of human corneal epithelial cells (HCECs) infected by Aspergillus fumigatus. METHODS: HCECs were cultured in vitro. They were randomly divided into 4 groups, including control group, Aspergillus fumigatus group, GW5074 (an inhibitor of Raf-1) group and Laminarin [an inhibitor of Dendriti-cell-associated C-type lectin 1 (Dectin-1)] group. The protein expression level of total Raf-1 and p-Raf-1was measured by Western blot. The expression of IL-6 and IL-8 mRNA in each group was detected by real-time polymerase chain reaction. RESULTS: In Aspergillus fumigatus group, total Raf-1 protein levels in HCECs remained unchanged at 5, 15, 30 and 45min after infection, while p-Raf-1 expression was significantly enhanced at 30min after infection compared with control group. However, the expression of p-Raf-1 was apparently declined after treated with GW5074 or Laminarin compared with Aspergillus fumigatus group. The expression levels of IL-6, IL-8 mRNA were significantly increased after stimulation with fumigatus compared with control group. Pre-treated with GW5074 significantly inhibited Aspergillus fumigatus-induced upregulation of IL-8 and IL-6. CONCLUSION: Aspergillus fumigatus stimulation can elevate the expression of p-Raf-1 in HCECs in vitro. Dectin-1/Raf-1 signal pathway may play a role on regulating the expression of inflammatory cytokines, including IL-6 and IL-8.

Effects of dexamethasone and HA1077 on actin cytoskeleton and β-catenin in cultured human trabecular meshwork cells

2016/10/13 0:00:00
AIM: To investigate the effects of dexamethasone (DEX) and 1-(5-isoquinolinesulfonyl)-homopiperazine (HA1077) on actin cytoskeleton and β-catenin in cultured human trabecular meshwork (HTM) cells. METHODS: The HTM cells were separated from human eyeball and cultured in vitro. They were divided into control group, DEX (1×10-6 mol/L) group, HA1077 (3×10-5 mol/L) group, and DEX (1×10-6 mol/L) and HA1077 (3×10-5 mol/L) group. Actin cytoskeleton and β-catenin in HTM cells of the four groups were examined by immunofluorescence and Western blot analyses. RESULTS: In DEX group, there were reorganization of actin cytoskeleton and formation of cross linked actin networks (CLANs), which were partially reversed in DEX and HA1077 group. DEX treatment also induced an increased expression of β-catenin, which was obviously reduced in DEX and HA1077 group. Meanwhile, the cultured HTM cells in HA1077 group had lower expression of β-catenin than that in the control group. CONCLUSION: Our results show that HA1077 can reverse the changes of actin organization and expression of β-catenin induced by DEX in cultured HTM cells, suggesting that HA1077 may play an important role in increasing outflow and reducing intraocular pressure.

Therapeutic effects of mesenchymal stem cells administered at later phase of recurrent experimental autoimmune uveitis

2016/10/13 0:00:00
AIM: To test the therapeutic effects of delayed treatment of mesenchymal stem cells (MSCs) in recurrent experimental autoimmune uveitis (rEAU). METHODS: The efficacy of different regimens of MSC administration in rEAU were tested by evaluation of clinical and pathological intraocular inflammation, as well as retinal structural and functional integrity using optical coherence tomography (OCT) and electroretinogram (ERG). The retinal sections were also immunostained with antibodies to glial fibrillary acidic protein (GFAP) and rhodopsin (RHO). RESULTS: Delayed treatment of MSCs effectively alleviated the severity of intraocular inflammation with relative intact of outer retinal structure and function. Moreover, double therapies with longer interval led to an even better clinical evaluation, as well as a trend of decrease in relapse and amelioration of retinal function. MSC therapies also effectively reduced GFAP expression and increased RHO expression in the retina. CONCLUSION: MSC administration can effectively treat developed diseases of rEAU, and multiple therapies can provide additional therapeutic benefits.

Gene expression and histopathological evaluation of thiamine pyrophosphate on optic neuropathy induced with ethambutol in rats

2016/10/13 0:00:00
AIM: To compare the effects of thiamine pyrophosphate (TPP) and thiamine (TM) in oxidative optic neuropathy in rats induced by ethambutol. METHODS: The animals were divided into four groups: a control group (CG), an ethambutol control (ETC) group, TM plus ethambutol group (TMG), and TPP plus ethambutol group (TPPG). One hour after intraperitoneal administration of TM 20 mg/kg to the TMG group and TPP 20 mg/kg to TPPG group, 30 mg/kg ethambutol was given via gavage to all the groups but the CG. This procedure was repeated once daily for 90d. After that period, all rats were exposed to high levels of anaesthesia in order to investigate the gene expression of malondialdehyde and glutathione in removed optic nerve tissue and histopathologically to examine these tissues. RESULTS: Malondialdehyde gene expression significantly increased, whereas glutathione gene expression significantly decreased in the ETC group compared to the CG. TM could not prevent the increase of malondialdehyde gene expression and the decrease of glutathione, while TPP significantly could suppress. Histopathologically, significant vacuolization in the optic nerve, single-cell necrosis in the glial cells, and a decrease in oligodendrocytes were observed in the ETC group. Vacuolization in the optic nerve, a decrease in oligodendrocytes and single-cell necrosis were found in the TMG group, while no pathological finding was observed in the TPPG group except for mild vacuolization. CONCLUSION: TPP protects the optic nerve against the ethambutol-induced toxicity but TM does not. TPP can be beneficial in prophilaxis of optic neuropathy in ethambutol therapy.

Novel TRPM1 mutations in two Chinese families with early-onset high myopia, with or without complete congenital stationary night blindness

Lin Zhou, Tuo Li, Yi-Qiao Xing, Yin Li, Qing-Song Wu and Mao-Ju Zhang — 2016/10/13 0:00:00
AIM: To investigate the relationship between high myopia [with or without complete congenital stationary night blindness (CSNB1)] and TRPM1 and NYX. METHODS: Two unrelated families with early-onset high myopia (eoHM) and 96 normal controls were recruited. Sanger sequencing or clone sequencing were used for mutation screening. Further analyses of the available family members and the 96 normal controls were subsequently conducted to obtain additional evidence of the pathogenicity of these variants. The initial diagnosis of the probands was eoHM. We performed a further comprehensive examination of the available family members after mutations were detected in TRPM1 or NYX. RESULTS: Two novel compound heterozygous mutations in TRPM1 were detected in the recruited families. The proband in family A with eoHM carried a c.2594C>T missense mutation in exon 19 and a c.669+3_669+6delAAGT splicing mutation, which was co-segregated with CSNB1 in this family. A patient in family B with a compound heterozygous missense mutation (c.3262G>A and c.3250T>C) was detected. No mutations were found in NYX. These two identified compound heterozygous mutations were not found in the 96 normal controls. After further examination of the family members, the patients in family A could be diagnosed as eoHM with CSNB1. However due to the limited clinic data, the patient in family B cloud not clearly diagnosed as CSNB1. CONCLUSION: This study has expanded the mutation spectrum of TRPM1 for CSNB1 and additional studies are needed to elucidate the association between isolated high myopia and TRPM1 and NYX.

FGFR2 mutation in a Chinese family with unusual Crouzon syndrome

2016/10/13 0:00:00
AIM: To describe the clinical characteristics with genetic lesions in a Chinese family with Crouzon syndrome. METHODS: All five patients from this family were included and received comprehensive ophthalmic and systemic examinations. Direct sequencing of the FGFR2 gene was employed for mutation identification. Crystal structure analysis was applied to analyze the structural changes associated with the substitution. RESULTS: All patients presented typical Crouzon features, including short stature, craniosynostosis, mandibular prognathism, shallow orbits with proptosis, and exotropia. Intrafamilial phenotypic diversities were observed. Atrophic optic nerves were exclusively detected in the proband and her son. Cranial magnetic resonance imaging (MRI) implied a cystic lesion in her sellar and third ventricular regions. A missense mutation, FGFR2 p.Cys342Trp, was found as disease causative. This substitution would generate conformational changes in the extracellular Ig-III domain of the FGFR-2 protein, thus altering its physical and biological properties. CONCLUSION: We describe the clinical presentations and genotypic lesions in a Chinese family with Crouzon syndrome. The intrafamilial phenotypic varieties in this family suggest that other genetic modifiers may also play a role in the pathogenesis of Crouzon syndrome.

Suppression of fibrosis in human pterygium fibroblasts by butyrate and phenylbutyrate

2017/9/5 0:00:00
AIM: To evaluate the antifibrogenic effects of butyrate or phenylbutyrate, a chemical derivative of butyrate, in human pterygium fibroblasts. METHODS: Human pterygium fibroblasts obtained from patient pterygium tissue were treated with butyrate or phenylbutyrate for 48h. Expression of α-smooth muscle actin, collagen I, collagen III and matrix metalloproteinase-1 mRNA was measured by quantitative real-time reverse transcription polymerase chain reaction, and acetylated histone was evaluated by Western blotting. RESULTS: Butyrate inhibited α-smooth muscle actin, type III collagen and matrix metalloproteinase-1 expressions, and phenylbutyrate inhibited types I and III collagen and matrix metalloproteinase-1 expressions without changing cell viability as well as both of these increased histone acetylation. These results suggested that butyrate and phenylbutyrate suppress fibrosis through a mechanism involving histone deacetylase inhibitor. CONCLUSION: This indicates that butyrate or phenylbutyrate have antifibrogenic effects in human pterygium fibroblasts and could be novel types of prophylactic and/or therapeutic drugs for pterygium, especially phenylbutyrate, which does not have the unpleasant smell associated with butyrate.

Analysis of proteomic differences between liquefied after-cataracts and normal lenses using two-dimensional gel electrophoresis and mass spectrometry

Jia-Jia Ge and Yu-Sen Huang — 2017/9/5 0:00:00
AIM: To analyze and identify the proteomic differences between liquefied after-cataracts and normal lenses by means of liquefied chromatography-tandem mass spectrometry (LC-MS/MS). METHODS: Three normal lenses and three liquefied after-cataracts were exposed to depolymerizing reagents to extract the total proteins. Protein concentrations were separated using two-dimensional gel electrophoresis (2-DE). The digitized images obtained with a GS-800 scanner were then analyzed with PDQuest7.0 software to detect the differentially-expressed protein spots. These protein spots were cut from the gel using a proteome work spot cutter and subjected to in-gel digestion with trypsin. The digested peptide separation was conducted by LC-MS/MS. RESULTS: The 2-DE maps showed that lens proteins were in a pH range of 3-10 with a relative molecular weight of 21-70 kD. The relative molecular weight of the more abundant proteins was localized at 25-50 kD, and the isoelectric points were found to lie between PI 4-9. The maps also showed that the protein level within the liquefied after-cataracts was at 29 points and significantly lower than in normal lenses. The 29 points were identified by LC-MS/MS, and ten of these proteins were identified by mass spectrometry and database queries: beta-crystallin B1, glyceraldehyde-3-phosphate dehydrogenase, carbonyl reductase (NADPH) 1, cDNA FLJ55253, gamma-crystallin D, GAS2-like protein 3, sorbitol dehydrogenase, DNA FLJ60282, phosphoglycerate kinase, and filensin. CONCLUSION: The level of the ten proteins may play an important role in the development of liquefied after-cataracts.

MMP-2 Rs24386 (C-->T) gene polymorphism and the phenotype of age-related macular degeneration

2017/9/5 0:00:00
AIM: To examine the MMP-2 (-1306 C/T) gene polymorphism and the phenotype characterized by soft and hard drusen of early age-related macular degeneration (AMD) and geographic atrophy of late AMD form. METHODS: The study enrolled 850 investigations (290 AMD patients with soft and hard drusen, 34 with geographic atrophy and a random sample of the population n=526). Early AMD was classified according to the International Classification and Grading System. For geographic atrophy diagnosis the Age-Related Eye Disease Study classification was used. The potential association with single nucleotide polymorphisms on MMP-2 Rs243865 was evaluated for all patients, adjusted for age and sex. The genotyping test of MMP-2 Rs243865 (C-->T) was conducted using the real-time polymerase chain reaction method. RESULTS: MMP-2 (-1306 C/T) C/C genotype was more frequently detected in AMD patients with hard drusen than the soft drusen or control group (66.43% vs 53.74%, vs 54.94%, P=0.047). Logistic regression analysis showed that the MMP-2 (-1306) C/C genotype increased the likelihood to develop hard drusen in AMD patients (OR=1.7, 95% CI: 1.06-2.74; P=0.028). No association between MMP-2 (-1306 C/T) gene polymorphism in patients with atrophic AMD and control group was found (54.94%, 37.64%, 7.41% vs 50%, 38.24%, 11.76%; P=0.6). CONCLUSION: The MMP-2 Rs24386 (C-->T) polymorphism is found to be associated with the development of hard drusen in patients with AMD.

Intraocular pressure control of a novel glaucoma drainage device - in vitro and in vivo studies

Li-Jun Cui, Di-Chen Li, Jian Liu, Lei Zhang and Yao Xing — 2017/9/5 0:00:00
AIM: To evaluate the intraocular pressure (IOP) control of an artificial trabeculum drainage system (ATDS), a newly designed glaucoma drainage device, and postoperative complications in normal rabbit eyes. METHODS: Pressure drops in air and fluid of 30 ATDS were measured after being connected to a closed manometric system. Twenty of them were then chosen and implanted randomly into the eyes of 20 rabbits. Postoperative slit-lamp, gonioscopic examination and IOP measurements were recorded periodically. Ultrasound biomicroscopy and B-scan ultrasonography were also used to observe the complications. Eyes were enucleated on day 60. RESULTS: Pressure drops of 4.6-9.4 mm Hg were obtained at physiological aqueous flow rates in the tests in vitro. The average postoperative IOP of the experimental eyes (11.6-12.8 mm Hg) was lower than the controls significantly (P<0.05) at each time point. Complications of hemorrhage (n=1), cellulosic exudation (two cases) and local iris congestion (two cases) were observed. The lumina of the devices were devoid of obstructions in all specimens examined and a thin fibrous capsule was found around the endplate. CONCLUSION: ATDS reduce IOP effectively. However, further studies on the structure are needed to reduce complications.

The ocular toxicity and pharmacokinetics of simvastatin following intravitreal injection in mice

2017/9/5 0:00:00
AIM: To investigate the retinal toxicity and pharmacokinetics of simvastatin intravitreally injected into mice. METHODS: Forty-eight 6-8-week-old C57BL/6J mice were used in this study. Simvastatin was intravitreally injected into the right eye of each mouse; the left eye was injected with vehicle and was used as a control. Bilateral dark-adapted electroretinography (ERG) was performed 1 and 7d following injection. Histology was examined using a combination of light, fluorescence and electron microscopy. High-performance liquid chromatography (HPLC) was used to determine the decay in the retinal simvastatin concentration. RESULTS: ERG revealed no significant changes in the simvastatin-injected eyes compared to control. Histologic studies showed normal retinal morphology in eyes injected with simvastatin up to a final vitreal concentration of 200 μmol/L. No significant changes in the number of photoreceptors, bipolar cells or ganglion cells were found. The retinal simvastatin concentration decayed exponentially, with a half-life of 1.92-2.41h. CONCLUSION: Intravitreal injection of up to 200 μmol/L simvastatin produced no signs of adverse effects in the mouse retina. Simvastatin reaches the retina shortly after intravitreal injectionand has a short half-life.

Effect of dopamine on bone morphogenesis protein-2 expression in human retinal pigment epithelium

Hong-Hui Li, Yan-Li Sun, Dong-Mei Cui, Juan Wu and Jun-Wen Zeng — 2017/9/5 0:00:00
AIM: To investigate the effect of dopamine on bone morphogenesis protein-2 (BMP-2) expression in retinal pigment epithelium (RPE) cells in vitro. METHODS: ARPE-19 cells as a human RPE cell line were cultured with dopamine for different times (2, 4, 6, 8, 12, 16 and 24h) or with different concentrations (0.1, 1, 2, 5, 10, 20, and 100 μg/mL) in vitro. BMP-2 mRNA expression level in ARPE-19 cells was analyzed with real-time polymerase chain reaction (PCR) analysis and BMP-2 protein level was measured with Western blot analysis. The active form of BMP-2 in the culture medium was measured with enzyme-linked immunosorbent assay (ELISA). RESULTS: The expression level of BMP-2 increased significantly cultured with 20 μg/mL dopamine, at different time points (P<0.05). BMP-2 mRNA level peaked 2h and the protein level peaked at 6 and 8h after treatment. The concentrations of secreted BMP-2 elevated at 12h and peaked at 24h (P<0.05) in a time-dependent manner. Treated with 100 μg/mL dopamine for 6h, the expression levels of BMP-2 mRNA and protein in ARPE-19 cells were enhanced significantly compared to that in the untreated cells (P<0.05). And secreted BMP-2 protein in the cell culture supernatant was also increased (P<0.05). CONCLUSION: Dopamine up-regulate BMP-2 expression in RPE cells, and this may be associated with its inhibitive effect on myopia development.

Inhibition effect of curcumin on UVB-induced secretion of pro-inflammatory cytokines from corneal limbus epithelial cells

2017/6/14 0:00:00
AIM: To study the effects of curcumin on the secretion of interleukin (IL) -6 and IL-8 by corneal limbus epithelial cells. METHODS: Human corneal limbus epithelial cells were isolated and cultured from donor eyes and irradiated by UVB at different dosages with or without curcumin. MTT test was used for studying the effects of UVB and curcumin on the cell viability. The role of mitogen-activated protein kinase (MAPK) and nuclear factor-kappa B (NF-κB) pathways on the UVB-induced secretion of IL-6 and IL-8 were tested by addition of their inhibitors to the culture with or without UVB-radiation. Levels of various signal pathways, IL-6 and IL-8 in the cells and in the conditioned culture medium were measured by ELISA analysis. RESULTS: UVB at 20 mJ/cm2 or less and curcumin at 20 μmol/L or less did not affect the cell viability of cultured limbus epithelial cells (P>0.05). UVB irradiation at 10 and 20 mJ/cm2 induced a significant increase of secretion of IL-6 and IL-8 and upregulated NF-κB and phosphorylated MAPK pathways of cultured limbus epithelial cells (P<0.05). Various signal pathway inhibitors, including SP600125 (JNK inhibitor), SB203580 (p38 MAPK inhibitor) and BAY11-7082 (NF-κB inhibitor) significantly decreased the UVB-induced secretion of IL-6 and IL-8 secretion (P<0.05). Curcumin at 5-20 μmol/L significantly inhibited UVB-induced secretion of IL-6 and IL-8 by limbus epithelial cells in a dose-dependent manner; while curcumin alone did not affect the secretion of IL-6 and IL-8. The upregulation of NF-κB and MAPK pathways induced by UVB treatment was significantly inhibited by curcumin, suggesting that NF-κB and MAPK pathways are involved in the inhibitory effect of curcumin on UVB-induced production of IL-6 and IL-8. CONCLUSION: Curcumin may be a promising agent to be explored for the prevention and treatment of pterygium.

Effect of sorafenib in a murine high risk penetrating keratoplasty model

Yang Kyung Cho,Eun Young Shin,Hironori Uehara and Balamurali K Ambati — 2017/6/14 0:00:00
AIM: To evaluate the effect of sorafenib in murine high risk keratoplasty model. METHODS: Graft survival, corneal neovascularization, and corneal lymphangiogenesis were compared among the sorafenib, dexamethasone, dimethyl sulfoxide (DMSO), and phosphate buffered saline (PBS) groups following subconjunctival injection in mice that underwent high risk penetrating keratoplasty (HRPK). Real-time polymerase chain reaction was performed to quantify the expression of inflammatory cytokines and vascular endothelial growth factor (VEGF)-A, VEGF-C, vascular endothelial growth factor receptor (VEGFR)-2, VEGFR-3. RESULTS: The two-month graft survival rate for HRPK was 42.86% in sorafenib group, 37.50% in dexamethasone group, 0 in DMSO group, and 0 in PBS group. Sorafenib significantly increased graft survival compared to the DMSO and PBS group (P<0.05). The sorafenib didn’t show significant effect in decreasing neovascularization compared with dexamethsone, DMSO, and PBS group. The sorafenib showed less total lymphangiogenesis than the dexamethasone, DMSO, and PBS group (P=0.011, P<0.001, P<0.001, respectively). The sorafenib group showed reduced expression of VEGF-C, tumor necrosis factor (TNF)-alpha, interleukin (IL)-6, VEGFR-2 and VEGFR-3 compared with DMSO group and PBS group (all P<0.05). The sorafenib group didn’t show difference in the expression of VEGF-A compared with DMSO, neither with PBS. The sorafenib group showed reduced expression of VEGFR-3 compared with dexamethasone (P=0.051). CONCLUSION: The subconjunctivally administered sorafenib shows significant anti-lymphangiogenic effect, resulting in increased transplant survival in a murine high risk keratoplasty model. We suggest that a close linkage between decreased VEGF-C/VEGFR-2 and -3 signaling and increased corneal graft survival by sorafenib seems to exist.

Effects of lens extirpation with anterior vitrectomy on vitreous three-dimensional mesh structure

Yan Zhao,Long-Fang Zhou and Hong Yang — 2017/6/14 0:00:00
AIM: To investigate the changes in vitreous gel structure after lens extirpation combined with anterior vitrectomy in rabbit eyes. METHODS: Twenty-eight chinchilla rabbits were divided into three groups. The control group (Group I) included 16 eyes from eight rabbits who did not receive any treatment. Group II included 20 eyes from 10 rabbits that underwent lens aspiration only. Group III included 20 eyes from 10 rabbits that underwent lens aspiration combined with posterior capsulotomy and anterior vitrectomy. Eyes were harvested on the 30th and 60th day postoperatively, respectively. Changes in vitreous gel stretch length due to gravity and the rate of vitreous liquefaction were observed. The collagen content in the vitreous body was examined using the L-hydroxyproline test. Electronic microscopic images were obtained from each eyeball. RESULTS: On both the 30th and 60th day postoperatively, the vitreous gel length of group III was significantly shorter than group I and group II (P<0.05), while the rate of liquefaction of the vitreous body in group III was significantly higher than group I and group II (P<0.05). The collagen content in group III was also higher than that in group I and group II (P<0.05). CONCLUSION: Loss of vitreous gel mass is more likely to occur in the eyes of rabbits receiving anterior vitrectomy. Lensectomy combined with anterior vitrectomy may damage the stable three-dimensional mesh structure of collagen, which could aggravate vitreous gel liquefaction.

A Chinese family with Axenfeld-Rieger syndrome: report of the clinical and genetic findings

Da-Peng Sun,Yun-Hai Dai,Xiao-Jing Pan,Tao Shan,Dian-Qiang Wang and Peng Chen — 2017/6/14 0:00:00
AIM: To describe a Chinese family affected by a severe form of Axenfeld-Rieger syndrome (ARS) and characterize the molecular defect in PITX2 in the family. METHODS: Patients presented with typical ARS from a Chinese family were investigated. We performed genome-wide linkage scan and exome sequencing to identify the pathogenic mutations. Candidate mutations were verified for co-segregation in the whole pedigree using Sanger sequencing. Real-time polymerase chain reaction (RT-PCR) and Western blotting were performed to verify the expression of the pathogenic gene. RESULTS: Genome-wide linkage and exome sequencing analyses showed PITX2 as the disease candidate gene. A>G substitution at position -11 of 3’ss of exon 5 (IVS5-11A>G) that co-segregated with the disease phenotype was discovered in the family. The PITX2 messenger ribonucleic acid and protein levels were about 50% lower in patients with ARS than in unaffected family members in the family. CONCLUSION: Our findings implicate the first intronic mutation of the PITX2 gene in the pathogenesis of a severe form of ARS in a Chinese family. This study highlights the importance of a systematic search for intronic mutation in ARS cases for which no mutations in the exons of PITX2 have been found.

Protection of retinal ganglion cells against optic nerve injury by induction of ischemic preconditioning

Xia Liu,Jiu-Ping Liang,Ou Sha,Song-Juan Wang,Heng-Guo Li and Eric Y.P. Cho — 2017/6/14 0:00:00
AIM: To explore if ischemic preconditioning (IPC) can enhance the survival of retinal ganglion cells (RGCs) after optic nerve axotomy. METHODS: Twenty-four hours prior to retinal ischemia 60min or axotomy, IPC was applied for ten minutes in groups of (n=72) animals. The survival of RGCs, the cellular expression of heat shock protein 27 (HSP27) and heat shock protein 70 (HSP70) and the numbers of retinal microglia in the different groups were quantified at 7 and 14d post-injury. The cellular expression of HSP27 and HSP70 and changes in the numbers of retinal microglia were quantified to detect the possible mechanism of the protection of the IPC. RESULTS: Ten minutes of IPC promoted RGC survival in both the optic nerve injury (IPC-ONT) and the retinal ischemia 60min (IPC-IR60) groups, examined at 7d and 14d post-injury. Microglial proliferation showed little correlation with the extent of benefit effects of IPC on the rescue of RGCs. The number of HSP27-positive RGCs was significantly higher in the IPC-ONT group than in the sham IPC-ONT group, although the percentage of HSP27-positive RGCs did not significantly differ between groups. For the IPC-IR60 group, neither the number nor the percentage of the HSP27-positive RGCs differed significantly between the IPC and the sham-operated groups. The number of HSP70-positive RGCs was significantly higher for both the IPC-ONT and the IPC-IR60 experimental groups, but the percentages did not differ. CONCLUSION: The induction of IPC enhances the survival of RGCs against both axotomy and retinal ischemia.

CCR7/p-ERK1/2/VEGF signaling promotes retinal neovascularization in a mouse model of oxygen-induced retinopathy

Lin-Hui Yuan,Xiao-Long Chen,Yu Di and Mei-Lin Liu — 2017/6/14 0:00:00
AIM: To investigate the role of CCR7/p-ERK1/2/VEGF signaling in the mouse model of oxygen-induced retinopathy (OIR). METHODS: Neonatal C57BL/6J mice were evenly randomized into four groups: normoxia, OIR, OIR control (treated with scramble siRNA), and OIR treated (treated with CCR7 siRNA). Normoxia group was not specially handled. Postnatal day 7 (P7) mice in the OIR group were exposed to 75%±5% oxygen for 5d (P7-P12) and then maintained under normoxic conditions for 5d (P12-P17). Mice in the OIR control and OIR treated groups were given injections of scramble or CCR7 siRNA plasmid on P12 before returning to normoxic conditions for 5d (P12-P17). Retina samples were collected from all mice on P17, stained with adenosine diphosphatase (ADPase), and retinal neovascularization (RNV) was assessed. Retinas were also stained with hematoxylin and eosin (H&E) for RNV quantitation. The distribution and expression of CCR7, p-ERK1/2 and vascular endothelial growth factor (VEGF) were assessed via immunohistochemistry, Western blot, and quantitative real-time polymerase chain reaction (qRT-PCR). RESULTS: High oxygen promoted retinal neovascularization (P<0.05) and increased the number of endothelial nuclei in new vessels extending from the retina to the vitreous body; CCR7 promoted this process (P<0.05). CCR7 and VEGF mRNA were expressed at higher levels in the OIR and OIR control groups than in the normoxia and OIR treated groups. CCR7, p-ERK1/2, and VEGF protein were expressed in the retinas of mice in the OIR and OIR control groups. Intravitreal injection of CCR7 siRNA significantly reduced CCR7, p-ERK1/2, and VEGF expression in the OIR mouse model (all P<0.05). CCR7 significantly enhanced the neovascularization and non-perfusion areas in the OIR group (P<0.05). CCR7 siRNA significantly reduced levels of p-ERK1/2 and VEGF as compared to OIR controls (P<0.05). CONCLUSION: These results suggest that CCR7/p-ERK 1/2/VEGF signaling plays an important role in OIR. CCR7 may be a potential target for the prevention and treatment of retinopathy of prematurity.

Scutellaria barbata attenuates diabetic retinopathy by preventing retinal inflammation and the decreased expression of tight junction protein

Xi-Yu Mei,Ling-Yu Zhou,Tian-Yu Zhang,Bin Lu and Li-Li Ji — 2017/6/14 0:00:00
AIM: To observe the attenuation of ethanol extract of Herba Scutellaria barbata (SE) against diabetic retinopathy (DR) and its engaged mechanism. METHODS: C57BL/6J mice were intraperitoneally injected with streptozotocin (STZ, 55 mg/kg) for 5 consecutive days to induce diabetes. The diabetic mice were orally given with SE (100, 200 mg/kg) for 1mo at 1mo after STZ injection. Blood-retinal barrier (BRB) breakdown was detected by using Evans blue permeation assay. Real-time polymerase chain reaction (RT-PCR), Western blot and immunofluorescence staining were used to detect mRNA and protein expression. Enzyme-linked immunosorbent assay (ELISA) was used to detect serum contents of tumor necrosis factor-α (TNF-α) and interleukin (IL)-1β. RESULTS: SE (100, 200 mg/kg) reversed the breakdown of BRB in STZ-induced diabetic mice. The decreased expression of retinal claudin-1 and claudin-19, which are both tight junction (TJ) proteins, was reversed by SE. SE decreased the increased serum contents and retinal mRNA expression of TNF-α and IL-1β. SE also decreased the increased retinal expression of intercellular cell adhesion molecule-1 (ICAM-1). SE reduced the increased phosphorylation of nuclear factor kappa B (NFκB) p65 and its subsequent nuclear translocation in retinas from STZ-induced diabetic mice. Results of Western blot and retinal immunofluorescence staining of ionized calcium-binding adapter molecule 1 (Iba1) demonstrated that SE abrogated the activation of microglia cells in STZ-induced diabetic mice. CONCLUSION: SE attenuates the development of DR by inhibiting retinal inflammation and restoring the decreased expression of TJ proteins including claudin-1 and claudin-19.

Proteomic profiling of early degenerative retina of RCS rats

Zhi-Hong Zhu,Yan Fu,Chuan-Huang Weng,Cong-Jian Zhao and Zheng-Qin Yin — 2017/6/14 0:00:00
AIM: To identify the underlying cellular and molecular changes in retinitis pigmentosa (RP). METHODS: Label-free quantification-based proteomics analysis, with its advantages of being more economic and consisting of simpler procedures, has been used with increasing frequency in modern biological research. Dystrophic RCS rats, the first laboratory animal model for the study of RP, possess a similar pathological course as human beings with the diseases. Thus, we employed a comparative proteomics analysis approach for in-depth proteome profiling of retinas from dystrophic RCS rats and non-dystrophic congenic controls through Linear Trap Quadrupole - orbitrap MS/MS, to identify the significant differentially expressed proteins (DEPs). Bioinformatics analyses, including Gene ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway annotation and upstream regulatory analysis, were then performed on these retina proteins. Finally, a Western blotting experiment was carried out to verify the difference in the abundance of transcript factor E2F1. RESULTS: In this study, we identified a total of 2375 protein groups from the retinal protein samples of RCS rats and non-dystrophic congenic controls. Four hundred thirty-four significantly DEPs were selected by Student’s t-test. Based on the results of the bioinformatics analysis, we identified mitochondrial dysfunction and transcription factor E2F1 as the key initiation factors in early retinal degenerative process. CONCLUSION: We showed that the mitochondrial dysfunction and the transcription factor E2F1 substantially contribute to the disease etiology of RP. The results provide a new potential therapeutic approach for this retinal degenerative disease.

Effect of pyridone agent on blood-retinal barrier in diabetic mice

Si-Qi Xiong,Hai-Bo Jiang,Hui-Zhuo Xu and Xiao-Bo Xia — 2017/6/14 0:00:00
AIM: To evaluate the therapeutic effect of fluorofenidone on disrupted blood-retinal barrier in the diabetic mice and uncover its underlying mechanism. METHODS: db/db mice were randomly chosen for treatment with daily doses of fluorofenidone or placebo at 5-week-old, treatment continued until mice reach 24-week-old. Then, expression of transcriptiona factor insulin gene enhancer binding protein-1 (Islet-1) and vascular endothelial growth factor (VEGF) in murine retinas were evaluated. Retinal vascular permeability was assessed by examining the level of albumin in db/db murine retinas. Furthermore, the retinal vessel tight junction was estimated by checking the level of occludin in the murine retinal tissues. RESULTS: After occurrence of diabetic retinopthy in db/db mice, expressions of transcritpional factor Islet-1 was found to be upregulated in db/db murine retinas compared with non-diabetic controls. Similar to expression pattern of Islet-1, VEGF were also demonstrated to be increased in retinas of db/db mice, which was accompanied by increased retinal vascular leakage and decreased tight junction protein level. Systemetic administration of fluorofenidone repaired broken retinal vascular tight junction by restoring occludin expression in db/db retinal tissue. Consequently, retinal vascular premeability were indicated to be reduced by examining the transudative albumin level in diabetic retinal tissues. Both Islet-1 and VEGF expression were inhibited in the retinas of db/db mice after treatment with fluorofenidone. CONCLUSION: Fluorofenidone significantly protectes retinal tight junction and reduces retinal vascular leakage. The phenomenon can be partially attributed to reducing overexpression of Islet-1 and VEGF in diabetic retinal tissues.

Effect of angiotensin II type 1 receptor blocker and angiotensin converting enzyme inhibitor on the intraocular growth factors and their receptors in streptozotocin-induced diabetic rats

Ik Soo Byon,Dong Hyun Lee,Eun Sook Jun,Min Kyu Shin,Sung Who Park and Ji Eun Lee — 2017/6/14 0:00:00
AIM: To investigate the effect of angiotensin II type 1 receptor blocker (ARB) and angiotensin converting enzyme inhibitor (ACEI) on intraocular growth factors and their receptors in streptozotocin-induced diabetic rats. METHODS: Forty Sprague-Dawley rats were divided into 4 groups: control, diabetes mellitus (DM), candesartan-treated DM, and enalapril-treated DM (each group, n=10). After the induction of DM by streptozotocin, candesartan [ARB, 5 mg/(kg·d)] and enalapril [ACEI, 10 mg/(kg·d)] were administered to rats orally for 4wk. Vascular endothelial growth factor (VEGF) and angiotensin II (Ang II) concentrations in the vitreous were measured using enzyme-linked immunosorbent assays, and VEGF receptor 2 and angiotensin II type 1 receptor (AT1R) levels were assessed at week 4 by Western blotting. RESULTS: Vitreous Ang II levels were significantly higher in the DM group and candesartan-treated DM group than in the control (P=0.04 and 0.005, respectively). Vitreous AT1R increased significantly in DM compared to the other three groups (P<0.007). Candesartan-treated DM rats showed higher vitreal AT1R concentration than the enalapril-treated DM group and control (P<0.001 and P=0.005, respectively). No difference in vitreous Ang II and AT1R concentration was found between the enalapril-treated DM group and control. VEGF and its receptor were below the minimum detection limit in all 4 groups. CONCLUSION: Increased Ang II and AT1R in the hyperglycemic state indicate activated the intraocular renin-angiotensin system, which is inhibited more effectively by systemic ACEI than systemic ARB.

B cell receptor signaling pathway involved in benign lymphoepithelial lesions of the lacrimal gland

Xiao-Na Wang,Xin Ge,Jing Li,Xiao Liu and Jian-Min Ma — 2017/5/11 0:00:00
AIM: To detect the expression of B cell receptor signaling pathway (BCRSP) in lacrimal gland benign lymphoepithelial lesions (LGBLEL). METHODS: Gene microarray was used to compare whole-genome expression in lacrimal gland tissues from LGBLEL patients to tissues from orbital cavernous hemangioma (control tissues). Expression of BCRSP was confirmed by polymerase chain reaction (PCR) and immunohistochemistry. RESULTS: The expression of 22 genes of the BCRSP increased significantly in LGBLEL patients. PCR analysis showed that CD22, CR2, and BTK were all highly expressed in LGBLEL tissues. Immunohistochemical analysis showed that CR2 protein was present in LGBLEL, but CD22 and BTK proteins were negative. CR2, CD22, and BTK were not observed in the orbital cavernous hemangiomas with either PCR or immunohistochemistry. CONCLUSION: BCRSP might be involved in the pathogenesis of LGBLEL.

Cell viability and extracellular matrix synthesis in a co-culture system of corneal stromal cells and adipose-derived mesenchymal stem cells

2017/5/11 0:00:00
AIM: To investigate the impact of adipose-derived mesenchymal stem cells (ADSCs) on cell viability and extracellular matrix (ECM) synthesis of corneal stromal cells (CSCs). METHODS: ADSCs and CSCs were obtained from the corneas of New Zealand white rabbits and indirectly co-cultured in vitro. The proliferative capacity of CSCs in the different groups was assessed by CCK-8 assays. Annexin V-fluorescein isothiocyanate (FITC)/proliferation indices (PI) assays were used to detect the apoptosis of CSCs. The expression levels of matrix metalloproteinase (MMP), such as MMP1, MMP2, MMP9, and collagens were also evaluated by Western blot. RESULTS: ADSCs significantly promoted proliferation and invasion of CSCs in the indirect co-culture assays. The co-cultural group displayed much higher ability of proliferation, especially under the co-culture conditions of ADSCs for 3d, compared with that CSCs cultured alone. The PI of CSCs in the co-culture system were increased approximately 3-8-fold compared with the control group. A significant change was observed in the proportions of cells at apoptosis (early and late) between the negative control group (6.34% and 2.06%) and the ADCSs-treated group (4.69% and 1.59%). The expression levels of MMPs were down regulated in the co-culture models. Compared with the control group, the decrease intensities of MMP-1, MMP-2 and MMP-9 in CSCs/ADSCs group were observed, 3.90-fold, 1.09-fold and 3.03-fold, respectively. However, the increase intensities of collagen type (I, II, III, IV, and V) in CSCs were observed in CSCs/ADSCs group, 3.47-fold, 4.30-fold, 2.35-fold, 2.55-fold and 2.43-fold, respectively, compared to that in the control group. The expressions of aldehyde dehydrogenase and fibronectin in CSCs were upregulated in the co-culture models. CONCLUSION: ADSCs play a promotive role in CSCs’ growth and invasion, which may be partially associated with MMPs decrease and collagens increase, resulting in a positive participation in the plasticity and ECM synthesis of CSCs. This provided a new insight into the extensive role of ADSCs in CSCs and a potential molecular target for corneal therapy.

Ocular penetration of topically applied 1% tigecycline in a rabbit model

2017/5/11 0:00:00
AIM: To evaluate ocular penetration of topically applied 1% tigecycline. METHODS: Forty-two New Zealand White rabbits were divided into 3 groups. A 50 μL drop of 1% tigecycline was administered in group 1. In groups 2 and 3, the drop was administered every 15min for 60min (keratitis protocol). Aqueous humor samples in groups 1 and 2 were collected under general anesthesia at 15, 30, 45, 60, 120, and 180min after the last drop. All animals in group 3 were euthanatized. Cornea, vitreous and blood samples were collected 60 and 120min after the last drop. Tigecycline concentrations were measured using high performance liquid chromatography-mass spectrometry (LC-MS/MS). RESULTS: The peak aqueous humor tigecycline concentration [mean 0.73±0.14 mg/L (SD) and 2.41±0.14 mg/L, respectively] occurred 45min after topical drug application in groups 1 and 2. Group 3 mean values in the cornea, and vitreous, were 3.27±0.50 µg/g, and 0.17±0.10 mg/L at 60min and 3.17±0.77 µg/g and 0.20±0.07 mg/L at 120min, respectively. Tigecycline serum concentrations were negligible. CONCLUSION: Tigecycline levels in the aqueous humor in groups 1 and 2, and in the cornea in group 3 exceeded the minimum inhibitory concentrations of most gram-positive organisms that cause bacterial keratitis and endophthalmitis.

A novel frameshift mutation in CX46 associated with hereditary dominant cataracts in a Chinese family

2017/5/11 0:00:00
AIM: To investigate the genetic mutations that are associated the hereditary autosomal dominant cataract in a Chinese family. METHODS: A Chinese family consisting of 20 cataract patients (including 9 male and 11 female) and 2 unaffected individuals from 5 generations were diagnosed to be a typical autosomal dominant cataract pedigree. Genomic DNA samples were extracted from the peripheral blood cells of the participants in this pedigree. Exon sequence was used for genetic mutation screening. In silico analysis was used to study the structure characteristics of connexin 46 (CX46) mutant. Immunoblotting was conduceted for testing the expression of CX46. RESULTS: To determine the involved genetic mutations, 11 well-known cataract-associated genes (cryaa, cryab, crybb1, crybb2, crygc, crygd, Gja3, Gja8, Hsf4, Mip and Pitx3) were chosen for genetic mutation test by using exon sequencing. A novel cytosine insertion at position 1195 of CX46 cDNA (c.1194_1195ins C) was found in the samples of 5 tested cataract patients but not in the unaffected 2 individuals nor in normal controls, which resulted in 30 amino acids more extension in CX46C-terminus (cx46fs400) compared with the wild-type CX46. In silico protein structure analysis indicated that the mutant showed distinctive hydrophobicity and protein secondary structure compared with the wild-type CX46. The immunoblot results revealed that CX46 protein, which expressed in the aging cataract lens tissues, was absence in the proband lens. In contrast, CX50, alpha A-crystallin and alphaB-crystallin expressed equally in both proband and aging cataract tissues. Those results revealed that the cx46fs400 mutation could impair CX46 protein expression. CONCLUSION: The insertion of cytosine at position 1195 of CX46 cDNA is a novel mutation site that is associated with the autosomal dominant cataracts in this Chinese family. The C-terminal frameshift mutation is involved in regulating CX46 protein expression.

Effect of ATF3-deletion on apoptosis of cultured retinal ganglion cells

Ming-Ming Sun,Ya-Chen Wang,Yi Li,Xiao-Dan Guo,Yan-Ming Chen and Zhong-Zhi Zhang — 2017/5/11 0:00:00
AIM: To investigate the effect of activating transcription factor-3 (ATF3)-deletion on apoptosis of cultured retinal ganglion cells (RGCs). METHODS: Three ATF3 siRNA (ATF3-rat-651, ATF3-rat-319, ATF3-rat-520) were constructed, and were transiently transfected into RGC-5 cells. Quantitative real-time polymerase chain reaction (PCR) was used to examine ATF3 expression and the most effective ATF3 siRNA was selected for further studies. Flow cytometry was applied to investigate the effects of ATF3 deletion on RGC-5 apoptosis under elevated hydrostatic pressure. Quantitative real-time PCR and Western blot were performed to validate differentially expressed genes and proteins in ATF3-knockdown RGC-5 cells. RESULTS: ATF3 specific siRNA effectively down-regulated ATF3 expression and significantly inhibited cell apoptosis in RGC-5 cells. Quantitative real-time PCR and Western blot confirmed that ATF3 knockdown remarkably decreased Jun-B and increased c-Jun at both mRNA and protein levels in RGC-5 cells. CONCLUSION: ATF/cAMP-response element-binding family of transcription factors may be involved in the development of glaucoma and could be novel treatment targets for glaucoma.

Homocysteine mediates transcriptional changes of the inflammatory pathway signature genes in human retinal pigment epithelial cells

Mahavir Singh and Suresh C Tyagi — 2017/5/11 0:00:00
AIM: To test whether homocysteine (Hcy) can influence the transcriptional profile, we hypothesized that Hcy can lead to the induction of proinflammatory molecules in the retinal cells of aging people. METHODS: An unbiased in vitro inflammatory pathway focused study was designed employing retinal pigment epithelial (RPE) cell line, ARPE-19. Cells were cultured in the presence or absence of Hcy to capture target genes’ expression profile. Three different concentrations of Hcy were added in the culture medium of confluent monolayers. cRNAs were made from the isolated total RNAs and the labeled cRNA probes were hybridized to microarrays specific for human disease pathway inflammatory cytokines, chemokines and their receptor gene micro-array panels as per manufacture’s recommendations. Two Hcy up-regulated molecules: IL6 and CEBPB were further validated via Western blot analysis. Hcy’s effect on ARPE-19 cellular morphology and genomic DNA integrity were also evaluated. RESULTS: Gene microarray analyses of RPE cells in response to Hcy treatment revealed alterations in the expressions of several inflammatory gene transcripts such as CCL5, CEBPB, IL13RA2, IL15RA, IL6, IL8 and CXCL3 that were up-regulated. The transcripts for C3, CCL2, IL11RA and IL18 genes exhibited down-regulation. The IL6 and CEBPB expressions were subsequently validated at the protein levels. Treatment of the retinal cells with increasing Hcy concentration influenced their density in culture however their morphology and DNA integrity remained unaffected. CONCLUSION: These findings suggest that Hcy can potentially mediate the expression of chemokines, cytokines and interleukins receptors in the retinal cells without having any debilitating effects on their morphology and the genomic DNA integrity.

The expressions of metadherin and LEF-1 in mucosa-associated lymphoid tissue lymphoma of ocular adnexal

Dan Qi,Hong Lin,Yan Gao,Jing Lin,Li-Ting Hu and Gui-Qiu Zhao — 2017/5/11 0:00:00
AIM: To investigate the expressions of metadherin (astrocyte elevated gene-1, AEG-1) and lymphoid enhancer-binding factor-1 (LEF-1) in ocular adnexal mucosa-associated lymphoid tissue (MALT) lymphoma. METHODS: The expressions of AEG-1 and LEF-1 were detected on specimens harvested from patients suffering from MALT lymphoma and lymphadenosis of ocular adnexal in Ophthalmology Department, Affiliated Hospital of Qingdao University from 2000 to 2015 by immunohistochemical and polymerase chain reaction (PCR) analysis. RESULTS: AEG-1 and LEF-1 expressions in MALT lymphoma was respectively higher than that in lymphadenosis, both by immunohistochemical and PCR analysis (P<0.05). Diversity of AEG-1 and LEF-1 expressions in different Ann Arbor clinical stages showed a statistically significant result (P<0.05). A positive relevance between AEG-1 and LEF-1 was observed in MALT ocular adnexal lymphoma (r=0.435, P=0.016). CONCLUSION: The over expressions of AEG-1 and LEF-1 at the level of protein and mRNA participates in the tumorigenesis of ocular adnexal MALT lymphoma. They should act as a new biological marker for pathological diagnosis in the future.

Comparison of the impact of epigallocatechin gallate and ellagic acid in an experimental cataract model induced by sodium selenite

Irfan Ergen, Burak Turgut and Nevin Ilhan — 2017/4/14 0:00:00
AIM: To compare the potential protective effects of epi-gallocatechin gallate (EGCG) and ellagic acid (EA) in an experimental cataract model. METHODS: Twenty-eight Spraque-Dawley rat pups were assigned into four groups. All the rats, except for those in the control group, were injected subcutaneously sodium selenite to induce experimental cataract on the postpartum ninth day, and between 10th and 14th days. Rats in the sham, EGCG, and EA groups were intraperitoneally administered 50 mg/(kg·d) saline solution, 50 mg/(kg·d) EGCG and 200 mg/(kg·d) EA, respectively. The reduced glutathione (GSH) and malondialdehyde (MDA) levels, total antioxidant status (TAS) and total oxidant status (TOS) in lens supernatants were measured. RESULTS: The mean cataract gradings in EGCG and EA groups were found to be significantly lower than that in sham group (P<0.001). The mean GSH levels and TASs in EGCG and EA groups were significantly higher than that in sham group while mean MDA levels and TOSs in EGCG and EA groups were significantly lower than that in the sham group (P<0.001). CONCLUSION: EGCG and EA have protective effects on cataract development via the inhibition of oxidative stress.

Oxidative stress affects retinal pigment epithelial cell survival through epidermal growth factor receptor/AKT signaling pathway

2017/4/14 0:00:00
AIM: To investigate the cross-talk between oxidative stress and the epidermal growth factor receptor (EGFR)/AKT signaling pathway in retinal pigment epithelial (RPE) cells. METHODS: Human RPE cell lines (ARPE-19 cell) were treated with different doses of epidermal growth factor (EGF) and hydrogen peroxide (H2O2). Cell viability was determined by a methyl thiazolyl tetrazolium assay. Cell proliferation was examined by a bromodeoxyuridine (BrdU) incorporation assay. EGFR/AKT signaling was detected by Western blot. EGFR localization was also detected by immunofluorescence. In addition, EGFR/AKT signaling was intervened upon by EGFR inhibitor (erlotinib), PI3K inhibitor (A66) and AKT inhibitor (MK-2206), respectively. H2O2-induced oxidative stress was blocked by antioxidant N-acetylcysteine (NAC). RESULTS: EGF treatment increased ARPE-19 cell viability and proliferation through inducing phosphorylation of EGFR and AKT. H2O2 inhibited ARPE-19 cell viability and proliferation and also suppressed EGF-stimulated increase of RPE cell viability and proliferation by affecting the EGFR/AKT signaling pathway. EGFR inhibitor erlotinib blocked EGF-induced phosphorylation of EGFR and AKT, while A66 and MK-2206 only blocked EGF-induced phosphorylation of AKT. EGF-induced phosphorylation and endocytosis of EGFR were also affected by H2O2 treatment. In addition, antioxidant NAC attenuated H2O2-induced inhibition of ARPE-19 cell viability through alleviating reduction of EGFR, and phosphorylated and total AKT proteins. CONCLUSION: Oxidative stress affects RPE cell viability and proliferation through interfering with the EGFR/AKT signaling pathway. The EGFR/AKT signaling pathway may be an important target in oxidative stress-induced RPE cell dysfunction.

Differential expression of breast cancer-resistance protein, lung resistance protein, and multidrug resistance protein 1 in retinas of streptozotocin-induced diabetic mice

Meng-Shuang Li,Meng Xin,Chuan-Long Guo,Gui-Ming Lin,Jun Li and Xiang-Gen Wu — 2017/4/14 0:00:00
AIM: To investigate the altering expression profiles of efflux transporters such as breast cancer-resistance protein (BCRP), lung resistance protein (LRP), and multidrug resistance protein 1 (MDR1) at the inner blood-retinal barrier (BRB) during the development of early diabetic retinopathy (DR) and/or aging in mice. METHODS: Relative mRNA and protein expression profiles of these three efflux transporters in the retina during the development of early DR and/or aging in mice were examined. The differing expression profiles of Zonula occludens 1 (ZO-1) and vascular endothelial growth factor-A (VEGFA) in the retina as well as the perfusion characterization of fluorescein isothiocyanate (FITC)-dextran and Evans blue were examined to evaluate the integrity of the inner BRB. RESULTS: There were significant alterations in these three efflux transporters’ expression profiles in the mRNA and protein levels of the retina during the development of diabetes mellitus and/or aging. The development of early DR was confirmed by the expression profiles of ZO-1 and VEGFA in the retina as well as the compromised integrity of the inner BRB. CONCLUSION: The expression profiles of some efflux transporters such as BCRP, LRP, and MDR1 in mice retina during diabetic and/or aging conditions are tested, and the attenuated expression of BCRP, LRP, and MDR1 along with the breakdown of the inner BRB is found, which may be linked to the pathogenesis of early DR.

Inhibition of cell proliferation, migration and apoptosis in blue-light illuminated human retinal pigment epithelium cells by down-regulation of HtrA1

Tian Yu,Chang-Zheng Chen and Yi-Qiao Xing — 2017/4/14 0:00:00
AIM: To investigate the effect of HtrA1 on the proliferation, migration and apoptosis of human retinal pigment epithelium (RPE) cells in the light injured model, as well as the expression of the apoptosis related molecules. METHODS: The human RPE cell line ARPE-19 was exposed to blue light to establish the light injured model. The cells were transfected with HtrA1 siRNA to knockdown HtrA1 expression. Subsequent expression of HtrA1 was determined by real-time polymerase chain reaction (RT-PCR) and Western blot, respectively. Changes in cell proliferation, migration and apoptosis were assessed by cell counting kit-8 (CCK-8), Transwell assay and flow cytometry respectively, as well as changes in the mRNA and protein levels of Bax, Caspase-3 and Bcl-2 expression. RESULTS: HtrA1 was highly expressed in ARPE-19 cells after blue light irradiation. Knockdown of HtrA1 expression inhibited the proliferation, migration and apoptosis of the blue-light-irradiated ARPE-19 cells (P<0.05). Bax and Caspase-3 expression were significantly reduced both at mRNA and protein levels (P<0.05) after siRNA treatment. Bcl-2 expression significantly increased in blue-light-irradiated ARPE-19 cells after siRNA interference (P<0.05). CONCLUSION: Silence of HtrA1 may inhibit the proliferation, migration and apoptosis of ARPE-19 cells in light injured model. Moreover, HtrA1 suppression in blue-light-irradiated ARPE-19 cells may ameliorate cell apoptosis through down-regulation of Bax and Caspase-3, and up-regulation of Bcl-2 expression.

MicroRNA-126: a promising novel biomarker in peripheral blood for diabetic retinopathy

Li-Li Qin,Mei-Xia An,Yan-Li Liu,Han-Chun Xu and Zhi-Qing Lu — 2017/4/14 0:00:00
AIM: To investigate the content of serum microRNA-126 (miR-126) and its role in screening retinal endothelial injury and early diagnosis of proliferative diabetic retinopathy. METHODS: The study included 184 serum samples, 59 samples from healthy individuals, 44 samples from diabetes mellitus (DM) patients without diabetic retinopathy (NDR), 42 from non-proliferative diabetic retinopathy (NPDR) patients and 39 samples from proliferative diabetic retinopathy (PDR) patients. The expression of miR-126 was evaluated using a real-time quantitative polymerase chain reaction. RESULTS: The serum content of miR-126 declined as the damage degree in the retina. There was significant difference between the two retinopathy groups (P<0.001). No difference was observed in miR-126 content between healthy individuals and NDR patients (P>0.05). Receiver operating characteristic curve (ROC) analyses indicated that serum miR-126 had significant diagnostic value for PDR. It yielded an area under the curve (AUC) of ROC of 0.976 with 81.21% sensitivity and 90.34% specificity in discriminating PDR from healthy controls, and an AUC of ROC of 0.919 with 84.75% sensitivity and 94.41% specificity in discriminating NDR and NPDR from healthy controls. When the diagnostic threshold was greater than or equal to 8.43, there was an increase in the possibility of NPDR. When the content of miR-126 was less than or equal to 5.02, the possibility of the occurrence of PDR increased. CONCLUSION: Serum miR-126 can serve as a non-invasive biomarker for screening retinal endothelial injury and early diagnosis PDR.

Interleukin-13 and age-related macular degeneration

Bo Fu,Zhe-Li Liu,Han Zhang and Feng Gu — 2017/4/14 0:00:00
AIM: To identify the effects of interleukin (IL)-13 on retinal pigment epithelial (RPE) cells and the IL-13 level in aqueous humor of age-related macular degeneration (AMD) patients. METHODS: IL-13 levels in aqueous humor specimens from AMD patients were detected with enzyme-linked immunosorbent assay (ELISA). ARPE-19 cells were treated with 10 ng/mL IL-13 for 12, 24, and 48h. The cell proliferaton was evaluated by the MTS method. The mRNA and protein levels of α-SMA and ZO-1 were evaluated with quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot respectively. The expression of tumor necrosis factor-α (TNF-α), transforming growth factor-β (TGF-β) and vascular endothelial growth factor (VEGF) were assessed by ELISA. RESULTS: IL-13 levels in the aqueous humor of patients with AMD were significantly higher than those in the control (167.33±17.64 vs 27.12±5.65 pg/mL; P<0.01). In vitro, IL-13 of high concentrations (10, 15, and 20 ng/mL) inhibited ARPE-19 cell proliferation. α-SMA mRNA in ARPE-19 cell were increased (1.017±0.112 vs 1.476±0.168; P<0.001) and ZO-1 decreased (1.051±0.136 vs 0.702±0.069; P<0.001) after treated with 10 ng/mL IL-13 for 48h. The protein expression of α-SMA and ZO-1 also showed the same tendency (α-SMA: P=0.038; ZO-1: P=0.008). IL-13 significantly reduced the level of TNF-α (44.70±1.67 vs 31.79±3.53 pg/mL; P=0.005) at 48h, but the level of TGF-β2 was significantly increased from 34.44±2.92 to 57.61±6.31 pg/mL at 24h (P=0.004) and from 61.26±1.11 to 86.91±3.59 pg/mL at 48h (P<0.001). While expressions of VEGF didn’t change after IL-13 treatment. CONCLUSION: IL-13 in vitro inhibit ARPE-19 cell proliferation and expression in the aqueous may be associated with AMD.

Neuroprotective effects of gypenosides in experimental autoimmune optic neuritis

2017/4/14 0:00:00
AIM: To determine whether gypenosides have protective effects in experimental autoimmune optic neuritis (EAON). METHODS: Mice were randomly divided into seven groups: control group, model group, three different density gypenosides monotherapy, methylprednisolone monotherapy, combination of gypenosides and methylprednisolone group. The control group was subcutaneously injected with oil emulsion adjuvant and all other groups were subcutaneously immunized with an emulsified mixture of myelin oligodendrocyte glycoprotein (MOG) 35-55 peptide to induce EAON. Mice in the gypenosides groups were administered injections daily with three concentrations (15 mg/kg, 30 mg/kg, 45 mg/kg) of gypenosides respectively. Mice in the methylprednisolone group and the combination treatment group were injected daily with methylprednisolone (20 mg/kg) or methylprednisolone (20 mg/kg) + gypenosides (30 mg/kg), respectively. After MOG immunization, visual evoked potential (VEP), optical coherence tomography (OCT), and histopathologic examination were performed at 14, 20, 30, and 40d post-inoculation (p.i.). All results were expressed as mean±SEM. The data were evaluated by one-way ANOVA followed by Tukey or Games-Howell test. RESULTS: Compared with the control group, p2 latency was prolonged in the model group (P=0.041). Combination treatment can alleviated the change in VEP at 20d p.i. (P=0.012). Average peripapillary retinal nerve fiber layer (RNFL) thickness was reduced in the model group (P= 0.000, 30d; P=0.000, 40d) and gypenosides treatment remarkably diminished the degree of RNFL degeneration at 30d and 40d p.i (P=0.000, 30d; P=0.000, 40d). The pathomorphological results showed a decrease in demye-lination (P=0.020) and inflammatory reactions in the combination group compared with the model group (20d p.i.). Gypenosides treatment also alleviated the degree of axonal loss (40d p.i.) (P=0.003). CONCLUSION: Treatment with gypenosides exerts protective effects on retinal nerve fibers and axons in EAON. When combined with gypenosides, methylprednisolone reduces demyelination in the acute stage of EAON.

Expression and role of specificity protein 1 in the sclera remodeling of experimental myopia in guinea pigs

Bo Jiang,Zhang-You Wu,Zi-Cheng Zhu,Gen-Jie Ke,Yue-Chun Wen and Si-Qin Sun — 2017/4/14 0:00:00
AIM: To study the expression of collagen I and transcription factor specificity protein 1 (Sp1), a transforming growth factor-β1 (TGF-β1) downstream target, and reveal the impact of the TGF-β1-Sp1 signaling pathway on collagen remodeling in myopic sclera. METHODS: Seventy-five 1-week-old guinea pigs were randomly divided into normal control, form deprivation myopia (FDM), and self-control groups. FDM was induced for different times using coverage with translucent latex balloons and FDM recovery was performed for 1wk after 4wk treatment; then, changes in refractive power and axial length were measured. Immunohistochemistry and reverse transcription-polymerase chain reaction were used to evaluate dynamic changes in collagen I and Sp1 expression in the sclera of guinea pigs with emmetropia and experimental myopia, and the relationship between collagen I and Sp1 levels was analyzed. RESULTS: In the FDM group, the refractive power was gradually changed (from 2.09±0.30 D at week 0 to -1.23±0.69 D, -4.17±0.59 D, -7.07±0.56 D, and -4.30±0.58 D at weeks 2, 4, 6, and 1wk after 4wk, respectively; P<0.05), indicating deepening of myopia. The axial length was increased (from 5.92±0.39 mm at week 0 to 6.62±0.36 mm, 7.30±0.34 mm, 7.99±0.32 mm, and 7.41±0.36 mm at weeks 2, 4, 6, and 1wk after 4wk; P<0.05). The mRNA and protein expression of Sp1 and collagen I in the sclera of the FDM group was lower than that of the control groups (P<0.05), and the reduction was eye-coverage time-dependent. Furthermore, correlation between Sp1 and collagen I down-regulation in the myopic sclera was observed. CONCLUSION: Our data indicate that transcription factor Sp1 may be involved in the regulation of type I collagen synthesis/degradation during myopic sclera remodeling, suggesting that TGF-β1 signaling plays a role in the development and progression of myopia.

Expressions of matrix metalloproteinases 1 and 3 and their tissue inhibitors in the conjunctival tissue and fibroblasts cultured from conjunctivochalasis

2017/4/14 0:00:00
AIM: To investigate the expression of matrix metalloproteinases 1 and 3 (MMP-1 and MMP-3) and their tissue inhibitors of metalloproteinases 1 and 3 (TIMP-1 and TIMP-3) in the conjunctiva of eyes with conjunctivochalasis (CCh). METHODS: The conjunctival tissue was obtained from the CCh patients and controls, the MMPs/TIMPs expression concentration was determined by enzyme-linked immuno-sorbent assay (ELISA) and immunofluorescence staining. The expression levels of MMPs/TIMPs in the CCh fibro-blasts were determined by analyzing its concentration in the cellular supernatant that was abstracted from the in vitro cultured CCh fibroblasts. RESULTS: MMP-1 and MMP-3 levels determined by ELISA were both significantly higher in the CCh group than that in the control group (P=0.042, 0.022, respectively), so was the levels of TIMP-1 (P=0.010). No significant difference in the expression of TIMP-3 in conjunctiva was found between the two groups (P=0.298). The expression of MMP-1 and MMP-3 were both up-regulated significantly in the CCh group (P=0.040, 0.001, respectively) on immuno-fluorescence staining. MMP-1 and MMP-3 expression in the fibroblasts were both significantly higher in the CCh group than that in the control group (P=0.027, 0.001, respectively), while neither the TIMP-1 nor TIMP-3 expression was significantly different between the two groups (P=0.421, 0.237, respectively). CONCLUSION: The overexpression of MMP-1 and MMP-3 in conjunctival tissue and fibroblasts may play an important role in the pathogenesis and development of CCh.

Soluble expression of recomb inant cMyc, Klf4, Oct4, and Sox2 proteins in bacteria and transduction into living cells

2017/4/14 0:00:00
AIM: To develop a new method to produce recombinant reprogramming proteins, cMyc, Klf4, Oct4, and Sox2, in soluble format with low cost for the generation of induced pluripotent stem cells (iPSCs). METHODS: A short polypeptide sequence derived from the HIV trans-activator of transcription protein (TAT) and the nucleus localization signal (NLS) polypeptide were fused to the N terminus of the reprogramming proteins and they were constructed into pCold-SUMO vector which can extremely improve the solubility of recombinant proteins. Then these vector plasmids were transformed into E. coli BL21 (DE3) Chaperone competent cells for amplification. The solubility of these recombinant proteins was determined by SDS-PAGE and Coomassie brilliant blue staining. The recombinant proteins were purified by Ni-NTA resin and identified by Western blot. The transduction of these proteins into HEK 293T cells were evaluated by immunofluorescence staining. RESULTS: These four reprogramming proteins could be produced in soluble format in pCold-SUMO expression vector system with the assistance of chaperone proteins in bacteria. The proteins were purified successfully with a purity of over 70% with a relative high transduction rate into 293 cells. CONCLUSION: The results in the present study indicate the four important reprogramming proteins, cMyc, Klf4, Oct4, and Sox2, can be produced in soluble format in bacteria with low cost. Our new method thus might be expected to greatly contribute to the future study of iPSCs.

Effects of exogenous recombinant human bone morphogenic protein-7 on the corneal epithelial mesenchymal transition and fibrosis

2017/3/14 0:00:00
AIM: To evaluate the effect of exogenous recombinant human bone morphogenic protein-7 (rhBMP-7) on transforming growth factor-β (TGF-β)-induced epithelial mesenchymal cell transition (EMT) and assessed its antifibrotic effect via topical application. METHODS: The cytotoxic effect of rhBMP-7 was evaluated and the EMT of human corneal epithelial cells (HECEs) was induced by TGF-β. HECEs were then cultured in the presence of rhBMP-7 and/or hyaluronic acid (HA). EMT markers, fibronectin, E-cadherin, α-smooth muscle actin (α-SMA), and matrix metaloproteinase-9 (MMP-9), were evaluated. The level of corneal fibrosis and the reepithelization rate were evaluated using a rabbit keratectomy model. Expression of α-SMA in keratocytes were quantified following treatment with different concentrations of rhBMP-7. RESULTS: Treatment with rhBMP-7 attenuated TGF-β-induced EMT in HECEs. It significantly attenuated fibronectin secretion (31.6%; P<0.05), the α-SMA protein level (72.2%; P<0.01), and MMP-9 expression (23.6%, P<0.05) in HECEs compared with cells grown in the presence of TGF-β alone. E-cadherin expression was significantly enhanced (289.7%; P<0.01) in the presence of rhBMP-7. Topical application of rhBMP-7 combined with 0.1% HA significantly reduced the amount of α-SMA+ cells by 43.18% (P<0.05) at a concentration of 2.5 µg/mL and by 47.73% (P<0.05) at 25 µg/mL, compared with the control group, without disturbing corneal reepithelization. CONCLUSION: rhBMP-7 attenuates TGF-β-induced EMT in vitro, and topical application of rhBMP-7 reduces keratocyte myodifferentiation during the early wound healing stages in vivo without hindering reepithelization. Topical rhBMP-7 application as biological eye drops seems to be feasible in diseases involving TGF-β-related corneal fibrosis with corneal reepithelization disorders.

Edge detection and mathematic fitting for corneal surface with Matlab software

Yue Di,Mei-Yan Li,Tong Qiao and Na Lu — 2017/3/14 0:00:00
AIM: To select the optimal edge detection methods to identify the corneal surface, and compare three fitting curve equations with Matlab software. METHODS: Fifteen subjects were recruited. The corneal images from optical coherence tomography (OCT) were imported into Matlab software. Five edge detection methods (Canny, Log, Prewitt, Roberts, Sobel) were used to identify the corneal surface. Then two manual identifying methods (ginput and getpts) were applied to identify the edge coordinates respectively. The differences among these methods were compared. Binomial curve (y=Ax2+Bx+C), Polynomial curve [p(x)=p1xn+p2xn-1 +....+pnx+pn+1] and Conic section (Ax2+Bxy+Cy2+Dx+Ey+F=0) were used for curve fitting the corneal surface respectively. The relative merits among three fitting curves were analyzed. Finally, the eccentricity (e) obtained by corneal topography and conic section were compared with paired t-test. RESULTS: Five edge detection algorithms all had continuous coordinates which indicated the edge of the corneal surface. The ordinates of manual identifying were close to the inside of the actual edges. Binomial curve was greatly affected by tilt angle. Polynomial curve was lack of geometrical properties and unstable. Conic section could calculate the tilted symmetry axis, eccentricity, circle center, etc. There were no significant differences between ‘e’ values by corneal topography and conic section (t=0.9143, P=0.3760 >0.05). CONCLUSION: It is feasible to simulate the corneal surface with mathematical curve with Matlab software. Edge detection has better repeatability and higher efficiency. The manual identifying approach is an indispensable complement for detection. Polynomial and conic section are both the alternative methods for corneal curve fitting. Conic curve was the optimal choice based on the specific geometrical properties.

Two mutations in the transforming growth factor beta-induced gene associated with familial Lattice corneal dystrophy

Wen-Ping Cao, Hai-Gang Yuan, Ping Liu, Xue Li and Qi Hu — 2017/3/14 0:00:00
AIM: To report a phenotypic variant pedigree of lattice corneal dystrophy (LCD) associated with two mutations, R124C and A546D, in the transforming growth factor beta-induced gene (TGFBI). METHODS: A detailed ocular examination was taken for all participants of a LCD family. Peripheral blood leukocytes from each participant were extracted to obtain the DNA. Polymerase chain reaction (PCR) of all seventeen exons of TGFBI gene was performed. The products were sequenced and analyzed. Histological examination was carried out after a penetrating keratoplasty from the right eye of proband. RESULTS: Genetic analysis showed that the proband and all 6 affected individuals harbored both a heterozygous CGC to TGC mutation at codon 124 and a heterozygous GCC to GAC mutation at codon 546 of TGFBI. None of the 100 control subjects and unaffected family members was positive for these two mutations. Ocular examination displayed multiple refractile lattice-like opacities in anterior stroma of the central cornea and small granular deposits in the peripheral cornea. The deposits were stained positively with Congo red indicating be amyloid in nature and situated mainly in the anterior and middle stroma. CONCLUSION: We observed a novel LCD family which carried two pathogenic mutations (R124C and A546D) in the TGFBI gene. The phenotypic features were apparently different from those associated with corresponding single mutations. The result reveals that although the definite mutation is the most important genetic cause of the disease, some different modifier alleles may influence the phenotype.

Mathematical analysis of corneal remodelling after intracorneal ring surgery in keratoconus

2017/3/14 0:00:00
AIM: To represent mathematically the intersection between the ectatic corneal geometry and the plane of intracorneal ring implants (ICRS) in order to determine the corneal response to ICRS surgery in keratoconus (KC). Thereafter, to present the concept and early results of a newly derived topography-guided nomogram for ICRS surgery for the treatment of keratectasia. METHODS: The corneal rings plane intersection was modelled to a conic section. Ring effect was the result of: the ring size, position (steep vs flat), location (distance from the geometric centre of the cornea), and the discrepancy between the ring’s curvature and the tunnel’s curvature. Femtosecond laser was used to create the tunnels and the incision sites were chosen according to the nomogram in order to place the thickest ring in the steepest portion of the cornea regardless of the astigmatism axis of refraction. RESULTS: The conic section had a more prolate shape in the steep area of the cornea than in the flat area, depending on the corneal sagittal curvature. Equal ring size had more flattening effect in the steep area than in the flat area. Thick segment should be implanted under the steep portion of the cornea regardless of the cylinder axis of refraction. Single segment in the steep area was sufficient in early and moderate cases of KC. The new nomogram provided more topographic regularity with significant reduction of astigmatism and better improvement in uncorrected visual acuity (UCVA) and best-corrected visual acuity (BCVA) than the conventional nomogram. CONCLUSION: The newly derived nomogram can produce better results than the conventional nomogram. Moreover, based on this concept, a new nomogram can be integrated into the femtosecond laser software to create topography-guided, customized, elliptical tunnels with modified focal asphericity that allows for customized focal flattening of the irregularly steepened ectatic cornea.

Biomechanics of sclera crosslinked using genipin in rabbit

Tai-Xiang Liu and Zheng Wang — 2017/3/14 0:00:00
AIM: To strengthen the biomechanics of collagen by crosslinking rabbit scleral collagen with genipin to develop a new therapy for preventing myopic progression. METHODS: Ten New Zealand rabbits were treated with 0.5 mmol/L genipin injected into the sub-Tenon’s capsule in the right eyes. Untreated contralateral eyes served as the control. The treated area was cut into scleral strips measuring 4.0 mm×10.0 mm for stress-strain measurements (n=5). The remaining five treated eyes were prepared for histological examination. RESULTS: Compared to the untreated scleral strips, the genipin-crosslinked scleral strips showed that the ultimate stress and Young’s modulus at 10% strain were increased by the amplitude of 130% and 303% respectively, ultimate strain was decreased by 24%. There had no (-smooth muscle actin ((-SMA) positive cells in control and treated sclera. Histologically, there was no sign of apoptosis in the sclera, choroid, and retina; and no side effects were found in the peripheral cornea and optic nerve adjacent to the treatment area. CONCLUSION: Genipin induced crosslinking of collagen can increase its biomechanical behavior by direct strengthening of the extracellular matrix in rabbit sclera, with no (-SMA expression seen in the myofibroblasts. As there is no evidence of cytotoxicity in the scleral, choroidal, and retinal cells, genipin is likely a promising agent to strengthen the weakened sclera to prevent myopic progression.

Expression of lens-related microRNAs in transparent infant lenses and congenital cataract

Chang-Rui Wu,Min Ye,Li Qin,Yue Yin and Cheng Pei — 2017/3/14 0:00:00
AIM: To identify the expression of lens-related microRNAs (miRNAs) in the central epithelium of transparent infant lenses and congenital cataract. METHODS: Lens-related miRNAs were retrieved from PubMed database. The expression levels of these miRNAs in transparent infant lenses and congenital cataract were determined by stem-loop reverse transcription-polymerase chain reaction (RT-PCR). miRanda algorithm was used to predict the target genes of these differentially expressed miRNAs. The target mRNA was validated. RESULTS: Six lens-related miRNAs were retrieved from screening PubMed database. The most abundant miRNA in transparent infant lenses according to stem-loop RT-PCR was miR-184. miR-182 was up-regulated in congenital cataract. Contrarily, miR-204 and miR-124 was down-regulated. miR-204 exhibited a more significant decrease in expression than miR-124. In addition, Meis2 was predicted to be the target of miR-204 using miRanda algorithm. miR-204 mimic/antagomir transfection experiments suggested the negative correlation between the expression of miR-204 and Meis2. CONCLUSION: The expression levels of miR-182, miR-204 and miR-124 differ between the central epithelium of transparent infant lens and congenital cataract, suggesting their involvement in the pathogenesis of congenital cataract. miR-204 may act via silencing Meis2 to regulate lens development and congenital cataract formation.

Effect of bevacizumab on the expression of fibrosis-related inflammatory mediators in ARPE-19 cells

San-Jun Chu,Zhao-Hua Zhang,Min Wang and Hai-Feng Xu — 2017/3/14 0:00:00
AIM: To investigate the effect of anti-vascular epithelial growth factor (VEGF) agents on the expression of fibrosis-related inflammatory mediators under normoxic and hypoxic conditions, and to further clarify the mechanism underlying fibrosis after anti-VEGF therapy. METHODS: Human retinal pigment epithelial (RPE) cells were incubated under normoxic and hypoxic conditions. For hypoxia treatment, CoCl2 at 200 μmol/L was added to the media. ARPE-19 cells were treated as following: 1) control group: no treatment; 2) bevacizumab group: bevacizumab at 0.25 mg/mL was added to the media; 3) hypoxia group: CoCl2 at 200 μmol/L was added to the media; 4) hypoxia+bevacizumab group: CoCl2 at 200 μmol/L and bevacizumab at 0.25 mg/mL were added to the media. The expression of interleukin (IL)-1β, IL-6, IL-8 and tumor necrosis factor (TNF)-α were evaluated using real-time polymerase chain reaction (RT-PCR) and enzyme-linked immunosorbent assay (ELISA) at 6, 12, 24 and 48h. RESULTS: Both mRNA and protein levels of IL-1β, IL-6 and IL-8 were statistically significantly higher in the bevacizumab group than in the control group at each time point, and TNF-α gene and protein expression was only significantly higher only at 24 and 48h (P<0.05). Under hypoxic conditions, bevacizumab significantly increased the expression of IL-1β, IL-6, IL-8 and TNF-α at 6, 12, 24 and 48h (P<0.05). IL-1β, IL-8 and TNF-α peaked at 24h and IL-6 peaked at 12h after the bevacizumab treatment under both normoxic and hypoxic conditions. CONCLUSION: Treatment of ARPE-19 cells with bevacizumab can significantly increase the expression of fibrosis-related inflammatory mediators under both normoxic and hypoxic conditions. Inflammatory factors might be involved in the process of fibrosis after anti-VEGF therapy, and the up-regulation of inflammatory factors induced by anti-VEGF drugs might promote the fibrosis process.

The anti-inflammatory effects of asiatic acid in lipopolysaccharide-stimulated human corneal epithelial cells

Hao Chen, Xiao-Min Hua, Bai-Chen Ze, Bin Wang and Li Wei — 2017/2/10 0:00:00
AIM: To investigate the anti-inflammatory effects of asiatic acid (AA) on lipopolysaccharide (LPS)-induced inflammatory response in human corneal epithelial cells (HCECs). METHODS: Cell viability was measured using a cell counting kit-8 (CCK-8) assay. Quantitative real-time polymerase chain reaction (qRT-PCR) was used to determine the mRNA expression of interleukin-8 (IL-8), interleukin-6 (IL-6), interleukin-1β (IL-1β), tumor necrosis factor-alpha (TNF-α), and transforming growth factor-β (TGF-β) in HCECs. Intracellular reactive oxygen species (ROS) was measured using the ROS assay kit. Glutathione (GSH) concentration was measured using the total GSH assay kit. Akt1 and Akt phosphorylation (p-Akt1) levels were measured by Western blotting and immunofluorescence. RESULTS: AA induced toxicity at high concentrations and significantly stimulated the proliferation of HCECs at concentrations of 20 μmol/L for 1h. LPS at concentrations of 300 ng/mL for 1h significantly stimulated the mRNA expression of IL-8, IL-6, IL-1β, TNF-α, and TGF-β in HCECs, while the stimulation effects were significantly inhibited by AA (20 μmol/L). In addition, AA was found to decrease the content of ROS, increase GSH generation, and also inhibit LPS-induced p-Akt in HCECs. CONCLUSION: AA decreases the generation of inflammatory factors IL-8, IL-6, IL-1β, TNF-α, and TGF-β in LPS-stimulated HCECs. AA significantly inhibites the intracellular concentrations of ROS and increases GSH generation. AA also inhibites LPS-induced p-Akt in HCECs. These findings reveal that AA has anti-inflammation effects in LPS-stimulated HCECs.

Intraocular pressure with rebound tonometry and effects of topical intraocular pressure reducing medications in guinea pigs

Yue Di, Xiu-Mei Luo, Tong Qiao and Na Lu — 2017/2/10 0:00:00
AIM: To investigate the intraocular pressure (IOP) of adult guinea pig eyes with rebound tonometry (RBT), and assess the effects of four distinctive topical IOP reducing medications including Carteolol, Brimonidine, Brinzolamide and Latanoprost. METHODS: The IOPs of twenty-four 12-week-old guinea pigs (48 eyes) were measured every two hours in one day with RBT as baselines. All the animals were then divided into four groups (Carteolol, Brimonidine, Brinzolamide and Latanaprost groups, n=6). The IOPs were measured and compared to the baseline 1, 2, 3, 5, 7, 9, 15 and 24h after treatment. RESULTS: The mean baseline IOP of 24 guinea pigs (48 eyes) was 10.3±0.36 mm Hg (6-13 mm Hg) and no binocular significant differences of IOPs were observed (t=1.76, P>0.05). No significant difference of IOP in Carteolol group at each time point was observed before and after treatment (t=1.48, P>0.05). In Brimonidine group, IOP was 2.2±1.9 mm Hg lower than the baseline after one hour (t=3.856, P=0.003) and lasted for one hour. In Brinzolamide group, IOP was 1.4±1.1 mm Hg lower than the baseline after one hour (t=4.53, P=0.001) and lasted for 7h and the IOP declined most at 3h. In Latanaprost group, IOP was 2.1±1.3 mm Hg lower than the baseline after one hour (t=6.11, P=0.001) and lasted for one hour. CONCLUSION: The IOP of guinea pig eyes is relatively stable compared to human eyes. In four reducing IOP medications, no significant effect of Carteolol is observed. Brinzolamide has the longest duration, while the Brimonidine has the shortest duration and the maximum level of treatment.

Light-emitting-diode induced retinal damage and its wavelength dependency in vivo

Yu-Man Shang, Gen-Shuh Wang, David H. Sliney, Chang-Hao Yang and Li-Ling Lee — 2017/2/10 0:00:00
AIM: To examine light-emitting-diode (LED)-induced retinal neuronal cell damage and its wavelength-driven pathogenic mechanisms. METHODS: Sprague-Dawley rats were exposed to blue LEDs (460 nm), green LEDs (530 nm), and red LEDs (620 nm). Electroretinography (ERG), Hematoxylin and eosin (H&E) staining, transmission electron microscopy (TEM), terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL), and immunohistochemical (IHC) staining, Western blotting (WB) and the detection of superoxide anion (O2-·), hydrogen peroxide (H2O2), total iron, and ferric (Fe3+) levels were applied. RESULTS: ERG results showed the blue LED group induced more functional damage than that of green or red LED groups. H&E staining, TUNEL, IHC, and TEM revealed apoptosis and necrosis of photoreceptors and RPE, which indicated blue LED also induced more photochemical injury. Free radical production and iron-related molecular marker expressions demonstrated that oxidative stress and iron-overload were associated with retinal injury. WB assays correspondingly showed that defense gene expression was up-regulated after the LED light exposure with a wavelength dependency. CONCLUSION: The study results indicate that LED blue-light exposure poses a great risk of retinal injury in awake, task-oriented rod-dominant animals. The wavelength-dependent effect should be considered carefully when switching to LED lighting applications.

The effects of anti-vascular endothelial growth factor agents on human retinal pigment epithelial cells under high glucose conditions

Jong Rok Oh, Jung Woo Han, Yoon Kyung Kim, Young-Hoon Ohn and Tae Kwann Park — 2017/2/10 0:00:00
AIM: To investigate the effects of high glucose levels and anti-vascular endothelial growth factor (VEGF) agents (bevacizumab, ranibizumab and aflibercept) on retinal pigment epithelium (RPE) cells. METHODS: ARPE-19 cells were cultured at different glucose levels (5.5 mmol/L, 25 mmol/L, and 75 mmol/L). Cell viability was evaluated by MTT assay at 3d after treatment with D-glucose. Cell migration ability was measured by wound healing assay at 3d. A cell death detection kit was used to assess apoptosis at 3 and 14d. Cell proliferation was assessed by EdU assay at 3d. The culture medium was treated with anti-VEGF agents at clinically relevant concentrations. The experiment was then repeated at a different glucose level. RESULTS: The viability and migration of ARPE-19 cells were significantly decreased in the presence of 75 mmol/L as compared to 5.5 mmol/L glucose. The percentage of TUNEL-positive cells was significantly increased and the proliferative potential was decreased with 75 mmol/L compared to 5.5 mmol/L glucose. There were no significant differences in the results between 25 mmol/L and 5.5 mmol/L glucose. In the presence of 75 mmol/L glucose, the groups treated with anti-VEGF showed decreased cell viability and proliferation and increased apoptosis. However, there were no significant differences between the anti-VEGF groups. CONCLUSION: High glucose level decreases the viability, wound healing ability, and proliferation of RPE cells, while increasing apoptosis. Furthermore, anti-VEGF agents interfered with the physiological functions of RPE cells under high-glucose conditions, accompanied by decreases in cell viability and proliferation.

Vasoactive intestinal peptide, a promising agent for myopia?

2017/2/10 0:00:00
AIM: To investigate the role of vasoactive intestinal peptide (VIP) in form-deprivation myopia (FDM).METHODS: FDM was created in three groups of eight chicks by placing a translucent diffuser on their right eyes. Intravitreal injections of saline and VIP were applied once a day into the occluded eyes of groups 2 and 3, respectively. Retinoscopy and axial length (AL) measurements were performed on the first and 8th days of diffuser wear. The retina mRNA levels of the VIP receptors and the ZENK protein in right eyes of the three groups and left eyes of the first group on day 8 were determined using real time polymerase chain reaction (PCR). RESULTS: The median final refraction (D) in right eyes were -13.75 (-16.00, -12.00), -11.50 (-12.50, -7.50), and -1.50 (-4.75, -0.75) in groups 1, 2, and 3, respectively (P<0.001). The median AL (mm) in right eyes were 10.65 (10.00, 11.10), 9.90 (9.70, 10.00), and 9.20 (9.15, 9.25) in groups 1, 2, and 3, respectively (P<0.001). The median delta-delta cycle threshold (CT) values for the VIP2 receptors were 1.07 (0.82, 1.43), 1.22 (0.98, 1.65), 0.29 (0.22, 0.45) in right eyes of groups 1, 2, and 3, and 1.18 (0.90, 1.37) in left eyes of group 1, respectively (P=0.001). The median delta-delta CT values for the ZENK protein were 1.07 (0.63, 5.03), 3.55 (2.20, 5.55), undetectable in right eyes of groups 1, 2, and 3 and 1.89 (0.21, 4.73) in left eyes of group 1, respectively (P=0.001). CONCLUSION: VIP has potential inhibitory effects in the development of FDM.

A novel splice site mutation of CRYBA3/A1 gene associated with congenital cataract in a Chinese family

Meng-Han Wu, Yin-Hui Yu, Qin-Long Hao, Xiao-Hua Gong and Ke Yao — 2017/1/4 0:00:00
AIM: To identify the disease-causing mutation responsible for the presence of congenital cataract in a Chinese family. METHODS: The study recruited a four-generation Chinese pedigree affected by autosomal dominant congenital cataract (ADCC). Family history and the history of cataract extraction were recorded. Blood samples were collected from individuals for DNA extraction. Direct sequencing of congenital cataract-associated genes was performed. Single-strand conformational polymorphism and bioinformatic analysis were conducted to further study the mutation. RESULTS: Direct sequencing revealed a novel splice site mutation of c.30-2 A>G in the CRYBA3/A1 gene. The mutation co-segregated within all affected individuals in the family and was not found in unaffected members or 100 unrelated normal controls. These results were further confirmed by single-strand conformational polymorphism and bioinformatic analysis using the Human Splicing Finder and MaxEnt online software and Annovar computer software. CONCLUSION: c.30-2 A>G mutation of CRYBA3/A1 gene is a novel mutation and broadens the genetic spectrum of ADCC.

Comparison of lens oxidative damage induced by vitrectomy and/or hyperoxia in rabbits

Hong Yan, Dan Wang, Tian-Bing Ding, Hai-Yan Zhou, Wei-Jia Yan and Xin-Chuan Wang — 2017/1/4 0:00:00
AIM: To compare of lens oxidative damage induced by vitrectomy and/or hyperoxia in rabbit. METHODS: Sixteen New Zealand rabbits (2.4-2.5 kg) were randomly divided into two groups (Group A, n=12; Group B, n=4). In Group A, the right eyes were treated with vitrectomy and systemic hyperoxia (oxygen concentration: 80%-85%, 1 ATA, 4h/d) (Group A-right), and the left eyes were treated with hyperoxia without vitrectomy surgery (Group A-left). Four rabbits in group B (eight eyes) were untreated as the controls. Lens transparency was monitored with a slit lamp and recorded before and after vitrectomy. After hyperoxic treatment for 6mo, the eyeballs were removed and the lens cortices (containing the capsules) and nuclei were separated for further morphological and biochemical evaluation. RESULTS: Six months after treatments, there were no significant morphological changes in the lenses in any experimental group when observed with a slit lamp. However, the levels of water-soluble proteins and ascorbate, and the activities of catalase and Na+-K+-ATPase were significantly reduced, whereas the levels of malondialdehyde and transforming growth factor β2 (TGF-β2) were significantly elevated, in both the cortices and nuclei of eyes treated with vitrectomy and hyperoxia. The increase in protein-glutathione mixed disulfides and the reduction in water-soluble proteins were more obvious in the lens nuclei. The levels of ascorbate in the vitreous fluid were also reduced after vitrectomy, whereas TGF-β2 increased after vitrectomy and hyperoxia. Systemic hyperoxia exposure increased these effects. CONCLUSION: Removal of the intact vitreous gel with vitrectomy and exposing the lens to increased oxygen from the retina induce lens oxidation and aggregation. Thus, an intact vitreous gel structure may protect the lens from oxidative insult and maintain lens transparency.

Inhibition of proliferation of retinal vascular endothelial cells more effectively than choroidal vascular endothelial cell proliferation by bevacizumab

Bharani Krishna Mynampati, Kumar Sambhav, Sandeep Grover and Kakarla V. Chalam — 2017/1/4 0:00:00
AIM: To evaluate the differential inhibitory effects of bevacizumab on cell proliferation of vascular endothelial growth factor (VEGF)-stimulated choroidal vascular endothelial cells (CVECs) and retinal vascular endothelial cells (RVECs) in vitro. METHODS: VEGF (400 ng/mL) enriched CVECs and RVECs were treated with escalating doses of bevacizumab (0.1, 0.5, 1, 1.5 and 2 mg/mL). Cell proliferation changes were analyzed with WST-1 assay and trypan blue exclusion assay at 48, 72h and 1wk. Morphological changes were recorded with bright field microscopy. RESULTS: VEGF enriched RVECs showed significantly more decline of cell viability than CVECs after bevacizumab treatment. One week after treatment, RVEC cell proliferation decreased by 29.7%, 37.5%, 52.8%, 35.9% and 45.6% at 0.1, 0.5, 1.0, 1.5 and 2 mg/mL bevacizumab respectively compared to CVEC proliferation decrease of 4.1%, 7.7%, 2.4%, 4.1% and 17.7% (P<0.05) by WST-1 assay. Trypan blue exclusion assay also revealed similar decrease in RVEC proliferation of 20%, 60%, 73.3%, 80% and 93.3% compared to CVEC proliferation decrease of 4%, 12%, 22.9%, 16.7% and 22.2% respectively (P<0.05). The maximum differential effect between the two cell types was observed at bevacizumab doses of 1.0 and 1.5 mg/mL at all time points. RVECs were 22 fold more sensitive (P<0.01) compared to CVECs (52.8% vs 2.4%) at concentration of 1.0 mg/mL, and 8.7 fold more at 1.5 mg/mL (35.9% vs 4.1%) 1wk after treatment (P<0.05 respectively). CONCLUSION: VEGF-enriched RVECs are more susceptible to bevacizumab inhibition than CVECs at clinically used dosage of 1.25 mg and this differential sensitivity between two cell types should be taken into consideration in dosage selection.

Differentiation potential of human adipose tissue derived stem cells into photoreceptors through explants culture and enzyme methods

2017/1/4 0:00:00
AIM: To investigate the retinal photoreceptor differentiation potential of human orbital adipose tissue-derived stem cells (ADSCs) generated by enzyme (EN) and explant (EX) culture methods. METHODS: We investigated potentials of human orbital ADSCs to differentiate into photoreceptors through EN and EX culture methods. EN and EX orbital ADSCs were obtained from the same donor during rehabilitative orbital decompression, and then were subject to a 3-step induction using Noggin, DKK-1, IGF-1 and b-FGF at different time points for 38d. Stem cell, eye-field and photoreceptor-related gene and protein markers were measured by reverse transcription-polymerase chain reaction (RT-PCR) and immunofluorescent (IMF) staining. RESULTS: Both EX and EN orbital ADSCs expressed CD133, a marker of cell differentiation. Moreover, PAX6 and rhodopsin, markers of the retinal progenitor cells, were detected from EX and EN orbital ADSCs. In EX orbital ADSCs, PAX6 mRNA was detected on the 17th day and then the rhodopsin mRNA was detected on the 24th day. In contrast, the EN orbital ADSCs expressed PAX6 and rhodopsin mRNA on the 31st day. EX orbital ADSCs expressed rhodopsin protein on the 24th day, while EN orbital ADSCs expressed rhodopsin protein on the 31st day. CONCLUSION: Orbital ADSCs isolated by direct explants culture show earlier and stronger expressions of markers towards eye field and retinal photoreceptor differentiation than those generated by conventional EN method.

Effect on proliferation and apoptosis of retinoblastoma cell by RNA inhibiting high mobility group protein box-1 expression

Li-Lun Wang, Yan-Qin Feng and Yu-Hong Cheng — 2017/1/4 0:00:00
AIM: To investigate the effect of high mobility group protein box-1 (HMGB1) siRNA on proliferation and apoptosis of retinoblastoma (Rb) cells. METHODS: The expression of HMGB1 in Rb cells were detected by real-time polymerase chain reaction (RT-PCR) and Western blot. Chemically synthesized HMGB1 siRNA was transfected into Y79 cells. The inhibitory rate was also examined by RT-PCR and Western blot. After HMGB1 siRNA transfection, the cell proliferation was analyzed by MTT, and cell apoptosis was detected by Caspase-3 active detection kit. Cell cycle distribution and apoptosis were detected by flow cytometry. RESULTS: The expression of HMGB1 significantly elevated in Rb cells (P<0.01). After transfected by siRNA, the HMGB1 protein level of Y79 cells was significantly reduced (P<0.01). After siRNA interference HMGB1, the proportion of proliferating cells reduced, and the proportion of quiescent cells increased (P<0.05). In addition, apoptosis rate of Y79 cells increased from 2.03% to 9.10% after interfering with HMGB1 siRNA (P<0.05). CONCLUSION: Specific HMGB1 siRNA can inhibit the expression of HMGB1. The effect may be attributed to inhibit the proliferation and promote cell apoptosis.

Neuroprotective effects of BDNF and GDNF in intravitreally transplanted mesenchymal stem cells after optic nerve crush in mice

Zong-Li Hu, Ni Li, Xin Wei, Li Tang, Ting-Hua Wang and Xiao-Ming Chen — 2017/1/4 0:00:00
AIM: To assess the neuro-protective effect of bone marrow mesenchymal stem cells (BMSCs) on retinal ganglion cells (RGCs) following optic nerve crush in mice. METHODS: C56BL/6J mice were treated with intravitreal injection of PBS, BMSCs, BDNF-interference BMSCs (BIM), and GDNF-interference BMSCs (GIM) following optic nerve crush, respectively. The number of surviving RGCs was determined by whole-mount retinas and frozen sections, while certain mRNA or protein was detected by q-PCR or ELISA, respectively. RESULTS: The density (cell number/mm2) of RGCs was 410.77±56.70 in the retina 21d after optic nerve crush without any treatment, compared to 1351.39±195.97 in the normal control (P<0.05). RGCs in BMSCs treated eyes was 625.07±89.64/mm2, significantly higher than that of no or PBS treatment (P<0.05). While RGCs was even less in the retina with intravitreal injection of BIM (354.07+39.77) and GIM (326.67+33.37) than that without treatment (P<0.05). BMSCs injection improved the internal BDNF expression in retinas. CONCLUSION: Optic nerve crush caused rust loss of RGCs and intravitreally transplanted BMSCs at some extent protected RGCs from death. The effect of BMSCs and level of BDNF in retinas are both related to BDNF and GDNF expression in BMSCs.

Accommodation in human eye models: a comparison between the optical designs of Navarro, Arizona and Liou-Brennan

2017/1/4 0:00:00
AIM: To simulate and compare accommodation in accommodative and non-accommodative human eye models. METHODS: Ray tracing and optical design program was used. Three eye models were designed and studied: the Navarro, the Arizona and the Liou-Brennan. In order to make the Navarro and Liou-Brennan models to accommodate, specific geometric parameters of the models were altered with values that were chosen from the literature. For the Arizona model, its’ mathematical functions for accommodation were used for the same accommodative demands. The simulation included four distances of accommodation for each model: at infinity, 3, 1 and 0.5 m.The results were diffraction images of a “letter F” for graphical comparison, spot diagrams on the retinal field and Modulation Transfer Function (MTF) graphs. RESULTS:Zernike coefficients for the aberrations, Airy disk diameter, root mean square (RMS) error diameter and total axial length of the model were provided from the program. These were compared between them in all distances. The Navarro model had the smallest axial length change as a simple model. The Arizona did not change its axial length because it is designed to be accommodative. The Liou-Brennan model had different results concerning the aberrations because of the decentration of the pupil. The MTF graphs showed small differences between the models because of the differences in their designs. CONCLUSION: All the three models are able to simulate accommodation with the expected results. There is no model that can be assumed as the best choice. Accommodation can be simulated in non-accommodativemodels and in customized ones.

Suppression of corneal neovascularization by curcumin via inhibition of Wnt/β-catenin pathway activation

Yong-Kang Zhang, Jing-Ming Li and Li Qin — 2017/12/7 0:00:00
AIM: To investigate whether curcumin suppressed corneal neovascularization (CNV) formation via inhibiting activation of Wnt/β-catenin pathway. METHODS: Suture-induced CNV was established on Sprague-Dawley (SD) rats. Curcumin were daily administrated by subconjunctival injection. Phosphorylation of low-density lipoprotein receptor-related protein 6 (LRP6) and nuclear accumulation of β-catenin, two indicators of activated Wnt/β-catenin pathway, were determined by Western-blot analysis in subconfluent/proliferating human microvascular endothelial cells (HMEC) and neovascularized corneas. Wnt3a conditioned medium (WCM) were harvested from Wnt3a expressing cells. WCM-induced cell proliferation and endothelial tubular formation capacity was measured by MTT assay and Matrigel assay, respectively. RESULTS: Phosphorylation of LRP6 and nuclear accumulation of β-catenin was significantly increased in subconfluent/proliferating endothelial cells. Activation of Wnt/β-catenin pathway by WCM markedly promotes HMEC proliferation and tubular formation. Curcumin inhibited LRP6 phosphorylation and nuclear accumulation of β-catenin. In addition, curcumin attenuated WCM-induced HMEC proliferation and disrupted tubular structure of endothelial cells on Matrigel. Meanwhile curcumin suppressed suture-induced CNV and inhibited LRP6 phosphorylation as well as β-catenin accumulation in SD rats. CONCLUSION: Taken together, activation of Wnt/β-catenin pathway could be involved in endothelial proliferation during suture-induced CNV formation and curcumin attenuated CNV formation via inhibition of Wnt/β-catenin pathway activation.

Age-related changes of corneal endothelial cell in healthy Chinese tree shrew measured by non-contact specular microscope

Min Wu, De-Xuan Kuang, Ya-Qi Huang, Yu-Run Miao, Xiao-Cheng Liu and Jie-Jie Dai — 2017/12/7 0:00:00
AIM: To determine the impact of age on the morphology of endothelial cells and central corneal thickness (CCT) in Chinese tree shrew. METHODS: One-hundred and twenty eyes of 60 healthy Chinese tree shrews were studied. Based on age, the tree shrews were divided into four groups. After general anesthesia, the images of endothelium were acquired using non-contact specular microscope Topcon 3000P. Eight parameters of corneal endothelial cells were measured by built-in software, including CCT, endothelial cell density (ECD), percent hexagonality (HG%), coefficient of variability (CV), size of minimal cell (Smin), size of maximal cell (Smax), average cells size (Savg) and size standard deviation (Ssd). Data were analyzed using STATA software. The differences of eight parameters among groups and correlations with age were analyzed. RESULTS: In all studied animals, the average CCT was 249.6±20.29 μm (202-301 μm), ECD was 3080.72± 460.76 cells/mm2 (1239.6-4047.6 cells/mm2) and CV was 29.10±7.60 (13.6-54.6). CV was significantly different among different groups (P<0.001). Strong correlation with age was found in ECD, Smax, Savg, Ssd and CV. CONCLUSION: Cornea of Chinese tree shrews had half CCT of human cornea and similar ECD, CV and size of corneal endothelial cells. Young adult tree shrews had higher ECD, HG% and low CV. ECD, Smax, Savg, Ssd and CV correlated with age significantly.

Involvement of Rho-associated coiled-coil kinase signaling inhibition in TGF-β1/Smad2, 3 signal transduction in vitro

Zhao-Hui Feng, Xiao-Hui Zhang, Jia-Qi Zhao and Jun-Ze Ma — 2017/12/7 0:00:00
AIM: To research the effect of Y-27632, a selective Rho-associated coiled-coil kinase (ROCK) inhibitor, on TGF-β1/Smad2, 3 signal transduction in ocular Tenon’s capsule fibroblasts (OTFs). METHODS: Primary ocular Tenon’s capsule fibroblasts had been cultured in vitro. The effect of Y27632 on proliferation of OTF stimulated by lysophosphatidic acid (LPA) was evaluated by MTT colorimetric assay so as to sift out the proper concentrations range of Y-27632 for the next experiment. Real time-polymerase chain reactor (RT-PCR) was to analyze the changes of Smad2 and Smad3 genes of cells affected by Y-27632, though unaffected by transforming growth factor-beta1 (TGF-β1). Proteins of Smad2, Smad3, phosphorylated Smad2 (Ser245/250/255), and phosphorylated Smad3 (Ser423/425/203) were respectively quantified by Western blot after OTFs were successively incubated by TGF-β1 and Y-27632. Meanwhile, α-smooth muscular actin (α-SMA) protein was also quantified after the small intervening gene fragments of human Smad2 and Smad3 were designed, synthesized, and then transfected to OTFs. RESULTS: Y-27632 significantly inhibited OTFs proliferation stimulated by LPA. Also Y-27632 significantly suppressed the expressions of Smad2 mRNA, Smad2, 3 proteins expressions, Smad3 phosphorylation at the carboxylic terminals of Ser423/425/203 which had been radically promoted by TGF-β1. SiRNA-Smad2, 3 suppressed α-SMA expressions, but less effectively than Y-27632. CONCLUSION: The inhibition of ROCK signaling may be a potential therapeutic candidate for the treatment of the filtration channel fibrosis.

Pioglitazone ameliorates retinal ischemia/reperfusion injury via suppressing NLRP3 inflammasome activities

Yue-Lu Zhang, Ruo-Bing Wang, Wei-Yi Li, Fang-Zhou Xia and Lin Liu — 2017/12/7 0:00:00
AIM: To explore the role of Pioglitazone (Pio) on a mouse model of retinal ischemia/reperfusion (I/R) injury and to elucidate the potential mechanism. METHODS: Retinal ischemia was induced in mice by increasing the intraocular pressure, and Pio was administered 4h though periocular injection before I/R. The number of cells in the ganglion cell layer (GCL) was counted 7d after retinal I/R injury. Glial fibrillary acidic protein (GFAP), nuclear factor-kappa B (NF-κB), p38, phosphorylated-p38, PPAR-γ, interleukin-1β (IL-1β), Toll-like receptor 4 (TLR4), NLRP3, cleaved caspase-1, caspase-1 were determined by real-time polymerase chain reaction and Western blotting. RESULTS: Pio promoted the survival of retinal cells in GCL following retinal I/R injury (P<0.05). Besides, retinal I/R injury stimulated the expression of GFAP and TLR4, which were partially reversed by Pio treatment (P<0.05). Retinal I/R injury-upregulated expression of NLRP3, cleaved caspase-1, IL-1β was attenuated after Pio treatment (P<0.05). Moreover, I/R injury induced activation of NF-κB and p38 were inhibited by Pio treatment (P<0.05). CONCLUSION: Pio promotes retinal ganglion cells survival by suppressing I/R-induced activation of TLR4/NLRP3 inflammasomes via inhibiting NF-κB and p38 phosphorylation.

Clinical and experimental study on angiopoietin-like protein 8 associated with proliferative diabetic retinopathy

2017/12/7 0:00:00
AIM: To confirm the role of angiopoietin-like protein 8 (Angptl 8) in proliferative diabetic retinopathy (PDR). METHODS: The sera and aqueous humor of 10 PDR patients and 10 non-diabetic retinopathy (NDR) patients (idiopathic macular hole patients) were collected and the expression of Angptl 8 was detected by enzyme linked immune-sorbent assay (ELISA). Experimental diabetes mice model was induced with streptozotocin. The expression of glycosylated hemoglobin and Angptl 8 in sera was detected. Recombinant Angptl 8 was re-infused into wild type (WT) diabetic mice and spatial frequency threshold and contrast sensitivity were measured. In vitro retinal pigment epithelium (RPE) were stimulated by recombinant Angptl 8 for 24h. MMT assay were used to detect cell proliferation. At the same time, qRT-PCR and Western blot was used to measure the expression of proliferation-related factors in PRE cells. RESULTS: The expression of Angptl 8 was markedly increased in the sera and aqueous humor of PDR patients (F=99.02, P<0.0001 in sera; t=10.42, P<0.0001 in aqueous). After successfully establishing the diabetic mice model, we found that glycosylated hemoglobin and Angptl 8 expression levels were increased. Re-infusion of recombinant Angptl 8 into WT diabetic mice could further decrease spatial frequency threshold and contrast sensitivity (P<0.01). In vitro, RPE cells stimulated by recombinant Angptl 8 could increase the relative absorbance of MMT assay (1.486±0.042 vs 1.000±0.104, P<0.05) and proliferating cell nuclear antigen (PCNA) expression (0.55±0.01 vs 0.29±0.03, P<0.05). The proliferative effect of Angptl 8 is mainly mediated by increasing the expression of proliferation-activating factors cyclin A1 (4.973±0.205 vs 2.720±0.197, P<0.05), cyclin F (5.690±0.219 vs 4.297±0.292, P<0.05) and E2F2 (2.297±0.102 vs 1.750±0.146, P<0.05), and reducing the expression of proliferation-inhibiting factors cdkn1 (2.370±0.074 vs 3.317±0.135, P<0.05) and cdkn2 (4.793±0.065 vs 5.387±0.149, P<0.05). CONCLUSION: The expression of Angptl 8 is increased in PDR, and the increased Angptl 8 can promote proliferation and increase proliferation-related factors.

Infliximab relieves blood retinal barrier breakdown through the p38 MAPK pathway in a diabetic rat model

Mao-Song Xie, Yong-Zheng Zheng, Li-Bin Huang and Guo-Xing Xu — 2017/12/7 0:00:00
AIM: To clarify the mechanism of infliximab treatment in diabetic macular edema (DME) and to provide a new alternative therapy for DME. METHODS: Rats were randomly divided into the control group, the model group and the infliximab treatment group. A diabetic rat model was created. The concentration of TNF-α in the vitreous body was detected by ELISA. The expressions of B-Raf, p38, claudin-1 and occludin in the retina were detected by Western blot. The integrity of the blood retinal barrier (BRB) was measured using Evan’s blue as a tracer. RESULTS: After three months and six months of the diabetes model, the vitreous TNF-α level in the model group was higher than that of the control group. It was also higher in treated group than that of the control group but was lower than that of the model group. The differences among the three groups were statistically significant (at 3mo, F=857.098, P<0.001; 6mo, F=1261.897, P<0.001). The retina B-Raf and p38 levels in the model group were higher than that of the control group. They were also higher in treated group than that of the control group but were lower than that of the model group. The differences among the three groups were statistically significant (B-Raf at 3mo, F=106.596, P<0.001 and at 6mo, F=200.681, P<0.001; p38 at 3mo, F=41.662, P<0.001 and at 6mo, F=67.979, P<0.001). The retina claudin-1 and occludin levels in the model group were lower than that of the control group. They were also lower in treated group than that of the control group but were higher than that of the model group. The differences among three groups were statistically significant (claudin-1 at 3mo, F=139.088, P<0.001 and at 6mo, F=128.415, P<0.001; occludin at 3mo, F=92.733, P<0.001 and at 6mo, F=104.478, P<0.001). The retinal Evans blue leakage in the model group was higher than that of the control group. It was also higher in treated group than that of the control group but was lower than that of the model group. The differences among the three groups were statistically significant (at 3mo, F=447.946, P<0.001; at 6mo, F=1610.732, P<0.001). CONCLUSION: In a diabetic rat model, infliximab may relieve TNF-α induced BRB breakdown via the B-Raf and p38 signaling pathway.

DNA vaccine expressing herpes simplex virus 1 glycoprotein C and D protects mice against herpes simplex keratitis

Li-Li Dong, Ru Tang, Yu-Jia Zhai, Tejsu Malla and Kai Hu — 2017/11/7 0:00:00
AIM: To investigate whether DNA vaccine encoding herpes simplex virus 1 (HSV-1) glycoprotein C (gC) and glycoprotein D (gD) will achieve better protective effect against herpes simplex keratitis (HSK) than DNA vaccine encoding gD alone. METHODS: DNA vaccine expressing gD or gC combined gD (gD.gC) were constructed and carried by chitosan nanoparticle. The expression of fusion protein gD and gC were detected in DNA/nanoparticle transfected 293T cells by Western-blot. For immunization, mice were inoculated with DNA/nanoparticle for 3 times with 2wk interval, and two weeks after the final immunization, the specific immune responses and clinical degrees of primary HSK were evaluated. RESULTS: Fusion protein gD.gC could be expressed successfully in cultured 293T cells. And, pRSC-gC.gD-IL21 DNA/chitosan nanoparticle could effectively elicit strongest humoral and cellular immune response in primary HSK mice evidenced by higher levels of specific neutralizing antibody and sIgA production, enhanced cytotoxicities of splenocytes and nature killer cells (NK), when compared with those of gD alone or mocked vaccine immunized mice. As a result, gC-based vaccine immunized mice showed least HSK disease. CONCLUSION: gC-based DNA vaccine could effectively prevent the progress of primary HSK, suggesting that this DNA vaccine could be a promising vaccine for HSK treatment in the future.

Histopathologic findings of keratoconus corneas underwent penetrating keratoplasty according to topographic measurements and keratoconus severity

Mohammad Naderan, Ali Jahanrad and Siavash Balali — 2017/11/7 0:00:00
AIM: To investigate the histopathologic and morphological changes of the corneas with keratoconus (KC) undergoing penetrating keratoplasty (PKP) according to topographic findings and severity of KC. METHODS: The corneal tissue of 35 samples with KC was retrospectively evaluated with conventional light microscopy. Topographic and pachymetric parameters of keratoconus corneas by means of Pentacam such as mean keratometry (K) and central corneal thickness (CCT) were recorded. Severity of KC was graded according to Amsler-Krumeich classification. RESULTS: Epithelial thinning and breaks in Bowman’s layer are the most common findings in keratoconus corneas (94.3% and 82.9% corneas, respectively). The results revealed statistically significant higher mean K value and lower CCT in the keratoconus corneas that were affected by epithelial thinning, breaks in the Bowman's layer, folds in the Descemet's membrane, epithelial scars, breaks in Descemet's membrane, and stromal scars than those corneas without these findings (P<0.05). Moreover, those corneas with epithelial thinning, breaks in the Bowman's layer, folds in Descemet's membrane, epithelial scars, and stromal scars had significantly more severe disease than those corneas without these findings (P<0.05). The presence of the stromal and epithelial scars were associated with the higher KC severity, in which, respectively, 87.5% and 80.0% of the corneas with stromal and epithelial scars had stage 4 of the KC severity. CONCLUSION: It seems that there are some specific patterns in histologic changes of the keratoconus corneas. The presence of pathologic findings was correlated with thinner and steeper corneas. Epithelial or stromal scars were associated with the highest disease severity. The description of histopathologic findings of KC may help in elucidating the pathogenesis of the disease and help pathologist in differentiating KC from other corneal diseases.

Effect of itraconazole on the cornea in a murine suture model and penetrating keratoplasty model

Yang Kyung Cho, Eun Young Shin, Hironori Uehara and Balamurali Ambati — 2017/11/7 0:00:00
AIM: To investigate the anti-(lymph)angiogenic and/or anti-inflammatory effect of itraconazole in a corneal suture model and penetrating keratoplasty (PK) model. METHODS: Graft survival, corneal neovascularization, and corneal lymphangiogenesis were compared among itraconazole, amphotericin B, dexamethasone, phosphate buffered saline (PBS) and surgery-only groups following subconjunctival injection in mice that underwent PK and corneal suture. Immunohistochemical staining and analysis were performed in each group. Real-time polymerase chain reaction (RT-PCR) was performed to quantify the expression of inflammatory cytokines (TNF-alpha, IL-6) and vascular endothelial growth factor (VEGF)-A, VEGF-C, VEGFR-2, and VEGFR-3. RESULTS: In the suture model, the itraconazole group showed less angiogenesis, less lymphangiogenesis, and less inflammatory infiltration than the PBS group (all P<0.05). The itraconazole group showed reduced expression of VEGF-A, VEGFR-2, TNF-alpha, IL-6 than the PBS group (all P<0.05). In PK model, the two-month graft survival rate was 28.57% in itraconazole group, 62.50% in dexamethasone group, 12.50% in PBS group, 0 in amphotericin B group and 0 in surgery-only group. Graft survival in the itraconazole group was higher than that in the amphotericin, PBS and surgery-only group (P=0.057, 0.096, 0.012, respectively). The itraconazole group showed less total angiogenesis and lymphangiogenesis than PBS group (all P<0.05). CONCLUSION: Itraconazole decrease neovascularization, lymphangiogenesis, and inflammation in both a corneal suture model and PK model. Itraconazole has anti-(lymph)-angiogenic and anti-inflammatory effects in addition to its intrinsic antifungal effect and is therefore an alternative treatment option in cases where steroids cannot be used.

Expression of multidrug resistance proteins in retinoblastoma

2017/11/7 0:00:00
AIM: To elucidate the mechanism of multidrug resistance in retinoblastoma, and to acquire more insights into in vivo drug resistance. METHODS: Three anticancer drug resistant Y79 human RB cells were generated against vincristine, etoposide or carboplatin, which are used for conventional chemotherapy in RB. Primary cultures from enucleated eyes after chemotherapy (PCNC) were also prepared. Their chemosensitivity to chemotherapeutic agents (vincristine, etoposide and carboplatin) were measured using MTT assay. Western blot analysis was performed to evaluate the expression of p53, Bcl-2 and various multidrug resistant proteins in retinoblastoma cells. RESULTS: Following exposure to chemotherapeutic drugs, PCNC showed less sensitivity to drugs. No significant changes observed in the p53 expression, whereas Bcl-2 expression was found to be increased in the drug resistant cells as well as in PCNC. Increased expression of P-glycoprotein (P-gp) was observed in drug resistant Y79 cells; however there was no significant change in the expression of P-gp found between primary cultures of primarily enucleated eyes and PCNC. Multidrug resistance protein 1 (Mrp-1) expression was found to be elevated in the drug resistant Y79 cells as well as in PCNC. No significant change in the expression of lung resistance associated protein (Lrp) was observed in the drug resistant Y79 cells as well as in PCNC. CONCLUSION: Our results suggest that multidrug resistant proteins are intrinsically present in retinoblastoma which causes treatment failure in managing retinoblastoma with chemotherapy.

Protective effect of pomegranate juice on retinal oxidative stress in streptozotocin-induced diabetic rats

2017/11/7 0:00:00
AIM: To investigate the effect of pomegranate juice (PJ) intake on overall oxidation status in retinas of diabetic rats. METHODS: Twenty-seven rats were divided into four groups as control (CO), diabetic (DM), control treated with PJ (CO-PJ), and diabetic treated with PJ (DM-PJ).The retina tissues were used to determine 8-hydroxy-2’-deoxyguanosine (8OHdG), malondialdehyde (MDA), reduced glutathione (GSH) levels, and the enzyme activities of superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px). RESULTS: The levels of 8OHdG and MDA were significantly increased in the retina of DM group compared to CO group (P=0.001, P<0.001 respectively). Both 8OHdG and MDA levels were decreased in PJ-DM group compared to DM group (P=0.004, P<0.001 respectively). The activities of antioxidant enzymes GSH, SOD, and GDH-Px were significantly decreased in the retina of DM group compared to CO group (P≤0.01). GSH and GSH-Px activities were higher in PJ-DM group compared with DM group (P=0.010, P=0.042, respectively) but SOD activity was not statistically different (P=0.938). CONCLUSION: PJ intake is found to be effective in decreasing oxidative end products, and in increasing the activities of antioxidant enzymes in diabetic retinas of rats, which suggests it may be effective against oxidative stress in diabetic retinas.

Gastrodin protects retinal ganglion cells through inhibiting microglial-mediated neuroinflammation in an acute ocular hypertension model

Jia-Wei Wang, Yao-Ming Liu, Xiao-Fei Zhao and Han Zhang — 2017/9/30 0:00:00
AIM: To investigate the neuroprotective effect of gastrodin on retinal ganglion cells (RGCs) in an acute ocular hypertension (AOH) rat model and to identify its possible mechanism. METHODS: AOH rat model was performed in a randomly selected eye by anterior chamber perfusion and either received an intraperitoneal injection with various concentrations of gastrodin or normal saline. After 2wk, the rats were sacrificed. FluoroGold was used to label survival RGCs. Immunostaining with anti-Iba1 in the retinal flat mounts to calculate the microglia density in the ganglion cell layer (GCL). Changes in microglial cytokines, tumour necrosis factor-alpha (TNF-α) and inducible NO synthase (iNOS) were examined with Western blot and reverse transcription-quantitative polymerase chain reaction. Expression levels of total and phosphorylated p38 mitogen activated protein kinase (MAPK) were determined by Western blot. RESULTS: Results showed that AOH induced significant loss of RGCs and severe microglia activation in the GCL. Besides, AOH increased the phosphorylation of p38 MAPK and promoted the release of microglial cytokines in the retinas. Intraperitoneal injection with dose-dependent gastrodin significantly reduced the loss of RGCs and inhibited retinal microglia activation, accompanied with the decreased expression levels of microglial cytokines and p38 MAPK phosphorylation. CONCLUSION: Gastrodin exerts a neuroprotective effect on RGCs in an acute glaucoma animal model via inhibiting microglia activation and microglial-mediated neuroinflammation. The finding demonstrates the potential application of gastrodin in the neuroprotective therapy of acute glaucoma and other retinal neurodegenerative diseases characterized by microglia activation and RGCs death.

Genes of tumor necrosis factors and their receptors and the primary open angle glaucoma in the population of Central Russia

2017/9/30 0:00:00
AIM: To examine the association of genetic polymorphisms (-308)G/A TNFα, (+250)A/G Ltα, (+36)A/G TNFR1, (+1663)A/G TNFR2 with the development of primary open angle glaucoma (POAG) among people in Central Russia. METHODS: The study sample included 443 individuals, of which 252 patients with POAG and 191 individuals in the control group. Genotyping of (-308)G/A TNFα, (+250)A/G Ltα, (+36)A/G TNFR1, (+1663)A/G TNFR2 was performed using polymerase chain reaction. The distribution of alleles and genotypes of the studied DNA markers in the groups was examined by 2×2 contingency tables and χ2 with the Yates’s correction for continuity and odds ratios (OR) with 95% confidence intervals (CI). RESULTS: Allele (-308)G TNFα (Р=0.01, OR=1.78, 95%CI 1.12-2.85) was identified as a risk factor for POAG. Homozygotes (-308) AA TNFα are at a lowest risk for development of the disease (Р=0.01, OR=0.0005). The following combination of genetic variants of cytokines were associated with a reduced risk of POAG: (+1663)A TNFR2 and (+250)G Ltα (OR=0.34) CONCLUSION: Genetic polymorphisms (-308)G/A TNFα, (+250)A/G Ltα, (+1663)A/G TNFR2 associated with the development of POAG in the population of Central Russia.

The reason for the amelioration of N-methyl-N-nitrosourea- induced retinitis pigmentosa in rats by hydrogen-rich saline

2017/9/30 0:00:00
AIM: To investigate the effects of hydrogen-rich saline (HRS) on microglia activation and Sirtuin type 1 (Sirt1) in rats with N-methyl-N-nitrosourea (MNU)-induced retinitis pigmentosa (RP). METHODS: Rats were divided into norm (N) group, model (M) group and HRS (H) group. Rats in M and H groups were given saline and HRS respectively prior to and after administration of MNU. At one day (d1) and d3 afterwards, electroretinogram and histological examination were performed to confirm the effects of HRS on retinal function and structure of MNU-induced RP. Immunofluorescence staining of anti-ionized calcium-binding adapter molecule 1 (Iba1), a maker of microglia cells, was performed, with quantitative real-time polymerase chain reaction (qRT-PCR) for its mRNA quantification. Moreover, Sirt1 mRNA and protein expression in the retinas were detected by Western blot and qRT-PCR. RESULTS: HRS preserved the retinal function and mitigated the reduction of photoreceptor degeneration in MNU-treated retinas. The presence of microglia cells was somewhat more obvious in H group than that in M group at d1. HRS suppressed the further activation of microglia cells, with the number of microglia cells less than that of M group at d3. Results of qRT-PCR of Iba1 were consistent with those of immunofluorescence staining, with the mRNA expression of Iba1 in H group more intensive than that of M group at d1 (P<0.05), while less than that of M group at d3 (P<0.05). Furthermore, the Sirt1 mRNA and protein expression decreased after MNU administration, while HRS mitigated the MNU-induced downregulation of Sirt1. CONCLUSION: HRS can effectively keep microglia activation induced by MNU to an appropriate extent, while upregulate Sirt1 in MNU-induced RP.

Differentiation of human olfactory mucosa mesenchymal stem cells into photoreceptor cells in vitro

Wen Lu, Da Duan, Zacharia Ackbarkhan, Ming Lu and Min-Li Huang — 2017/9/30 0:00:00
AIM: To investigate whether the human olfactory mucosa mesenchymal stem cells (OM-MSCs) can differentiate into photoreceptor cells in vitro. METHODS: Through the olfactory mucosa adherent method, olfactory mucosa was isolated, cultured and identified in vitro among mesenchymal stem cells. The cell surface markers were analyzed by flow cytometry, induced to differentiate into retinal photoreceptor cells in vitro, and the expression of rhodopsin was observed and identified by Immunofluorescence and Western blot methods. RESULTS: OM-MSCs from human were spindle cell-based, and showing radial colony arrangement. OM-MSCs were negative for CD34, CD45 and CD105, but positive for CD73 and CD90. Following induction, a strong positive reaction was produced by photoreceptor specific marker rhodopsin in the cells.

Expressions of nestin and glial fibrillary acidic protein in rat retina after optic nerve transection

Li Wang and Peng Li — 2017/9/30 0:00:00
AIM: To assess the expression of nestin and glial fibrillary acidic protein (GFAP) in rat retina after optic nerve transection. METHODS: Rats were randomly divided into normal control group, sham group and operation group, and used for establishing an animal model of optic nerve transection. Retinal specimen of each group was collected at 3, 48h, 7 and 14d postoperative. Nestin and GFAP expressions on sagittal sections were analyzed by immunohistochemical staining, and protein extraction was analyzed by Western blot. RESULTS: Immunohistochemical analysis showed that nestin positive staining was rarely detected in normal control group and sham group, while sham group showed weak positive staining at 3h postoperative, the reaction gradually increased at 48h postoperative, and reached its maximum at 7d postoperative, and then decreased at 14d postoperative. Compared to the expression of GFAP, there was not statistically significant obvious difference among three groups (P>0.05). Result of Western blot method was consistent with that of immunohistochemical method. CONCLUSION: The expression of nestin increased in a time dependent fashion in Müller cells of retina following optic nerve transection, which was statistically significant, but there was no obvious difference in GFAP expression. The results indicate that an increase in colloid synthesis in retina following optic nerve transection can improve the retinal neurons’ environment.

The association of lumican polymorphisms and high myopia in a Southern Chinese population

2017/9/30 0:00:00
AIM: To investigate the correlation between lumican (LUM) gene and high myopia in a Southern Chinese population. METHODS: The study comprised of 95 high myopia patients with a spherical equivalent ≤?6.5 diopters (D). The control group recruited 95 individuals with a spherical equivalent ranging from ?0.5 D to +0.5 D. Direct sequencing was used to detect the single nucleotide polymorphisms (SNPs) of LUM gene in coding region. Genotype distributions were tested for Hardy-Weinberg disequilibrium. Genotypic and allelic frequencies were analyzed through Chi-square test or Fisher’s exact test. RESULTS: We identified 3 SNPs of the LUM gene: LUM c.32 (rs577456426), LUM c.507 (rs17853500) and LUM c.849 (rs181915277). Among the three SNPs, the genotype and allele frequencies of rs17853500 showed a significant difference between patients and control subjects (P<0.05). However, there were no significant differences in rs181915277 and rs577456426 between the two groups (P>0.05). CONCLUSION: LUM c.507 polymorphism may be a risk factor for the pathogenesis of high myopia in the Southern Chinese population.

In vivo biodistribution of topical low molecular weight heparin-taurocholate in a neovascularized mouse cornea

2018/8/6 0:00:00
AIM: To investigate the ocular biodistribution and clearance of topically administered 7-taurocholic acid conjugated low-molecular weight heparin (LHT7) in a neovascularized mouse cornea using an in vivo optical imaging system. METHODS: A total of 10 eyes of 6 to 8-week-old BALB/c mice were analyzed. Corneal neovascularization (CoNV) was induced in the inferior cornea (IC) of each animal by penetrating the stroma with two interrupted sutures. The development of CoNV was verified after one week and the area of each neovascularized region was measured. A near-infrared fluorescent probe of 20 μmol/L Cy5.5 labeled LHT7 (LHT7-Cy5.5) in 0.02 mL solution was topically instilled onto the cornea in the experimental group (n=5). Free-Cy5.5 of 20 μmol/L in 0.02 mL was instilled in the control group (n=5). In vivo optical images were obtained before instillation and 5min, 2, 4, and 6h after instillation. The intensities were separately measured at the superior cornea (SC) and the IC. RESULTS: The mean CoNV areas were 1.97±0.17 mm2 and 1.92±0.96 mm2 in the experimental and control groups, respectively (P=0.832). The SC remained normal in all 10 subject animals. The IC intensity of the LHT7-Cy5.5 was greater than the SC intensity at 5min (P=0.038), 2h (P=0.041), and 4h (P=0.041) after application. The IC intensity fell to less than half of its initial value (42.9%±8.6%) at 6h in the experimental group. In the control mice, here were no significant differences in the free-Cy5.5 intensity between the IC and SC. CONCLUSION: Topically administered LHT7 shows a high biodistribution in CoNV areas for 4h and should be reapplied accordingly to maintain its effects. In vivo optical imaging can be a useful tool for evaluating the ocular biodistribution of a drug in an animal model.

Cell death and survival following manual and femtosecond laser-assisted capsulotomy in age-related cataract

2018/8/6 0:00:00
AIM: To study molecular and morphological changes in lens epithelial cells following femtosecond laser-assisted and manually performed continuous curvilinear capsulotomy (CCC) in order to get information about these methods regarding their potential role in the induction of development of secondary cataract. METHODS: Anterior lens capsules (ALC) were removed from 40 patients with age-related cataract by manual CCC and by femtosecond laser-assisted capsulotomy (FLAC). Samples removed by manual CCC were assorted in group 1, FLAC samples were classified in group 2. Morphology of lens epithelial cells was examined with light and electron microscopes. Following capsulotomy, expressions of p53, Bcl-2 and cyclin D1 genes were analyzed with reverse transcriptase polymerase chain reaction. Immunohistochemistry was used to detect the pro-apoptotic p53 in the epithelial cells. RESULTS: Light and electron microscopic examination showed that ALC of group 1 contained more degenerating cells following manual CCC than after FLAC. The expression level of p53 was higher after manual than laser-assisted surgery. Immunocytochemistry indicated significantly higher number of cells containing p53 protein in the manual CCC group than following FLAC. Bcl-2 and cyclin D1 gene expression levels were slightly lower following manual CCC than after FLAC, but the difference was not significant. CONCLUSION: Manually removed ALC shows slightly, but not significantly larger damage due to the mechanical stretching and pulling of the capsule than those removed using FLAC.

Effects of LY294002 on the function of retinal endothelial cell in vitro

Yu Di and Xiao-Long Chen — 2018/8/6 0:00:00
AIM: To study the effects of LY294002 [phosphatidylinositol 3-kinase (PI3K) inhibitor] on the function and mechanisms of retinal endothelial cells (RECs) in vitro. METHODS: RECs were randomly divided into control group and LY294002 treatment group. RECs in the control group were placed the incubator for hypoxic exposure in vitro. RECs in the LY294002 treatment group were pretreated with LY294002 (40 μmol/L) under hypoxic condition. The expression of matrix metalloproteinase (MMP)-2, MMP-9, vascular endothelial growth factor (VEGF), and apoptosis and proliferation of RECs were evaluated with Western blot, real-time reverse transcription-polymerase chain reaction (RT-PCR), and flow cytometric analysis, correspondently. RESULTS: Compared with the control group, treating the RECs with LY294002 was able to remarkably inhibit cell proliferation rates (t1d=2.13, t2d=2.65, t3d=2.36, t4d=2.06, all P<0.05). Flow cytometric analysis indicated that a moderate increase in apoptosis in the LY294002 treatment group compared to the control group (t=2.51, P<0.05). The expression of MMP-2, MMP-9 and VEGF were downregulated in the LY294002 treatment group by Western blot and real-time RT-PCR (all P<0.05). CONCLUSION: LY294002 regulates the function of RECs by reducing the expression of MMP-2, MMP-9, and VEGF in vitro. LY294002 may provide an effective method for preventing pathological angiogenesis.

Influence of polymorphisms in VEGF, ACE, TNF and GST genes on the susceptibility to retinopathy of prematurity among Chinese infants

Xiao-Jun Lei, Yong-Xia Zhao and Tong Qiao — 2018/8/6 0:00:00
AIM: To investigate common polymorphisms in VEGF, ACE, TNF and GST genes with retinopathy of prematurity (ROP) risk among Chinese infants. METHODS: Nine polymorphisms in the above genes were genotyped on 724 advanced cases of ROP and 878 prematurely-born infants of low birth weight who were without any ophthalmologic disease. The frequencies of the polymorphisms were compared between cases and controls to identify the association present, if any. RESULTS: Of the nine polymorphisms, only two showed significant associations: ACE insertion deletion (ID) polymorphism (P=0.031) and TNF -308G/A polymorphism (P<0.001). The former was associated with a reduced ROP risk [ID genotype, adjusted OR (aOR): 0.603, 95%CI: 0.427-0.893, P=0.034; DD genotype, aOR: 0.468, 95%CI: 0.229-0.626, P=0.002], while the latter showed an increased risk (GA genotype, aOR: 1.956, 95%CI: 1.396-2.465, P<0.001; AA genotype, aOR: 2.809, 95%CI: 1.802-4.484, P<0.001). The association was also noted at the allele level (ACE D allele aOR: 0.698, 95%CI: 0.294-0.883, P<0.001; TNF -308A allele aOR: 1.776, 95%CI: 1.446-2.561, P<0.001). CONCLUSION: The ACE ID polymorphism can protect against ROP development while the TNF -308G/A can increase the risk of the disease among Chinese infants.

Frequency of IL-10-producing regulatory B cells associated with disease activity in thyroid-associated orbitopathy

Yun-Gang Ding, Guo Chen, Qian Li, Xiao-Feng Wen, Lai Wei and Hua-Sheng Yang — 2018/8/6 0:00:00
AIM: To investigate the association between IL-10-producing regulatory B (B10) cells and the clinical features of thyroid-associated orbitopathy (TAO). METHODS: A total of 30 patients with TAO were recruited at Zhongshan Ophthalmic Center from May 2015 to December 2015. Peripheral blood mononuclear cells (PBMCs) were separated from blood samples of 30 TAO patients and 16 healthy controls and stimulated with CD40 ligand and CpG for 48h. The frequency of IL-10+ B cells was examined by flow cytometry and the correlation between the frequency of IL-10+ B cells and clinical features of TAO was analyzed by SPSS. RESULTS: The frequency of IL-10+ B cells among CD19+ B cells in TAO patients was significantly lower than in healthy controls (TAO: 4.66%±1.88% vs healthy control: 6.82%±2.40%, P<0.01). The frequency of IL-10+ B cells showed a positive correlation with disease activity of TAO measured by Clinical Activity Score (CAS) (r=0.50, P<0.01), and became higher in TAO patients with family history of Graves’ disease (GD) (P=0.04). CONCLUSION: The decrease of the frequency of IL-10+ B cells in TAO patients indicates the deficiency of B10 cells in TAO, and the positive association with disease activity suggests its important role in TAO inflammation regulation.

Expression of multidrug-resistance associated proteins in human retinoblastoma treated by primary enucleation

2018/8/6 0:00:00
AIM: To reveal the expression of multidrug-resistance associated proteins: glutathione-S-transferase π (GSTπ), P-glycoprotein (P-gp) and vault protein lung resistance protein (LRP) in retinoblastoma (RB) without any conservative treatment before primary enucleation and to correlate this expression with histopathological tumor features. METHODS: A total of 42 specimens of RB undergone primary enucleation were selected for the research. Sections from the formalin-fixed, paraffin-embedded specimens were stained with HE and immunohistochemistry to detect the expression of GSTπ, P-gp and LRP. RESULTS: GSTπ was expressed in 39/42 (92.86%) RBs and in 9/9 (100%) well-differentiated RBs. P-gp/GSTπ was found in 30 (71.42%) of 42 RBs. Totally 9 (21.43%) tumors were well differentiated and 33 (78.57%) were poorly differentiated. Totally 15 (35.71%) eyes had optic nerve (ON) tumor invasion, 36 (85.71%) had choroidal tumor invasion, and 14 (33.33%) had simultaneous choroidal and ON invasion. There was no statistically significant relationship between P-gp, GSTπ, LRP positivity and the degree of ocular layer tumor invasion and ON tumor invasion (P>0.05). CONCLUSION: RB intrinsically expresses GSTπ, P-gp and LRP. GSTπ expression is positive in 100% well- differentiation ones, so in which way it is correlated with differentiation. But the other two proteins expressions are not related to tumor differentiation and to the degree of tumor invasion. GSTπ may be a new target of chemotherapy in RB.

Pterygial body epithelium domination of pterygial proliferation with TCF4 as a potential key factor

Cong Nie, Xin-Chun Zhang, Si-Ying Xu, Ya-Dan Quan, Zhi-Xin Tang and Rong Lu — 2018/8/6 0:00:00
AIM: To characterize the proliferative capacity of pterygial epithelium in different regions (head, neck and body) of pterygium and explore the function of transcription factor 4 (TCF4) in pterygium proliferation. METHODS: Thirty pterygium tissues and 10 normal conjunctival tissues were obtained from Zhongshan Ophthalmic Center (ZOC) and Guangdong Eye Bank, respectively. Proliferative capacity of head, neck and body in pterygial epithelium was measured using clonal analysis, fold growth analysis and expression profile of proliferative markers revealed by immunofluorescent staining and real-time PCR. The expression of TCF4 was highlighted by double immunofluorescent staining with other proliferation related markers such as proliferating cell nuclear antigen (PCNA) and ATP-binding cassette sub-family G member 2 (ABCG2). RESULTS: The proliferative potential of pterygial epithelium was higher than that of normal conjunctival epithelium. High expression levels of proliferative markers (P63α, PCNA and ABCG2) in pterygial body epithelium were observed in immunofluorescent staining and real-time PCR (P<0.05). Also, epithelial cells isolated from pterygial body demonstrated higher proliferative capacity in clonal analysis and fold growth analysis, than those isolated from the head and neck regions. The TCF4 expression in pterygial epithelium was similar to other proliferative markers (P63α, PCNA and ABCG2), as higher in pterygial body than head and neck. Moreover, TCF4 showed coexpression with other proliferation-related markers (PCNA and ABCG2) in the double immunofluorescent staining experiment. CONCLUSION: The proliferative capacity in pterygial body epithelium is prominent than the head and neck regions, and upregulated TCF4 may be associated with enhanced proliferation in the pterygium.

Establishment of an acute extraocular muscle injury model in cats

Jun-Jie Zhi, Hong Yan and Li-Hua Sun — 2018/8/6 0:00:00
AIM: To describe an acute extraocular muscle injury model in cats. METHODS: Seventy-two cats were randomly divided into 6 groups (12 cats per group). Cats’ left lateral recti were clamped using a surgical needle holder with a clamping strength of 2 (Groups A and D), 4 (Groups B and E) and 6 kg (Groups C and F). The right lateral recti were treated as controls. On the 4th and 7th days, hematoxylin eosin (HE) staining, immunohistochemical staining for proliferating cell nuclear antigen (PCNA), muscle force measurements and ocular alignment changes were performed to evaluate the extent of injuries. RESULTS: The morphological changes were graded as mild, moderate or severe by HE staining in all experiment groups. PCNA immunohistochemical staining indicated repairment of muscle fibers in the damaged area. On the 4th and 7th days after clamping, the injured lateral muscle exhibited an elevated threshold for electric stimulation. The muscle forces among groups 2, 4 and 6 kg injury at 4d (Groups A, B and C) were statistically significant (P<0.05), but no significant differences were noted among groups 2, 4 and 6 kg injury at 7d (Groups D, E and F) (P>0.05), respectively. In addition, medial deviation in ocular alignment was also present to various degrees in all groups. CONCLUSION: A cat model of acute extraocular muscle injury can be established by rectus clamping. Different clamping strengths can make different degrees of muscle injury. This model may help the future study in the acute extraocular muscle injury.

Biomarker identification of thyroid associated ophthalmopathy using microarray data

Hong-Bin Yang, Jie Jiang, Lu-Lu Li, Huang-Qiang Yang and Xiao-Yu Zhang — 2018/8/6 0:00:00
AIM: To uncover the underlying pathogenesis of thyroid associated ophthalmopathy (TAO) and explore potential biomarkers of this disease. METHODS: The expression profile GSE9340, which was downloaded from Gene Expression Omnibus database, included 18 specimens from 10 TAO patients and 8 hyperthyroidism patients without ophthalmopathy. The platform was HumanRef-8 v2 Expression BeadChip. Raw data were normalized using preprocess. Core package and the differentially expressed genes (DEGs) were identified based on t-test with limma package of R. Functional enrichment analyses were performed recruiting the DAVID tool. Based on STRING database, a protein-protein interaction (PPI) network was constructed, from which a module was extracted. The functional enrichment for genes in the module was performed by the BinGO plugin. RESULTS: In total, 861 DEGs (433 up-regulated and 428 down-regulated) between TAO patients and hyperthyroidism patients without ophthalmopathy were identified. Crucial nodes in the PPI network included TPX2, CDCA5, PRC1, KIF23 and MKI67, which were also remarkable in the module and all enriched in cell cycle process. Additionally, MKI67 was highly correlated with TAO. Besides, the DEGs of GTF2F1, SMC3, USF1 and ZNF263 were predicted as transcription factors (TFs). CONCLUSION: Several crucial genes are identified such as TPX2, CDCA5, PRC1 and KIF23, which all might play significant roles in TAO via the regulation of cell cycle process. Regulatory relationships between TPX2 and CDCA5 as well as between PRC1 and KIF23 may exist. Additionally, MKI67 may be a potent biomarker of TAO, and SMC3 and ZNF263 may exert their roles as TFs in TAO progression.

Tranilast inhibits TGF-β-induced collagen gel contraction mediated by human corneal fibroblasts

2018/8/7 0:00:00
AIM: To determine if tranilast affects human corneal fibroblast (HCFs) contraction. METHODS: HCFs cultured in a three-dimensional type I collagen gel were treated with or without transforming growth factor beta (TGF-β) or tranilast. Gel diameter was measured as an indicator for collagen contraction. Immunoblot was performed to evaluate myosin light chain (MLC) and paxillin phosphorylation. Confocal microscopy was employed to examine the focal adhesions and actin stress fiber formation. Immunoblot analysis and gelatin zymography were performed to detect tissue inhibitors of metalloproteinases and matrix metalloproteinases (MMPs) in supernatant. RESULTS: The inhibitory effect of tranilast on HCFs-mediated collagen gel contraction induced by TGF-β was dose-dependent. The significant effect of tranilast was started from 100 μmol/L and maximized at 300 μmol/L. The peak effect of 300 μmol/L tranilast also relied on the duration of treatment, which showed statistical significance from day 2. TGF-β-induced paxillin and MLC phosphorylation, stress fiber formation, focal adhesions, and MMP-1, MMP-2, and MMP-3 secretion in HCFs were also inhibited by tranilast. CONCLUSION: Tranilast suppresses the HCFs-cultured collagen gel contraction induced by TGF-β. It attenuates actin stress fibers formation, focal adhesions, and the secretion of MMPs, with these actions likely contributing to the inhibitory effect on HCF contractility. By attenuating the contractility of corneal fibroblasts, tranilast treatment may inhibit corneal scarring.

In vitro inhibition of proliferation, migration and epithelial-mesenchymal transition of human lens epithelial cells by fasudil

Jing-Zhi Shao, Ying Qi, Shan-Shan Du, Wen-Wen Du, Fu-Zhen Li and Feng-Yan Zhang — 2018/8/7 0:00:00
AIM: To study the potential role of fasudil as a treatment for posterior capsular opacification (PCO) of the human crystalline lens. METHODS: Human lens epithelial cells (HLECs; line SRA01/04) was exposed to transforming growth factor-β2 (TGF-β2) to induce the process of epithelial-mesenchymal transition (EMT). Fasudil was applied to the cell samples. Its effect on overall HLECs proliferation and migration was studied, as was its influence on EMT induction by TGF-β2 using cell migration assay, MTT colorimetric assay and Western blot assay. RESULTS: Fasudil inhibited the proliferation of SRA01/04. Its effect was time- and concentration-dependent. The migration of SRA01/04 cells was significantly reduced 24-72h after fasudil treatment, and the half maximal inhibitory concentration (IC50) was 22.37 μmol/mL at 72h. Reversal of the elongated, fibroblast-like shape changes induced by TGF-β2 in SRA01/04 cells was observed. Fasudil up-regulated the expression of Connexin43 protein and down-regulated the expression of α-SMA protein compared with the cells treated with TGF-β2. Furthermore, when exposed to fasudil, the phosphorylation of Rho-associated protein kinase (Rock) and myosin light chain (MLC) could not be activated in the cell preparations. CONCLUSION: Fasudil suppresses the proliferation and migration of SRA01/04 cells, and inhibits the process of EMT induced by TGF-β2. These results suggest that fasudil may serve as a therapeutic agent for PCO.

Role of microRNA-21 in uveal melanoma cell invasion and metastasis by regulating p53 and its downstream protein

Ying-Chih Wang, Xuan Yang, Wen-Bin Wei and Xiao-Lin Xu — 2018/8/7 0:00:00
AIM: To reveal the insight mechanism of liver metastasis in uveal melanoma, we investigated cell functions of microRNA-21 in three different uveal melanoma cell lines and analyze the relationship of target gene p53 and its downstream targets. METHODS: Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was used to detect microRNA-21 expression in normal uveal tissue and uveal melanoma cell lines. Lenti-virus expression system was used to construct OCM-1, MuM-2B and M619 cell line with stable overexpression and inhibition of microRNA-21. In vitro cell function tests such as cell proliferation, cell apoptosis, cell circle and abilities of migration and invasion were examined by MTT, BrdU assay, flow cytometry, transwell assay and Matrigel invasion assay respectively. The target gene was predicted by bioinformatics and confirmed by using a dual luciferase reporter assay. The expression of p53 and its suspected downstream targets LIM and SH3 protein 1 (LASP1) and glutathione S transferase pi (GST-Pi) were determined by qRT-PCR in mRNA level and Western blotting analysis in protein level. Finally, the effect of microRNA-21 in a xenograft tumor model was assessed in four-week-old BALB/c nude mice. RESULTS: Compared to normal uveal melanoma, expressions of microRNA-21 were significantly higher in uveal melanoma cell lines. Overexpression of microRNA-21 promoted proliferation, migration, and invasion of OCM-1, M619 and MuM-2B cells, while inhibition of microRNA-21 reveal opposite effects. Wild type p53 was identified as a target gene of microRNA-21-3p, and proved by dual luciferase reporter assay. Up-regulated microRNA-21 inhibited the expression of wild type p53 gene, and the increased expression of LASP1 in mRNA level and protein level, while down-regulated microRNA-21 presented opposite way. However, GST-pi showed the potential pattern as expected, but relative mRNA level showed no statistically significant difference in OCM-1 cells. Furthermore, the mRNA expression of GST-pi was decreased in microRNA-21 overexpressing MuM-2B, and increased in M619 cells with inhibition of microRNA-21. In vivo, inhibition of microRNA-21 reduced tumor growth with statistically significant difference. CONCLUSION: These findings provide novel insight into molecular etiology of microRNA-21 in uveal melanoma cell lines, and suggest that microRNA-21 might be a potential candidate for the diagnosis and prognostic factor of human uveal melanoma.

Inhibition of retinal angiogenesis by gold nanoparticles via inducing autophagy

2018/8/7 0:00:00
AIM: To investigate the effect of gold nanoparticles on retinal angiogenesis in vitro and in vivo, and to reveal the possible mechanism. METHODS: Seed growth method was used to synthesize gold nanoparticles (GNPs). The size, zeta potential, absorption spectrum and morphology of GNPs were identified using Malvern Nano-ZS, multimode reader (BioTek synergy2) and transmission electron microscope. Cell viability was analyzed using cell counting kit-8 method and cell growth was assessed with EdU kit. Transwell chamber was used to investigate cell migration. Tube formation method was used to assess the angiogenic property in vitro. Oxygen induced retinopathy (OIR) model was used to investigate the effect of GNPs on retinal angiogenesis. Confocal microscope and Western blot were used to study the possible mechanism of GNPs inhibited angiogenesis. RESULTS: The GNPs synthesized were uniform and well dispersed. GNPs of 10 μg/mL and 20 μg/mL were able to inhibit human umbilical vein endothelial cells proliferation (50% and 72% separately, P<0.001), migration (54% and 83% separately, P<0.001) and tube formation (52% and 90% separately, P<0.001). Further data showed that GNPs were able to improve the retinopathy in an OIR model. The possible mechanism might be that GNPs were able to induce autophagy significantly (P<0.05). CONCLUSION: The present study suggests that GNPs are able to inhibit retinal neovascularization in vitro and in vivo. GNPs might be a potential nanomedicine for the treatment of retinal angiogenesis.

Cytotoxic effect of interleukin-8 in retinal ganglion cells and its possible mechanisms

2018/8/7 0:00:00
AIM: To investigate the effect of interleukin-8 (IL-8) on neural retinal ganglion cells (RGCs) and whether it can be alleviated by G31P. METHODS: RGC-5 cells were exposed to IL-8 with or without its specific receptor antagonist G31P for 24h, and the cell viability was assessed by Cell Counting Kit 8 (CCK-8). Apoptosis was measured by examining nuclear morphology and quantifying with flow cytometry. Reverse transcription quantitative real-time polymerase chain reaction (RT-qPCR) and Western blot were used to investigate the expression of apoptosis-related genes. RESULTS: CCK-8 assay showed that IL-8 significantly inhibits the viability of RGC-5 cells in a dose-dependent manner. Cell apoptosis assays exhibited higher apoptotic rate in IL-8 treatment group compared to control group. We further found that IL-8 could promote Bax and caspase-3 expressions, but decrease the level of Bcl-2 in the aspect of mRNA and protein. However, pre-treatment with G31P partly attenuated these effects in RGC-5 cells (P<0.05). CONCLUSION: These results indicate that anti-proliferation effects of IL-8 through induction of cell apoptosis regulated by Bcl-2, Bax and caspase-3 expressions, can be ameliorated by G31P.

Inhibition of LY294002 in retinal neovascularization via down-regulation the PI3K/AKT-VEGF pathway in vivo and in vitro

Yu Di and Xiao-Long Chen — 2018/8/7 0:00:00
AIM: To investigate the effects of the phosphatidylinositol 3-kinase (PI3K) inhibitor LY294002 on retinal neovascularization (RNV) in the oxygen-induced retinopathy (OIR) mouse model and human umbilical vein endothelial cells (HUVECs). METHODS: C57BL/6J mice were randomly divided into normoxia-control, OIR-control and LY294002 treatment groups. LY294002 or phosphate-buffered solution was intraperitoneally injected daily into mouse pups from P6 to P9 in LY294002 treatment group or OIR-control group. Morphological and pathological changes in RNV, as well as expression levels of PI3K, serine-threonine kinase (AKT) and vascular endothelial growth factor (VEGF) were observed. HUVECs treating with LY294002 were exposed to hypoxia; the expression of PI3K, AKT and VEGF were examined by Western blot and RT-PCR analyses. RESULTS: Compared with the OIR-control group, LY294002 significantly inhibit RNV. Adenosine diphosphatase (ADPase) staining and hematoxylin and eosin staining indicated that the clock hour scores of neovascularization and the nuclei of pre-retinal neovascular cells in the LY294002 treatment group were clearly less than those in the OIR-control group (1.41±0.52 vs 6.20±1.21; 10.50±1.58 vs 22.25±1.82, both P<0.05). Intravitreal injection of LY294002 (in the LY294002 treatment group) markedly decreased PI3K/AKT-VEGF expression compared with the OIR-control group by immunohistochemistry, Western blotting and RT-PCR (all P<0.05). In HUVECs treated with hypoxia, expression of PI3K, AKT and VEGF were downregulated in the hypoxia-LY294002 group (all P<0.05). CONCLUSION: The PI3K inhibitor LY294002 can inhibit RNV by downregulating PI3K, AKT, and VEGF expression in vivo and in vitro. LY294002 may provide an effective method for preventing retinopathy of prematurity (ROP).

Evaluation of a rat meibomian gland dysfunction model induced by closure of meibomian gland orifices

Zi-Yi Dong, Ming Ying, Jie Zheng, Lan-Jun Hu, Jiang-Yan Xie and Yi Ma — 2018/7/10 0:00:00
AIM: To find a stable, inexpensive, and reliable method to produce a rat meibomian gland dysfunction (MGD) model. METHODS: We inserted slim guidewires into the meibomian gland orifices of twelve Brown Norway rats and fulgurized every guidewire to destroy part of the meibomian gland. We then observed the morphological changes in the eyelid margin, and compared the data of tear breakup time (TBUT), Schirmer I test, and the corneal fluorescence staining scores at different times (1, 2, 4, and 6wk). We observed pathological changes of the cornea, conjunctiva and meibomian gland, and we used real-time polymerase chain reaction to analyze epithelial growth factor (EGF), interleukin-6 (IL-6), IL-8, tumor necrosis factor-α (TNF-α), and Ki67. RESULTS: In the fourth week, compared with the control group, the TBUT of the model group began to decreased (P<0.05). The tear secretion remained stable (P>0.05). The corneal dots were significantly increased in the fourth week when the fusion stain began to appear (P<0.05). In the fourth week, partial meibomian gland openings had hoary secretions blocked, orifices were expanded, and there was a partial convex deformation. In the sixth week, the tissue section showed that the number of conjunctival goblet cells was decreased, epithelial cells were irregular, the epithelium was detached and rough, and meibomian glands were lost. The expressions of EGF, IL-6, IL-8, and TNF-α in corneal, conjunctival, and meibomian tissues were highly increased (P<0.05), but no statistical difference was found in the expression of Ki67 in corneal and conjunctival tissues (P>0.05). CONCLUSION: The MGD rat model, produced via electrocauterization of meibomian gland orifices, matched clinical manifestations and cytokine levels. Our research provides a new method of achieving an MGD animal model.

Early expression of PTX3 in Aspergillus fumigatus infected rat cornea

Jie Zhang, Gui-Qiu Zhao, Jing Qu, Jing Lin, Cheng-Ye Che and Xue-Jiao Yang — 2018/7/10 0:00:00
AIM: To investigate the expression of pentraxin 3 (PTX3) in rat corneal epithelium at the early stage of Aspergillus fumigatus (A. fumigatus) infection. METHODS: A total of 50 Wistar rats were randomly divided into control group, Sham group and experimental group (fungal keratitis group, FK group). The right eye was chosen as the experiment one and infected by A. fumigatus. Rats were executed at 8, 16 and 24h after the experimental models being established. Corneal epithelia were collected to assess the expression of PTX3 by quantitative reverse transcription polymerase chain reaction (qRT-PCR) and Western blot analysis. RESULTS: Corneal inflammation scores increased as infection prolonged (P<0.05, P<0.001). PTX3 mRNA expression was low in normal and Sham group rats' corneas. Level of PTX3 mRNA in infected rat cornea was elevated at 8h and peaked at 16h. The difference was significant compared with control group (P<0.001). Western blot analysis also showed a significant increase of PTX3 protein in experimental group at 8h and peaked at 16h (P<0.001). The synchronous expression of control group and experimental group were also in significant difference (P<0.001). CONCLUSION: PTX3 exists in cornea epithelium and is significantly increased after A. fumigatus infection. PTX3 plays an important role in the early stage of cornea innate immunity against A. fumigatus.

Comparison of the inhibitory effect of different doses of subconjunctival bevacizumab application in an experimental model of corneal neovascularization

Burak Ulas, Rana Altan-Yaycioglu and Nebil Bal — 2018/7/10 0:00:00
AIM: To evaluate the inhibitory effect of subconjunctival bevacizumab as single- and multiple-dose application, and compare their effects on corneal neovascularization in a rat model. METHODS: Thirty adult Sprague-Dawley rats were used in this experimental study. The central cornea of the rats was cauterized chemically. The rats were randomly enrolled into three groups. All groups received subconjunctival injections. In Group 1 (control group, n=10), 0.05 mL 0.9% NaCl solution was injected on the first day. In Group 2 (single-dose group, n=10), 0.05 mL bevacizumab (1.25 mg) was injected on the first day. In Group 3 (multiple-dose group, n=10), four doses of 0.05 mL bevacizumab (1.25 mg) were injected on the first, third, fifth and seventh day. Slit-lamp examination of all rats was performed at the third and ninth day. Digital images of the corneas were taken and analyzed using image analysis software to calculate corneal neovascularization area. All rats were sacrificed on the tenth day. In corneal sections, the number of blood vessels, state of inflammation and collagen formation was evaluated histopathologically. RESULTS: In Group 3, corneal edema grades were significantly lower than Group 1 and Group 2 (P=0.02, and P=0.035, respectively). The mean percentage of neovascularized corneal area in Group 3 was significantly lower than Group 2 (P=0.005). On histopathological examination, Group 2 and Group 3 showed significantly less number of blood vessels than Group 1 (P=0.005, and P=0.001, respectively). Additionally, Group 3 showed significantly less number of blood vessels compared to Group 2 (P=0.019). Inflammation and edema grades were significantly lower in Group 3 compared to Group 1 (P=0.001). CONCLUSION: Subconjunctival bevacizumab injection is effective in inhibition of newly formed corneal neovascularization. The multiple-dose bevacizumab treatment seems to be more effective compared to single-dose treatment.

Evaluation of artificial tears on cornea epithelium healing

Ying Zhang, Xiao-You Lu, Ren-Jian Hu, Fang-Li Fan and Xiu-Ming Jin — 2018/7/10 0:00:00
AIM: To observe the efficacy of different artificial eye drops on corneal epithelium healing in rabbit. METHODS: Thirty-five rabbits with 6 mm diameter central corneal epithelium removed were randomly assigned to six groups: 0.9% normal saline (NS) group, 0.1% hyaluronate (HA) group, 0.3% HA group, Tears Naturale Free® (TNF) group, 0.4% polyethylene glycol (PEG) group, 0.5% carboxymethyl cellulose (CMC) group and blank control group. Treatments were administered topically four times daily. Corneal epithelium healing was evaluated by the percentage reduction in wound area at 24, 36, 48, 60, and 72h after removal of the corneal epithelium. Cornea re-epithelialization was also assessed by histological analysis and electron microscopy. RESULTS: All corneal wounds completely re-epithelialized in less than 72h. The average re-epithelialization time was 47.61±4.25h in the 0.3% HA group and 49.72±1.05h in the 0.9% NS group, followed by 0.1% HA, TNF, 0.4% PEG, 0.5% CMC, and lastly by the control group. Compared to the control group, there were significant differences among 0.3% HA, 0.9% NS, PEG, and TNF (P<0.05) groups. At the first 24h, re-epithelialization at the 0.3% HA, TNF, and 0.9% NS treatment groups were significantly faster than the other groups. At 48h post-wounding, corneal epithelium is nearly completing re-epithelialization at 0.3% HA and 0.9% NS treatment groups. Electron microscopy revealed that there were a large number of vacuoles in the cells of the 0.9% NS group at 72h. CONCLUSION: Artificial tears promote corneal re-epithelium varied in the efficacy. Obviously, all artificial eye drops better than blank group. In the process of corneal healing, corneal epithelium cells suffered from hypoxia caused by NS.

Screening of methylation genes in age-related cataract

Li Wang, Peng Li and Xiong Guo — 2018/7/10 0:00:00
AIM: To analyze and screen the methylation status of whole-genome in age-related cataract samples. METHODS: Anterior lens capsule samples were collected from age-related cortical cataract patients over 50 years of age with LOCS III score of nuclear color ≥4 along with control subjects. DNAs were extracted and subjected to methylation microarray for the identification of methylated genes employing the high-throughput sequencing approach. RESULTS: Compared with the control group, 843 sites were found methylated, including 802 hypermethylation sites with 542 corresponding genes, 41 demethylation sites with 29 corresponding sites. COL4A1, GJA3, SIPA1L3 were confirmed by mass spectrometry, the results were consistent with high-throughput sequencing. CONCLUSION: DNA methylation microarrays is an efficient way for screening the aberrantly methylated genes. In this study, we are able to screen a few age-related cataract genes such as COL4A1, GJA3, and SIPA1L3 for their aberrant methylation patterns in cataract patients however further work is warranted to understand the significance of these findings.

Triptolide inhibits TGF-β-induced matrix contraction and fibronectin production mediated by human Tenon fibroblasts

2018/7/10 0:00:00
AIM: To determine if triptolide influences the contractility and fibronectin production in human Tenon fibroblasts (HTFs). METHODS: HTFs were cultured in type I collagen gels with or without transforming growth factor beta (TGF-β) and/or triptolide. The diameter of the collagen gel was used to measure contraction. Immunoblot analysis was used to quantify myosin light chain (MLC) phosphorylation and integrin expression. Laser confocal fluorescence microscopy was used to monitor the formation of actin stress fibers. Fibronectin production was measured with an enzyme immunoassay. RESULTS: Triptolide inhibition of contraction in TGF-β-induced collagen gel mediated by HTFs was dose-dependent and statistically significant at 3 nmol/L (P<0.05) and maximal at 30 nmol/L and significantly time dependent at 2d (P<0.05). Triptolide reduced TGF-β-induced expression of integrins α5 and β1, phosphorylation of MLC, and formation of stress fibers in HTFs. Furthermore, the inhibition of triptolide on the attenuated TGF-β-induced production of fibronectin by HTFs was concentration-dependent and significant at 1 nmol/L (P<0.05) and maximal at 30 nmol/L. CONCLUSION: Triptolide suppress the contractility of HTFs induced by TGF-β and the production of fibronectin by these cells. It is promising that triptolide treatment may possibly inhibit scar formation after glaucoma filtration surgery.

Induction of significant intraocular pressure diurnal fluctuation in rats using a modified technique of microbead occlusion

Lin Fu, Jimmy Shiu Ming Lai, Amy Cheuk Yin Lo and Kendrick Co Shih — 2018/7/10 0:00:00
AIM: To investigate the effect of microbead iridocorneal angle occlusion on intraocular pressure (IOP) diurnal fluctuation in rat eyes. METHODS: Male Dark Agouti (DA) rats, 8-10 week old, were each given a single intracameral injection of microbeads, followed by injection of dispersive viscoelastic solution. The right eye served as the experimental eye, while the left eye served as the control. IOP was measured twice daily postoperatively for 3wk and compared between groups. At the end of 3wk, the rats were sacrificed and the eyes were harvested for histological analysis and retinal ganglion cell (RGC) counting. RESULTS: After microbead injection, experimental eyes had significantly higher dark time IOP than controls from the second week to the third week [2nd week: 22.92±1.631 mm Hg (n=5) vs 17.35±0.751 mm Hg (n=5); 3rd week: 23.59±1.494 mm Hg vs 17.73±0.592 mm Hg (n=5)], while light time IOP was comparable between groups. The fluctuation levels of IOP in the experimental eyes were 7.21±0.398 mm Hg (n=5), 9.50±1.017 mm Hg (n=5) and 10.66±0.894 mm Hg (n=5) from the first week to the third week after injection. Comparatively, they were significantly lower in the control eyes, which were 4.69±0.323 mm Hg (n=5), 2.84±1.122 mm Hg (n=5) and 4.98±0.603 mm Hg (n=5) respectively. However, at the end of 3wk, the larger fluctuations in IOP in the experimental eyes was not associated with a significant loss of RGCs. CONCLUSION: Microbead occlusion exacerbates diurnal IOP fluctuation in rats. This reported model may serve as a method of investigating the pathological effects of IOP fluctuation. A longer observation period, or repeated injections, may be needed to observe a significant change in RGC density.

GSK3β inhibits epithelial-mesenchymal transition via the Wnt/β-catenin and PI3K/Akt pathways

Cheng Zhang, Li Su, Li Huang and Zheng-Yu Song — 2018/7/10 0:00:00
AIM: To investigate the regulatory mechanism of glycogen synthase kinase 3β (GSK3β) in epithelial-mesenchymal transition (EMT) process after proliferative vitreoretinopathy (PVR) induction. METHODS: Experimental PVR was induced by intravitreal injection of retinal pigment epithelium (RPE) cells in the eyes of rabbits. A PI3K/Akt inhibitor (wortmannin) and a GSK3β inhibitor (LiCl) were also injected at different time during PVR progress. Electroretinogram (ERG), ocular fundus photographs, and B-scan ultrasonography were used to observe the PVR progress. Western blot test on the extracted retina were performed at 1, 2, 4wk. The expression of the mesenchymal marker vimentin was determined by immunohistochemistry. Toxicity of wortmannin and LiCl were evaluated by ERG and TdT-mediated dUTP nick-end labeling (TUNEL) assay. The vitreous was also collected for metabolomic analysis. RESULTS: Experimental PVR could significantly lead to EMT, along with the suppressed expression of GSK3β and the activation of Wnt/β-catenin and PI3K/Akt pathways. It was verified that upregulating the expression of GSK3β could effectively inhibit EMT process by suppressing Wnt/β-catenin and PI3K/Akt pathways. CONCLUSION: GSK3β effectively inhibits EMT via the Wnt/β-catenin and PI3K/Akt pathways. GSK3β may be regarded as a promising target of experimental PVR inhibition.

A preliminary study on the establishment of an animal model of conjunctivochalasis

2018/6/12 0:00:00
AIM: To explore a feasible method on the establishment of an animal model of conjunctivochalasis (CCH). METHODS: Twelve clean-grade New Zealand white rabbits were divided into four groups (n=3/group): the control group (one received no interventions, and the others underwent subconjunctival injection of sterile water), the matrix metalloproteinases (MMPs) group (administered subconjunctival injection of MMP-3), the aging group (administered subcutaneous injection of D-galactose), the tumor necrosis factor-α (TNF-α) solution group (administered eye drops of TNF-α). Anterior segment photography, conjunctival tissue light microscopy and transmission electron microscopy (TEM) were performed after 12wk. RESULTS: Among all groups, the MMPs group had the following changes: the looser connection between the inferior bulbar conjunctiva and sclera; the more disordered collagen fibers (Trichrome staining) and the broken elastic fibers (Aldehyde-fuchsin staining); the focal necrosis of fibroblasts (TEM). CONCLUSION: Administration of MMPs may be a feasible method for the establishment of an animal model of CCH.

Regulation of lipoxygenase-1 and Dectin-1 on interleukin-10 in mouse Aspergillus fumigatus keratitis

2018/6/12 0:00:00
AIM: To investigate the regulation of lipoxygenase (LOX)-1 and Dectin-1 on interleukin-10 (IL-10) production in mice with Aspergillus fumigatus (A. fumigatus) keratitis. METHODS: The corneas of C57BL/6 mice were pretreated with LOX-1 inhibitor Poly(I) or Dectin-1 siRNA separately before the infection of A. fumigatus. Polymerase chain reaction (PCR) and Western blot were used to detect the expression of IL-10. RESULTS: The mRNA and protein expressions of IL-10 were significantly increased in mice with A. fumigatus keratitis. Compared with the group pretreated with sterile water before infection, Poly(I) pretreatment suppressed IL-10 expression significantly. Compared with the group pretreated with scrambled siRNA before infection, Dectin-1 siRNA pretreatment significantly reduced IL-10 expression in response to A. fumigatus infection. CONCLUSION: LOX-1 and Dectin-1 regulate IL-10 production in mouse A. fumigatus keratitis.

Bioinformatics analysis of microarray data to explore the key genes involved in HSF4 mutation-induced cataract

Rui Tian, Yang Xu, Wen-Wen Dou and Hui Zhang — 2018/6/12 0:00:00
AIM: To reveal the mechanisms of heat-shock transcription factor 4 (HSF4) mutation-induced cataract. METHODS: GSE22362, including 3 HSF4-null lens and 3 wild-type lens, was obtained from Gene Expression Omnibus database. After data preprocessing, the differentially expressed genes (DEGs) were identified using the limma package. Based on Database for Annotation, Visualization and Integrated Discovery (DAVID) tool, functional and pathway enrichment analyses were performed for the DEGs. Followed by protein-protein interaction (PPI) network was constructed using STRING database and Cytoscape software. Furthermore, the validated microRNA (miRNA)-DEG pairs were obtained from miRWalk2.0 database, and then miRNA-DEG regulatory network was visualized by Cytoscape software. RESULTS: A total of 176 DEGs were identified in HSF4-null lens compared with wild-type lens. In the PPI network, FBJ osteosarcoma oncogene (FOS), early growth response 1 (EGR1) and heme oxygenase (decycling) 1 (HMOX1) had higher degrees and could interact with each other. Besides, mmu-miR-15a-5p and mmu-miR-26a-5p were among the top 10 miRNAs in the miRNA-DEG regulatory network. Additionally, mmu-miR-26a-5p could target EGR1 in the regulatory network. CONCLUSION: FOS, EGR1, HMOX1, mmu-miR-26a-5p and mmu-miR-15a-5p might function in the pathogenesis of HSF4 mutation-induced cataract.

Knobloch syndrome caused by homozygous frameshift mutation of the COL18A1 gene in a Chinese pedigree

Lu-Si Zhang, Hai-Bo Li, Jun Zeng, Yan Yang and Chun Ding — 2018/6/12 0:00:00
AIM: To explore the clinical feature and genetic etiology of a Chinese Knobloch syndrome family. METHODS: Ocular examinations and magnetic resonance imagings (MRIs) were performed on the family. Whole exome sequencing was conducted on the two patients. Sanger sequencing was utilized to validate the presence of variation in the family as well as in 100 normal controls. Real-time quantitative polymerase chain reaction (PCR) was used to detect the expression level of COL18A1 in peripheral blood lymphocytes of the patients and normal carriers. RESULTS: The affected subjects presented with vision loss, exotropia, cataracts, retinal detachment, and other complications. A homozygous c.4759_4760delCT (p.Leu1587ValfsX72) mutation (rs398122391) in COL18A1 was identified in the two patients, cosegregating with the phenotypes, and did not be detected in 100 normal controls. This mutation caused significant decreased expression of COL18A1 mRNA in the patients. CONCLUSION: The findings strongly indicate that this mutation is the disease-causing mutation. Moreover, this is the first Knobloch syndrome pedigree reported in the Chinese population.

Protective effects of ciliary neurotrophic factor on the retinal ganglion cells by injure of hydrogen peroxide

Wen-Jun Wang, Wei Jin, An-Huai Yang, Zhen Chen and Yi-Qiao Xing — 2018/6/12 0:00:00
AIM: To explore the effect of ciliary neurotrophic factor (CNTF) on retinal ganglion cell (RGC)-5 induced by hydrogen peroxide (H2O2). METHODS: After cell adherence, RGC-5 culture medium was changed to contain different concentrations of H2O2 from 50 to 150 μmol/L at four time points (0.5, 1, 1.5 and 2h) to select the concentration and time point for H2O2 induced model. Two different ways of interventions for injured RGC-5 cells respectively were CNTF as an addition in the culture medium or recombinant lentiviral plasmid carrying CNTF gene transfecting bone mesenchymal stem cells (BMSCs) for co-culture with RGC-5. RESULTS: Compared to the control group, H2O2 led to RGC-5 death closely associated with concentrations and action time of H2O2 and we chose 125 μmol/L and 2h to establish the H2O2-induced model. While CNTF inhibited the loss of RGC-5 cells obviously with a dose-dependent survival rate. Nevertheless two administration routes had different survival rate yet higher rate in recombinant lentiviral plasmid group but there were no statistically significant differences. CONCLUSION: Both the two administration routes of CNTF have effects on RGC-5 cells induced by H2O2. If their own advantages were combined, there may be a better administration route.

Effect of Aβ protein on inhibiting proliferation and promoting apoptosis of retinal pigment epithelial cells

Zi Ye, Shou-Zhi He and Zhao-Hui Li — 2018/6/12 0:00:00
AIM: To identify the effect and regulatory mechanism of amyloid β (Aβ) protein on retinal pigment epithelial (RPE) cells in cell proliferation and apoptosis, and clarify Aβ role in the pathogenesis of age-related macular degeneration (AMD). METHODS: The model of Aβ25-35 protein cytotoxicity in RPE cell was successfully established to investigate the effect of Aβ protein on RPE cells in vitro. Based on Aβ protein, the specific inhibitors (HY-50682 or BAY11-7082) or activating agent (lipopolysaccharide) was used to analyze the regulatory mechanism of Aβ protein to RPE cells on cell proliferation and apoptosis by flow cytometry, real-time polymerase chain reaction, Western blotting, enzyme-linked immunosorbent assay and dual-luciferase reporter gene assay. RESULTS: The number of RPE cells, treated with Aβ25-35 from 0.3 to 60 μmol/L, significantly reduce (P<0.01), and had the dose-dependent effect. Aβ protein 60 μmol/L inhibits the G1/S phase transition (P<0.01) and down-regulated cyclin E mRNA level (P<0.01). Similarly, Aβ25-35 induced a significant increase of cell apoptosis, accompanied by the significantly higher level of activated caspase 3 protein. Furthermore, nuclear factor-kappaB (NF-κB) activity and phosphorylated Iκ-Ba level would significantly lower in treated RPE cells. Using specific inhibitors or activating agent based on the Aβ, the cell numbers, NF-κB activity, phosphorylated Iκ-Ba level, receptor for advanced glycation endproducts (RAGE) gene expression levels, cyclin E mRNA level and activated caspase 3 level had accordingly changed by different methods, confirming that RAGE/NF-κB signaling pathway involved in the regulation of Aβ protein on RPE cell apoptosis and proliferation. CONCLUSION: Aβ protein inhibits cell proliferation and activates apoptosis via inactivation of the RAGE/NF-κB signaling pathway in RPE cell.

Protective effects of a novel drug RC28-E blocking both VEGF and FGF2 on early diabetic rat retina

2018/6/12 0:00:00
AIM: To investigate protective effects of a novel recombinant decoy receptor drug RC28-E on retinal damage in early diabetic rats. METHODS: The streptozotocin (STZ)-induced diabetic rats were randomly divided into 6 groups: diabetes mellitus (DM) group (saline, 3 μL/eye); RC28-E at low (0.33 μg/μL, 3 μL), medium (1 μg/μL, 3 μL), and high (3 μg/μL, 3 μL) dose groups; vascular endothelial growth factor (VEGF) Trap group (1 μg/μL, 3 μL); fibroblast growth factor (FGF) Trap group (1 μg/μL, 3 μL). Normal control group was included. At week 1 and 4 following diabetic induction, the rats were intravitreally injected with the corresponding solutions. At week 6 following the induction, apoptosis in retinal vessels was detected by TUNEL staining. Glial fibrillary acidic protein (GFAP) expression was examined by immunofluorescence. Blood-retinal barrier (BRB) breakdown was assessed by Evans blue assay. Ultrastructural changes in choroidal and retinal vessels were analyzed by transmission electron microscopy (TEM). Content of VEGF and FGF proteins in retina was measured by enzyme linked immunosorbent assay (ELISA). The retinal expression of intercellular cell adhesion molecule-1 (ICAM-1), tumor necrosis factor-α (TNF-α), VEGF and FGF genes was examined by quantitative polymerase chain reaction (qPCR). RESULTS: TUNEL staining showed that the aberrantly increased apoptotic cells death in diabetic retinal vascular network was significantly reduced by treatments of medium and high dose RC28-E, VEGF Trap, and FGF Trap (all P<0.05), the effects of medium and high dose RC28-E or FGF Trap were greater than VEGF Trap (P<0.01). GFAP staining suggested that reactive gliosis was substantially inhibited in all RC28-E and VEGF Trap groups, but the inhibition in FGF Trap group was not as prominent. Evans blue assay demonstrated that only high dose RC28-E could significantly reduce vascular leakage in early diabetic retina (P<0.01). TEM revealed that the ultrastructures in choroidal and retinal vessels were damaged in early diabetic retina, which was ameliorated to differential extents by each drug. The expression of VEGF and FGF2 proteins was significantly upregulated in early diabetic retina, and normalized by RC28-E at all dosages and by the corresponding Traps. The upregulation of ICAM-1 and TNF-α in diabetic retina was substantially suppressed by RC28-E and positive control drugs. CONCLUSION: Dual blockade of VEGF and FGF2 by RC28-E generates remarkable protective effects, including anti-apoptosis, anti-gliosis, anti-leakage, and improving ultrastructures and proinflammatory microenvironment, in early diabetic retina, thereby supporting further development of RC28-E into a novel and effective drug to diabetic retinopathy (DR).

Production of interleukin-1β related to mammalian target of rapamycin/Toll-like receptor 4 signaling pathway during Aspergillus fumigatus infection of the mouse cornea

Rui Xu, Jing Lin, Gui-Qiu Zhao, Cui Li, Cheng-Ye Che, Qiang Xu and Min Liu — 2018/5/11 0:00:00
AIM: To elucidate the effect of rapamycin on regulating the production of interleukin (IL)-1β in Aspergillus fumigatus (A. fumigatus)-induced keratitis and to verify whether the expression of IL-1β in A. fumigatus keratitis is associated with the mammalian target of rapamycin (mTOR)/Toll-like receptor 4 (TLR4) signaling pathway. METHODS: Fungal keratitis mouse models of susceptible C57BL/6 mice were established using A. fumigatus. The mice were subsequently treated with rapamycin. The protein levels of p-mTOR, TLR4, and IL-1β in normal and infected corneal tissue were measured by Western blot. The TLR4 and IL-1β mRNA levels were determined by real-time polymerase chain reaction (PCR). RESULTS: In C57BL/6 mice, rapamycin treatment decreased the clinical scores and production of the pro-inflammatory cytokine, IL-1β. The expression of TLR4, stimulated by A. fumigatus, was reduced as well when the mTOR signaling pathway was suppressed by rapamycin. CONCLUSION: Rapamycin is beneficial for the outcome of fungal keratitis and has an inhibitory effect expression of the inflammatory cytokine IL-1β. The inhibitory effect on IL-1β expression can be associated with the mTOR/TLR4 signaling pathway in A. fumigatus infection in mice.

Effects of brinzolamide on rabbit ocular blood flow in vivo and ex vivo

Ya-Ru Dong, Shi-Wei Huang, Ji-Zhe Cui and Takeshi Yoshitomi — 2018/5/11 0:00:00
AIM: To investigate if significant improvement of optic disc blood flow (ODBF) occurs after instillation of brinzolamide onto rabbit eyes. METHODS: Testing of bilateral intraocular pressure (IOP) and left ODBF in 10 male rabbits took place every 3h over a 24h period. Brinzolamide (1% ophthalmic solution, two drops at 9:00 and 21:00) was administered to the left eye. ODBF, assessed using laser speckle flowgraphy, was determined as the mean blur rate (MBR). Furthermore, the effect of brinzolamide on isolated rabbit ciliary arteries using isometric tension recording system was performed. RESULTS: After brinzolamide instillation, IOP was significantly decreased in the left eye. MBR-vessel was greater at 18:00 and 21:00 (P<0.05) than in the controls. MBR-tissue and MBR-average were greater at 18:00 (P<0.05) than in the controls. For isolated arteries pre-contracted with a high-K solution, brinzolamide induced concentration-dependent relaxation, reaching 46.1%±9% (n=21) at 1 mmol/L. In Ca2+-free solutions, incubation with brinzolamide suppressed 1 μmol/L histamine-induced contractions (P<0.05). CONCLUSION: Brinzolamide decreases IOP and increases ocular blood flow. The direct vasodilatory effect of brizolamide is mediated by suppression of Ca2+ release from intracellular calcium stores.

Effect of integrin α5β1 inhibition on SDF-l/CXCR4- mediated choroidal neovascularization

Yang Lyu, Wen-Qin Xu, Li-Juan Sun, Xiao-Yan Pan, Jian Zhang and Yu-Sheng Wang — 2018/5/11 0:00:00
AIM: To investigate the roles of integrins in choroidal neovascularization (CNV) and their associations with the stromal cell-derived factor-1 (SDF-1)/CXCR4 axis. METHODS: CNV lesions were induced in mice using laser photocoagulation. After CNV induction, all animals were randomly assigned to: control, SDF-1, SDF-1+age-related macular degeneration (AMD) 3100 (CXCR4 inhibitor), and SDF-1+ATN161 (integrin α5β1 inhibitor) groups; their effects on CNV progression were observed using hematoxylin eosin (HE) staining, fundus fluorescein angiography (FFA) grading and optical coherence tomography (OCT), and their effects on CXCR4/integrin α5 expression were evaluated using Western blot and double immunofluorescence staining. Hypoxia-exposed endothelial cells (ECs) were used to simulate CNV in vitro, they were treated with SDF-1, combined with CXCR4 siRNA/AMD3100 or ATN161, and expression of integrin α5, cell migration and tube formation were analyzed. RESULTS: Integrin subunit α5 increased at 3rd and 7th day and decreased at 14th day in CNV mice, with no significant change of β1-integrin. CXCR4 expression in CNV mice had persistent increase within 14d after induction. SDF-1 treatment significantly promoted the CNV progression during 3-14d. The mean CNV length in AMD3100 and ATN161 group at day 7 was 270.13 and 264.23 μm in HE images, significantly lower than the mean length in SDF-1 (345.70 μm) group. AMD3100 and ATN161 also significantly reduced thickness and leakage of CNV induced by SDF-1. Mean integrin α5 positive area in SDF-1 group reached 2.31×104 μm2, significantly higher than control (1.25×104 μm2), which decreased to 1.78×104 μm2 after AMD3100 treatment. About 61.36% of ECs in CNV lesions expressed α5 in SDF-1 group, which significantly decreased to 43.12% after AMD3100 treatment. In vitro, integrin α5 peaked by 6 folds after 6h of hypoxia exposure and CXCR4 gradually increased by up to 2.3 folds after 24h of hypoxia. Approximately 25.12% of ECs expressed integrin α5 after SDF-1 stimulation, which decreased to 7.2%-9.5% after si-CXCR4 or AMD3100 treatment. ATN161 exerted an inhibitory effect comparable to that of si-CXCR4 on EC migration and tube formation in the presence of SDF-1. CONCLUSION: SDF-1/CXCR4 signaling induces integrin α5β1 expression in ECs to promote CNV.

Crosslink between lipids and acute uveitis: a lipidomic analysis

Hai-Yan Wang, Yi Wang, Yuan Zhang, Jing Wang, Shu-Yu Xiong and Qian Sun — 2018/5/11 0:00:00
AIM: To explore the roles of phospholipids and sphingolipids in the inflammatory process of uveitis. METHODS: Aqueous humor (AH) and the retina were obtained from endotoxin-induced uveitis (EIU) rats during the acute inflammation stage (24h after endotoxin injection). Lipids were extracted using a modified Bligh and Dyer method and subjected to mass spectrometric identification using class-specific lipid standards and ratiometric quantification. Relative intensity analysis was performed to evaluate the amount change of common lipids between the EIU and control groups. RESULTS: Unique lipid species encompassing all five phospholipid classes were found in both control and the EIU AH and retina. Commensurate with the significantly increased level of lysophospholipids in the EIU AH and retina, we found that the ratio of lysophospholipids to total phospholipids was significantly increased too. We also detected a significant increase in 18:0 lysophosphatidylcholine levels in the EIU group (fold change =6.4 in AH and 3.8 in retina). Cer240, Cer241, and SM240 levels remarkably increased in the EIU AH. Enhanced C12 ceramide-1-phosphate (C12 C-1-P), C16 C-1-P, C24 C-1-P, and upregulated Cer160, Cer240, SM120, and SM240 were found in EIU retina. C-1-P was believed to restore homeostasis by inhibiting nuclear factor kappa B (NF-κB) activation. However, we still found elevated NF-κB levels in the EIU retina. CONCLUSION: A variety of lipids might have played a critical role in EIU inflammation. Exogenous topical application of these protective lipids or inhibition of these pro-inflammatory lipids may be useful therapeutic strategies for the resolution of EIU.

Amyloid beta deposition related retinal pigment epithelium cell impairment and subretinal microglia activation in aged APPswePS1 transgenic mice

Zhi-Zhang Dong, Juan Li, Yi-Feng Gan, Xue-Rong Sun, Yun-Xia Leng and Jian Ge — 2018/5/11 0:00:00
AIM: To identify the pathological role of amyloid beta (Aβ) deposition in retinal degeneration, and explore Aβ deposition on the retinal pigment epithelium cells (RPE) layer and the associated structural and functional changes in Alzheimer’s disease transgenic mice. METHODS: RPE changes in the eyes of APPswe/PS1 transgenic and none transgenic (NTG) mice over 20 months old were examined. Histological changes were investigated via hematoxylin and eosin (H&E) staining and transmission electron microscopy (TEM) examination, whereas the expression of amyloid precursor protein (APP), Aβ, Zonula occludens-1 (ZO-1) and Ionized calcium binding adaptor molecule-1 (IBA-1) were investigated using immunohistochemistry and immunofluorescence techniques. All of the obtained results were quantitatively and statistically analyzed. RESULTS: In aged transgenic mice, an APP-positive immunoreaction and Aβ deposition were detected on the RPE layer but were undetectable in NTG mice. The RPE demonstrated some vacuole changes, shortened basal infoldings and basal deposition in histopathological examination and TEM tests, wherein irregular shapes were indicated by ZO-1 disorganization through fluorescence. Furthermore, IBA-1 positive cells were observed to have accumulated and infiltrated into the RPE layer and localized beneath the RPE/Bruch’s membrane (BrM) complex, which was accompanied by an increase in BrM thickness in aged transgenic mice in comparison to NTG mice. The IBA-1 positive cells were found to be co-stained with Aβ deposition on the RPE flat mounts. CONCLUSION: The observed Aβ deposition in the RPE layer may cause RPE dysfunction, which is associated with microglia cells infiltration into the retina of aged transgenic mice, suggesting that Aβ deposition probably plays a significant role in RPE-related degenerative disease.

Changes in intrinsic excitability of ganglion cells in degenerated retinas of RCS rats

Yi-Ming Ren, Chuan-Huang Weng, Cong-Jian Zhao and Zheng-Qin Yin — 2018/5/11 0:00:00
AIM: To evaluate the intrinsic excitability of retinal ganglion cells (RGCs) in degenerated retinas. METHODS: The intrinsic excitability of various morphologically defined RGC types using a combination of patch-clamp recording and the Lucifer yellow tracer in retinal whole-mount preparations harvested from Royal College of Surgeons (RCS) rats, a common retinitis pigmentosa (RP) model, in a relatively late stage of retinal degeneration (P90) were investigated. Several parameters of RGC morphologies and action potentials (APs) were measured and compared to those of non-dystrophic control rats, including dendritic stratification, dendritic field diameter, peak amplitude, half width, resting membrane potential, AP threshold, depolarization to threshold, and firing rates. RESULTS: Compared with non-dystrophic control RGCs, more depolarizations were required to reach the AP threshold in RCS RGCs with low spontaneous spike rates and in RCS OFF cells (especially A2o cells), and RCS RGCs maintained their dendritic morphologies, resting membrane potentials and capabilities to generate APs. CONCLUSION: RGCs are relatively well preserved morphologically and functionally, and some cells are more susceptible to decreased excitability during retinal degeneration. These findings provide valuable considerations for optimizing RP therapeutic strategies.

Transfection with CXCR4 potentiates homing of mesenchymal stem cells in vitro and therapy of diabetic retinopathy in vivo

Jian Wang, Wei Zhang, Guang-Hui He, Bin Wu and Song Chen — 2018/5/11 0:00:00
AIM: To investigate the effect of the overexpression of C-X-C chemokine receptor type 4 (CXCR4) on homing of mesenchymal stem cells (MSCs) in vitro and therapeutic effects of diabetic retinopathy (DR) in vivo. METHODS: MSCs were infected by lentivirus constructed with CXCR4. The expression of CXCR4 was examined by immunofluorescence, Western blot, and quantitative polymerase chain reaction. CXCR4-overexpressing MSCs were cultured in vitro to evaluate their chemotaxis, migration, and apoptotic activities. CXCR4-overexpressing MSCs were intravitreally injected to observe and compare their effects in a mouse model of DR. The histological structure of DR in rats was inspected by hematoxylin and eosin staining. The expression of rhodopsin, neuron-specific enolase (NSE), and inflammatory cytokines interleukin (IL)-6 and tumor necrosis factor (TNF)-α was examined by Western blot and immunohistochemical analyses. RESULTS: The transduction of MSCs by lentivirus was effective, and the transduced MSCs had high expression levels of CXCR4 gene and protein. Improved migration activities were observed in CXCR4-overexpressing MSCs. Further, reduced retinal damage, upregulation of rhodopsin and NSE protein, and downregulation of inflammatory cytokines IL-6 and TNF-α were observed in CXCR4-overexpressing MSCs in vivo. CONCLUSION: The homing of MSCs can be enhanced by upregulating CXCR4 levels, possibly improving histological structures of DR. CXCR4-overexpressing MSCs can be a novel strategy for treating DR.

Differentially expressed miRNAs in premature infants with retinopathy-a bioinformatics analysis

Yang Yang, Jing-Jing Pan, Xiao-Guang Zhou, Xiao-Yu Zhou and Rui Cheng — 2018/5/11 0:00:00
AIM: To reveal the role of miRNAs in retinopathy of prematurity (ROP) by bioinformatics analysis. METHODS: The raw data of this study came from the researches of Wang et al and Zhao et al who analyzed the microRNA (miRNA) expression profile between ROP and controls. Based on the identified differentially expressed miRNAs, the related target genes, lncRNA and circRNA were predicted. Then we performed functional enrichment analysis to further analyze the functions of target genes. RESULTS: Hsa-miRNA-128-3p and hsa-miRNA-9-5p showed significantly different expression in both studies. LncRNA of POLDIP2, GAS5, NEFL and UHRF1, circRNA of ZNF280C_hsa_circ_001211 and SIAE_hsa_circ_002083, tar-get gene of QKI showed meaningful differential expression in ROP. Enrichment analysis showed that TGF-β signaling pathway, PI3K-Akt signaling pathway and MAPK signaling pathway might play important roles in the prog-ress of ROP. CONCLUSION: This research may provide a comprehensive bioinformatics analysis of differentially expressed miRNAs which are possibly involved in ROP.

Protective effects of Rutin against methanol induced acute toxic optic neuropathy: an experimental study

2018/5/11 0:00:00
AIM: To determine the effects of Rutin on methanol induced optic neuropathy and compare the results with the effects of ethanol. METHODS: Totally 30 rats were divided into 5 groups, with 6 rats in each group as follows: healthy controls (C), methotrexate (MTX), methotrexate+methanol (MTM), methotrexate+methanol+ethanol (MTME) and methotrexate+ methanol+Rutin (MTMR). In all rabbits except those of the control group, MTX, diluted in sterile serum physiologic, 0.3 mg/kg per oral was applied for 7d by the aid of a tube. After this procedure to the rats of MTM, MTME and MTMR groups, 20% methanol with a dose of 3 g/kg per oral was given by the aid of a tube. In MTME group, 4h after the application of methanol, 20% ethanol was applied by the same way with a dose of 0.5 g/kg. On the other hand, in MTMR group 4h after the application of methanol, Rutin, which was dissolved in distilled water, was applied by the same way with a dose of 50 mg/kg. RESULTS: There were statistically significant differences in tissue 8- hydroxy-2 deoxyguanine (8-OHdG), interleukin-1β (IL-1β), tumor necrosis factor-alpha (TNF-α), malondialdehyde (MDA), myeloperoxidase (MPO). glutathione peroxidase (tGSH) and superoxide dismutase (SOD) levels between groups (P<0.001). In MTMR group tissue 8-OHdG, IL-1β, MDA, and MPO levels were similar with the healthy controls but significantly different than the other groups. In histopathological evaluations, in MTX group there was moderate focal destruction, hemorrhage and decrease in number of astrocytes and oligodendrocytes; in MTM group there was severe destruction and edema with decrease in number of astrocytes and oligodendrocytes; in MTME group there was mild hemorrhage, mild edema, mildly dilated blood vessels with congestion while in MTMR group, optic nerve tissue was resembling the healthy controls. CONCLUSION: Rutin may prevent methanol-induced optic neuropathy via anti-inflammatory effects and decreasing the oxidative stress. New treatment options are warranted in this disease to avoid loss of vision in patients.

Mincle in the innate immune response of mice fungal keratitis

2018/4/10 0:00:00
AIM: To investigate how macrophage inducible C-type lectin (Mincle) influences inflammation in mice fungal keratitis induced by Aspergillus fumigatus (A. fumigatus). METHODS: C57BL/6 mice were infected with A. fumigatus after pretreated with Mincle agonist TDB or Mincle neutralizing antibody (MincleAb), taking DMSO or IgG as control group respectively. The cornea lesions were monitored with slit-lamp microscope and evaluated by clinical score. Mincle expression was assessed using reverse transcription-ploymerase chain reaction (RT-PCR) and immunostaining. The expression of cytokines (IL-1β, TNF-α and IL-6) chemokines (CXCL-1 and MIP-2) was determined by RT-PCR and ELISA. Neutrophil infiltration was observed by immunostaining. The levels of nitric oxide (NO) generated by corneas were tested by Griess reaction. RESULTS: Mincle mRNA and protein levels were higher in infected corneas than normal corneas of C57BL/6 mice, saving clinical scores revealed differences. When pretreated with Mincle agonist TDB, the mRNA and protein levels of IL-1β, TNF-α and IL-6 in infected corneas were significantly increased compared with the control group (P<0.01). Results of the counterpart in corneas pretreated with Mincle neutralizing antibody was decreased consistently (P<0.01). Expression of CXCL1 and MIP-2 mRNA levels were up-regulated in TDB group and down-regulated in MincleAb group (P<0.01), coincide with neutrophil aggregation degree in corneas showed by immunostaining. As for the concentration of NO, it was promoted in TDB group compared with DMSO control group, and decreased in MincleAb group compared with IgG control group. CONCLUSION: Mincle plays a dual role in mice fungal keratitis. It participates in the innate immune system by enhancing inflammation. What's more, Mincle can mediate cytotoxic effects by regulating the formation of NO.

Boxb mediate BALB/c mice corneal inflammation through a TLR4/MyD88-dependent signaling pathway in Aspergillus fumigatus keratitis

2018/4/10 0:00:00
AIM: To investigate whether high-mobility group box 1 (HMGB1) Boxb exacerbates BALB/c mice corneal immune responses and inflammatory through the Toll-like receptor 4 (TLR4)/myeloid differentiation primary response 88 (MyD88)-dependent signaling pathway in Aspergillus fumigatus (A. fumigatus) keratitis. METHODS: The mice corneas were pretreated with phosphate buffer saline (PBS), Boxb before A. fumigatus infection. The abdominal cavity extracted macrophages were pretreated with PBS, Boxb, TLR4 inhibitor (CLI-095), Dimethyl sulfoxide (DMSO) separately before A. fumigatus hyphae stimulation. HMGB1 was detected in normal and infected mice corneas and macrophages by real-time reverse transcriptase polymerase chain reaction (RT-PCR), the TLR4, MyD88, interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α) were detected by Western blot and PCR. RESULTS: In BALB/c mice corneas, the expressions of TLR4, HMGB1, IL-1β, TNF-α were increased after A. fumigatus infection. While pretreatment with Boxb significantly increased the expressions of TLR4, HMGB1, MyD88, IL-1β, TNF-α compared with PBS control after infection. In BALB/c mice abdominal cavity extracted macrophages, pretreatment with Boxb increased the expressions of TLR4, HMGB1, MyD88, IL-1β, TNF-α, while pretreatment with CLI-095 and Boxb significantly decreased the expressions of TLR4, HMGB1, MyD88, IL-1β, TNF-α. CONCLUSION: In A. fumigatus keratitis, Boxb play a pro-inflammatory role in corneal anti-fungi immune response through the HMGB1-TLR4-MyD88 signal pathway.

Effect of senescence marker protein 30 on the proliferation and apoptosis of human lens epithelial cells SRA01/04

Xi Chen, Song-Man Li, Yan-Wei Li, Zi-Hao Han and Hao Liang — 2018/4/10 0:00:00
AIM: To study the effect of senescence marker protein 30 (SMP30) on the proliferation and apoptosis of human lens epithelial cell (HLEC) SRA01/04. METHODS: SMP30 overexpression (OE) and knock down (KD) type cell lines were cultivated by using two groups regucalcin (RGN; SMP30) lentiviral vectors (LV-RGN, LV-RGN-RNAi) and the respective negative control virus infect SRA01/04 cells. Western blot and real-time quantitative polymerase chain reaction (q-PCR) analysis were used to determine RGN overexpression and knock down efficiency. We use cell counting kit-8 (CCK8) assay to measure cell viability and 5-bromodeoxyuridine (BrdU) assay to test cell proliferation. Cell cycle was measured by PI FACS assay and cell apoptosis was tested by Annexin V-APC assay through flow cytometry. We use Western blot to measure the content of caspase-3 in SRA01/04. RESULTS: We used PCR and Western blot techniques to determine the successful transfection of SMP30 OE and KD SRA01/04 cell lines. By CCK8, Brdu and PI FACS cell cycle assay, it was found that the SMP30 OE group promoted cell proliferation (P<0.05) compared with the control group, and the KD group inhibited cell proliferation (P<0.05). The results of Annexin V-APC signal staining detection indicated that compared with respective control group, the cell apoptosis rate was higher in KD group (P<0.05) but lower in OE group (P<0.01). The expression of caspase-3 was down-regulated in OE group through Western blot assay and up-regulated in KD group compared with respective control group. CONCLUSION: Proliferation of SRA01/04 was promoted by SMP30 OE and apoptosis was suppressed. Increasing the expression of SMP30 may protect HLEC SRA01/04 against apoptosis in cataract.

Mesenchymal stem cells-derived exosomes ameliorate blue light stimulation in retinal pigment epithelium cells and retinal laser injury by VEGF-dependent mechanism

2018/4/10 0:00:00
AIM: To observe the effect of exosomes derived from human umbilical cord blood mesenchymal stem cells (hUCMSCs) on the expression of vascular endothelial growth factor-A (VEGF-A) in blue light injured human retinal pigment epithelial (RPE) cells and laser-induced choroidal neovascularization (CNV) in rats. METHODS: Exosomes were isolated from hUCMSCs and characterized by transmission electron microscope and Western blot. MSCs-derived exosomes were cultured with RPE cells exposed to blue light. The mRNA and protein expression of VEGF-A were determined by real time-polymerase chain reaction (PCR) and Western blot, respectively. Immunofluorescence assay was used for the detection of the expression level of VEGF-A. We injected different doses of MSCs-derived exosomes intravitreally to observe and compare their effects in a mouse model of laser-induced retinal injury. The histological structure of CNV in rats was inspected by hematoxylin-eosin (HE) staining and fundus fluorescein angiography. The expression of VEGF-A was detected by immunohistochemistry. RESULTS: Exosomes exhibited the typical characteristic morphology (cup-shaped) and size (diameter between 50 and 150 nm). The exosomes marker, CD63, and hUCMSCs marker, CD90, showed a robust presence. In vitro, MSCs-derived exosomes downregulated the mRNA(Exo-L: t=6.485, 7.959, 9.286; Exo-M: t=7.517, 10.170, 13.413; Exo-H: t=10.317, 12.234, 14.592, P<0.05) and protein (Exo-L: t=2.945, 4.477, 6.657; Exo-M: t=4.713, 6.421, 8.836; Exo-H: t=6.539, 12.194, 12.783; P<0.05) expression of VEGF-A in RPE cells after blue light stimulation. In vivo, we found that the MSCs-derived exosomes reduced damage, distinctly downregulated VEGF-A (Exo-H: t=0.957, 1.382; P<0.05), and gradually improved the histological structures of CNV for a better visual function (Exo-L: 0.346, Exo-M: 3.382, Exo-H: 8.571; P<0.05). CONCLUSION: MSCs-derived exosomes ameliorate blue light stimulation in RPE cells and laser-induced retinal injury via downregulation of VEGF-A.

Autophagy activation and the mechanism of retinal microvascular endothelial cells in hypoxia

Rong Li, Li-Zhao Wang, Jun-Hui Du, Lei Zhao and Yang Yao — 2018/4/10 0:00:00
AIM: To explore the state of autophagy and related mechanisms in the murine retinal microvascular endothelial cells (RMECs) under hypoxia stimulation. METHODS: The murine RMECs were primarily cultured and randomly divided into three groups: hypoxia group (cultured in 1% O2 environment), hypoxia+autophagy inhibition group [pretreated with 5 mmol/L 3-methyladenine (3-MA) for 4h followed by incubation in 1% O2] and control group (cultured under normoxic condition). The state of autophagy in RMECs was examined by assaying the turnover of light chain 3B (LC3BB) and expression of Beclin-1, Atg3 and Atg5 proteins with Western blotting, by detecting formation of autophagosomes with transmission electron microscopy (TEM) and by counting the number of GFP+ puncta in RMECs. The protein levels of AMPK, P-AMPK, Akt, P-Akt, m-TOR and P-mTOR were also assayed by Western blotting. RESULTS: Primary murine RMECs were successfully cultured. Under hypoxic conditions, the ratio of LC3BB-II/I and the expression of Beclin-1, Atg3 and Atg5 proteins were increased when compared with the control group. In addition, the numbers of autophagosome and the GFP+ puncta were also increased under hypoxia. However, pre-treatment with 3-MA obviously attenuated these changes in autophagy in RMECs under hypoxia. Protein expression of P-Akt and P-AMPK was increased but P-mTOR level was decreased in cells exposed to hypoxia. CONCLUSION: In murine RMECs autophagy is activated under hypoxia possibly through activation of the AMPK/mTOR signaling pathway.

Comparison of the effects of intravitreal bevacizumab and dexamethasone in experimental posterior penetrating eye injury

Ayse Oner, Nisa Kahraman, Saim Ozdamar and Esra Balcioglu — 2018/4/10 0:00:00
AIM: To compare the effects of intravitreal anti-vascular endothelial growth factor (VEGF) and dexamethasone in an experimental rabbit model of posterior penetrating ocular injury. METHODS: Thirty white New Zealand rabbits were included in the study. A posterior penetrating ocular injury was performed at the superotemporal quadrant. They were randomly divided into three groups. The rabbits in group 1 received intravitreal dexamethasone, in group 2 they received intravitreal bevacizumab and those in group 3 received intravitreal physiological saline solution in both eyes. All eyes were examined ophthalmologically on the 1st, 3rd, 7th, 14th and 28th days following the injury and the clinical findings were scored. On the day 28, the eyes were enucleated, evaluated and scored macroscopically, histopathologically and scanning electron microscopically. RESULTS: The median clinical score on the 14th and 28th days and the median macroscopic score of the dexamethasone group was significantly better than that of control (P=0.004, 0.018). Dexamethasone group was also better than that of bevacizumab group but the differences did not reach statistical significance. Retinal detachment rate was 8.3%, 16.6% and 12.5% in the dexamethasone group, bevacizumab group and control group, respectively (P=0.476). More extensive fibrocelluler proliferations were observed in controls compared with dexamethasone and bevacizumab groups. But these differences did not reach the statistical significance (P=0.538). In scanning electron microscopy all groups showed fibreous stalk and dense collagen fibrils in vitreous. CONCLUSION: This study shows that intravitreal injection of both dexamethasone and bevacizumab may reduce the intraocular fibrous proliferation after an experimental posterior penetrating ocular injury in rabbits.

Comparison of three fluorescence labeling and tracking methods of endothelial progenitor cells in laser-injured retina

2018/4/10 0:00:00
AIM: To compare three kinds of fluorescent probes for in vitro labeling and in vivo tracking of endothelial progenitor cells (EPCs) in a mouse model of laser-induced retinal injury. METHODS: EPCs were isolated from human umbilical cord blood mononuclear cells and labeled with three different fluorescent probes: 5-(and-6)-carboxyfluorescein diacetate succinimidyl ester (CFSE), 1,1′-dilinoleyl-3,3,3′,3′-tetramethylindo-carbocyanine perchlorate linked acetylated low-density lipoprotein (DiI-AcLDL), and green fluorescent protein (GFP). The fluorescent intensity of EPCs was examined by confocal microscopy. Survival rate of labeled EPCs was calculated with trypan blue staining, and their adhesive capability was assessed. A mouse model of retinal injury was induced by laser, and EPCs were injected into the vitreous cavity. Frozen section and fluorescein angiography on flat-mounted retinal samples was employed to track the labeled EPCs in vivo. RESULTS: EPCs labeled with CFSE and DiI-AcLDL exhibited an intense green and red fluorescence at the beginning; the fluorescence intensity decreased gradually to 20.23% and 49.99% respectively, after 28d. On the contrary, the florescent intensity of GFP-labeled EPCs increased in a time-dependent manner. All labeled EPCs showed normal morphology and no significant change in survival and adhesive capability. In the mouse model, transplantation of EPCs showed a protective effect against retinal injury. EPCs labeled with CFSE and DiI-AcLDL were successfully tracked in mice during the development of retinal injury and repair; however, GFP-labeled EPCs were not detected in the laser-injured mouse retina. CONCLUSION: The three fluorescent markers used in this study have their own set of advantages and disadvantages. CFSE and DiI-AcLDL are suitable for short-term EPC-labeling, while GFP should be used for long-term labeling. The choice of fluorescent markers should be guided by the purpose of the study.

miR-211 regulates the antioxidant function of lens epithelial cells affected by age-related cataracts

2018/3/13 0:00:00
AIM: To investigate the effects and mechanism of miR-211 in mediating the antioxidant function of lens epithelial cells affected by age-related cataracts. METHODS: Real-time quantitative polymerase chain reaction (RT-qPCR) was used to detect miR-211 expression in the anterior lens capsules of healthy people, the anterior lens capsules of patients with age-related cataracts, and human epithelial cell line (SRA01/04) cells exposed to oxidative stress. A 2', 7'-dichloro-fluorescein diacetate (DCFH-DA) probe was used to measure the levels of endogenous reactive oxygen species (ROS) in human lens epithelial cells (hLECs) exposed to 400 μmol/L H2O2 for 1h. SRA01/04 cells were transfected with either miR-211 mimics, mimic controls, miR-211 inhibitors or inhibitor controls. After 72h, these cells were exposed to 400 μmol/L H2O2 for 1h, then p53 and Bax mRNA expression were measured using RT-qPCR. p53 and Bax protein expression were also measured by Western blotting analysis. Finally, cell viability was assessed using an MTS assay. RESULTS: Compared to the control group, expression of miR-211 in the anterior lens capsules of age-related cataract patients and in SRA01/04 cells exposed to oxidative stress was significantly increased (P<0.001). Levels of endogenous ROS were significantly elevated in hLECs exposed to oxidative stress (P<0.001). Compared to the mimic control group, the hLECs in the miR-211 mimic group expressed significantly higher levels of p53 and Bax mRNA and protein while cell viability was significantly reduced (P<0.001). Conversely, p53 and Bax mRNA and protein expression were significantly reduced in the miR-211 inhibitor group as compared to the control group, while the cells in this group had much higher levels of cell viability (P<0.001). CONCLUSION: miR-211 is upregulated in the anterior lens capsules of age-related cataract patients. miR-211 decreased the antioxidative stress capacity of lens epithelial cells by upregulating p53 and Bax, while inhibiting cell proliferation and repair. This finding suggests that miR-211 may play a key role in the development of age-related cataracts.

Scleral ultrastructure and biomechanical changes in rabbits after negative lens application

2018/3/13 0:00:00
AIM: To address the microstructure and biomechanical changes of the sclera of rabbits after negative lens application by spectacle frame apparatus. METHODS: Five New Zealand rabbits of seven weeks post-natal were treated with -8 D lens monocularly over the course of two weeks. Refractive errors and axial length (AXL) were measured at the 1st, 7th and 14th days of the induction period. Ultrastructure of sclera was determined with electron microscopy. Biomechanical properties were tested by an Instron 5565 universal testing machine. RESULTS: Lens-induced (LI) eyes elongated more rapidly compared with fellow eyes with AXL values of 15.56±0.14 and 15.21±0.14 mm (P<0.01). Fibril diameter was significantly smaller in the LI eyes compared with control ones in the inner, middle, and outer layers (inner layer, 63.533 vs 76.467 nm; middle layer, 92.647 vs 123.984 nm; outer layer, 86.999 vs 134.257 nm, P<0.01, respectively). In comparison with control eyes, macrophage-like cells that engulfed fibroblasts, dilated endoplasmic reticulum, and vacuoles in fibroblasts were observed in the inner and middle stroma in the LI eyes. Ultimate stress and Young’s modulus were lower in the LI eyes compared with those in the control eyes. CONCLUSION: Negative lens application alters eye growth, and results in axial elongation with changes in scleral ultrastructural and mechanical properties.

Protective effects of a composition of Chinese herbs-Gurigumu-13 on retinal ganglion cell apoptosis in DBA/2J glaucoma mouse model

Qiu-Li Zhang, Wei Wang, Yan Jiang, Tian-Zi Zhang, Zhan-Jun Lu and Ao Jiang — 2018/3/13 0:00:00
AIM: To explore the concrete mechanism of a Mongolian compound medicine-Gurigumu-13 (GRGM) for glaucoma treatment. METHODS: DBA/2J mice, as glaucoma models, were intragastric administrated with GRGM to study the effect of GRGM on retinal ganglion cells (RGCs). The loss of RGCs was evaluated with the number of RGCs and axons. The expression of the target protein of RGCs or mouse retinas was determined by Western blot. The relative content of malondialdehyde (MDA) was examined by ELISA assay. RESULTS: GRGM distinctly improved retina damage via increasing the number of neurons, RGCs and axons in a concentration dependent manner. Meanwhile, GRGM obviously decreased the high level of MDA and the expression of oxidative stress-related proteins in retinas of DBA/2J mice, but promoted the expression of antioxidant proteins. Additionally, GRGM also significantly inhibited the protein expression of Bip and Chop, which were markers of endoplasmic reticulum stress-induced apoptosis. CONCLUSION: GRGM have obvious protective effects on RGCs in DBA/2J mice, and increase the number of RGCs and axons via inhibiting oxidative stress and endoplasmic reticulum stress.

A recurrent G367R mutation in MYOC associated with juvenile open angle glaucoma in a large Chinese family

Yi-Hua Yao, Ya-Qin Wang, Wei-Fang Fang, Liu Zhang, Ju-Hua Yang and Yi-Hua Zhu — 2018/3/13 0:00:00
AIM: To identify the mutations of MYOC, OPTN, CYP1B1 and WDR36 in a large Chinese family affected by juvenile open angle glaucoma (JOAG). METHODS: Of 114 members of one family were recruited in this study. Blood samples from twelve members of this pedigree were collected for further research. As a control, 100 unrelated subjects were recruited from the same hospital. The exon and flanking intron sequences of candidate genes were amplified using the polymerase chain reaction and direct DNA sequencing. RESULTS: The proband (III:10) was a seventy-three years old woman with binocular JOAG at the age of 31. A recurrent heterozygous mutation (c.1099G>A) of MYOC was identified in the three JOAG patients and another suspect. This transition was located in the first base pair of codon 367 (GGA>AGA) in exon 3 of MYOC and was predicted to be a missense substitution of glycine to arginine (p.G367R) in myocilin. Mutations in OPTN, CYP1B1 or WDR36 were not detected in this study. The G367R mutation was not present in unaffected family members or in 100 ethnically matched controls. Other variants of the coding regions of candidate genes were not detected in all participants. To date, this family was the largest to have been identified as carrying a certain MYOC mutation in China, further evidence of a founder effect for the G367R MYOC mutant was provided by our data. CONCLUSION: A MYOC c.1099G>A mutation in an autosomal dominant JOAG family is identified and the characteristic phenotypes among the patients are summarized. Genetic testing could be utilized in high-risk populations and be helpful not only for genetic counseling, but also for early diagnosis and treatment of affected patients or carriers of inherited JOAG.

Mechanism of retinal pericyte migration through Angiopoietin/Tie-2 signaling pathway on diabetic rats

2018/3/13 0:00:00
AIM: To investigate the mechanism of pericyte migration through Angiopoietin-2 (Ang-2)/Tie-2 signaling pathway. METHODS: We divided the rats into 5 groups. Each diabetic rat model groups injected with Tie-2 inhibitor, ERK1/2 inhibitor, Akt/PKB inhibitor, and DMSO intravitreal. Retinal digest preparation was done to examine the retinal vasculature including pericyte: endothelial ratio, and morphology of pericyte migration. Tie-2, ERK1/2 and Akt/PKB phosporylation were analyzed by confocal laser scanning microscopy. RESULTS: There was a correlation between pericyte migration with increasing Ang-2 (P<0.05). Pericyte number reduced by 40% (1:2.4) after 5wk diabetes on diabetic rats. The pericyte: endothelial ratio on group with Tie-2 inhibitor were 1:1.8. The same result shows on group with Akt/PKB inhibition. ERK1/2 inhibitor group shows the best results of pericyte: endothelial ratio (1:1.7). Inhibition on Tie-2 receptor decreased the phosphorylation activity of Tie-2, ERK1/2 and Akt/PKB pathway. ERK1/2 inhibition also decreasing the phosphorylation of Tie-2 and Akt/PKB. But on Akt/PKB inhibition, the phosphorylation of Tie-2 and ERK1/2 were relative the same. CONCLUSION: Ang-2 has a role for pericyte migration on diabetic rats through Tie-2 receptor, ERK1/2 and Akt/PKB pathways. ERK1/2 is a dominant pathway based on the ability to supress another pathway activity and decreasing pericyte migration on diabetic rats.

Is Marcus Gunn jaw winking a primitive reflex? Rat neuroanatomy

2018/3/13 0:00:00
AIM: To investigate a possible trigeminal proprioceptive-oculomotor neural pathway and explore possible synaptic connections between neurons in this pathway. Attempt to bring a new insight to mechanism of Marcus Gunn syndrome (MGS). METHODS: Anterograde and retrograde tract tracing was applied and combined with immunofluorescent stain in rats. After electrophysiological identifying mesencephalic trigeminal nucleus (Vme) neurons, intracellular injection of tracer was performed to trace axon trajectory. RESULTS: Following injections of anterograde tracers into the Vme, labeled terminals were observed ipsilateral in oculomotor and trochlear nuclei (III/IV), as well as in their premotor neurons in interstitial nucleus of Cajal and Darkschewitsch nucleus (INC/DN). Combining with choline acetyltransferase (ChAT) immunofluorescent stain, it showed that Vme projecting terminals contact upon ChAT positive III/IV motoneurons under confocal microscope. By retrograde labeling premotor neurons of the III, it showed that Vme neuronal terminals contact with retrogradely labeled pre-oculomotor neurons in the INC/DN. Axons of intracellularly labeled Vme neurons that respond to electric stimuli of the masseter nerve traveled into the ipsilateral III. CONCLUSION: There may exist a trigeminal proprioceptive- oculomotor system neural circuit in the rat, which is probably related to vertical-torsional eye movements. Possible association of this pathway with MGS etiology was discussed.

Role of vasoactive intestinal peptide in Aspergillus fumigatus-infected cornea

2018/2/6 0:00:00
AIM: To investigate the anti-inflammatory role of vasoactive intestinal peptide (VIP) in Aspergillus fumigatus (A. fumigatus) ketatitis. METHODS: Expression of VIP was tested by polymerase chain reaction (PCR) in C57BL/6 and BALB/c normal and A. fumigatus infected corneas. C57BL/6 mice were pretreated with recombinant (r) VIP, while BALB/c mice were pretreated with VIP antagonist, and then infected with A. fumigatus. Clinical score was recorded. Expression of pro- and anti-inflammatory cytokines, toll-like receptor 4 (TLR4), lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1), and neutrophil infiltration were tested by PCR, enzyme-linked immunosorbent assay (ELISA), and myeloperoxidase (MPO) assay. RESULTS: VIP mRNA expression in BALB/c cornea was higher than C57BL/6 cornea at 1 and 3d post infection (p.i.). rVIP treatment of C57BL/6 mice showed alleviated disease and down-regulated expression of interleukin-1β (IL-1β) and tumor necrosis factor-α (TNF-α), while IL-10 expression was up-regulated. Neutrophil infiltration and TLR4, IL-17 expression were decreased after rVIP treatment, while LOX-1 expression was up-regulated in C57BL/6. VIP antagonist pretreatment showed increased disease and higher IL-1β, TNF-α, TLR4, IL-17 and MPO levels, while IL-10 and LOX-1 levels were down-regulated in BALB/c mice. CONCLUSION: rVIP alleviate disease response of C57BL/6 mice. VIP antagonist resulted in worsened disease of BALB/c mice. VIP proposed anti-inflammatory role in A. fumigatus keratitis.

Anti-fibrotic effect of rosmarinic acid on inhibition of pterygium epithelial cells

2018/2/6 0:00:00
AIM: To investigate the anti-fibrosis effect of rosmarinic acid (RA) in pterygium epithelial cells (PECs) to determine if RA is a potent agent for treating pterygium. METHODS: The PECs (1×104 cells/mL) were treated with 100 μmol/L of RA for 1, 3 and 6h. After RA treatment, the cell viability was determined by staining with acridine orange/DAPI and analysis via a NucleoCounter NC-3000. The protein expression levels of type I collagen, transforming growth factor beta-1 (TGF-β1), TGF-β type II receptor (TGF-βRII), p-Smad1/5, p-Smad2, p-Smad3, and Smad4 of the cell lysates were measured by Western blot analysis. RESULTS: The cell viability of PECs was significantly decreased after RA treatment (P<0.01). As the result, RA reduced the protein expression of type I collagen and TGF-β1 of PECs. Additionally, RA also inhibited TGF-β1/Smad signaling by decreasing the protein expressions of TGF-βRII, p-Smad1/5, p-Smad2, p-Smad3, and Smad4. CONCLUSION: This study demonstrate that RA could inhibit fibrosis of PECs by down-regulating type I collagen expression and TGF-β1/Smad signaling. Therefore, RA is a potent therapeutic agent for the treatment of pterygium.

Age-related pro-inflammatory and pro-angiogenic changes in human aqueous humor

Yan Zheng, Yu-Qing Rao, Jia-Kai Li, Yue Huang, Peiquan Zhao and Jing Li — 2018/2/6 0:00:00
AIM: To reveal age-related aqueous cytokine changes in human aqueous humor. METHODS: Aqueous humor was collected from 12 young children (3-6.5 years old) and 71 healthy adults (22-106 years old) with cataract but without other systemic or ocular disorders. Levels of 22 cytokines, chemokines and vascular endothelial growth factor (VEGF) were measured and analyzed. RESULTS: The following proteins showed significant increase from childhood to adult: interferon-gamma (IFN-γ), interleukin (IL)-13, IL-6, IL-12(p70), IL-10, CCL2, CCL3, CCL4, CXCL8, CXCL9, CXCL10, IFN-α2 and VEGF (all P<0.05). IFN-γ, IL-13, IL-12(p70), IL-10, CCL3, CXCL9 and VEGF also showed moderate strength age-related increase in the adult group (r>0.5). The strength of correlation between aging and CCL4 were fair (r=0.398). The concentrations of IL-2, IL-4, IL-5, IL-1β and TNF-α were low in both groups. CONCLUSION: From childhood to adult, the immunological milieu of the anterior chamber become more pro-inflammatory and pro-angiogenic. Such changes may represent the parainflammation state of the human eye.

miR-211 promotes lens epithelial cells apoptosis by targeting silent mating-type information regulation 2 homolog 1 in age-related cataracts

2018/2/6 0:00:00
AIM: To detect the expression of miR-211 in age-related cataract tissue, explore the effects of miR-211 on lens epithelial cell proliferation and apoptosis, and identify its target gene. METHODS: This study used real-time quantitative polymerase chain reaction (RT-qPCR) to measure the expression of miR-211 and its predicted target gene [silent mating-type information regulation 2 homolog 1 (SIRT1)] in 46 anterior lens capsules collected from age-related cataract patients. Human lens epithelial cell line (SRA01/04) cells were transfected with either miR-211 mimics, mimic controls, miR-211 inhibitors or inhibitor controls, 72h after transfection, miRNA and protein expression of SIRT1 were measured using RT-qPCR and Western blotting; then cells were exposed to 200 μmol/L H2O2 for 1h, whereupon cell viability was measured by MTS assay, caspase-3 assay was performed. Dual luciferase reporter assay was performed to verify the relationship between miR-211 of SIRT1. RESULTS: Compared to the control group, expression of miR-211 was significantly increased (P<0.001), the miRNA and protein expression of SIRT1 were significantly decreased (P<0.001) in the anterior lens capsules of patients with age-related cataracts. Relative to the control group, SIRT1 miRNA and protein levels in the miR-211 mimic group were significantly reduced, cell proliferation activity significantly decreased, and caspase-3 activity was significantly increased (P<0.001). In the miR-211 inhibitor group, SIRT1 miRNA and protein expression were significantly increased, cell proliferation activity significantly increased, and caspase-3 activity was significantly decreased (P<0.001). A dual luciferase reporter assay confirmed that SIRT1 is a direct target of miR-211. CONCLUSION: miR-211 is highly expressed in the anterior lens capsules of patients with age-related cataracts. By negatively regulating the expression of SIRT1, miR-211 promotes lens epithelial cell apoptosis and inhibits lens epithelial cell proliferation.

Effect of the Notch signaling pathway on retinal ganglion cells and its neuroprotection in rats with acute ocular hypertension

Lei Li, Li-Ping Chen and Qing-Huai Liu — 2018/2/6 0:00:00
AIM: To explore the effect of the Notch signaling pathway on retinal ganglion cells (RGCs) and optic nerve in rats with acute ocular hypertension (OH). METHODS: Totally 48 Sprague-Dawley (SD) rats were included, among which 36 rats were selected to establish acute OH models. OH rats received a single intravitreal injection of 2 μL phosphate buffered solution (PBS) and another group of OH rats received a single intravitreal injection of 10 μmol/L γ-secretase inhibitor (DAPT). Quantitative real-time polymerase chain reaction (qPCR) and Western blot assay were adopted to determine the mRNA level of Notch and the protein levels of Notch, Bcl-2, Bax, caspase-3, and growth-associated protein 43 (GAP-43). The RGC apoptosis conditions were assessed by TUNEL staining. RESULTS: The OH rats and PBS-injected rats had increased expression levels of Notch1, Bax, caspase-3, and GAP-43, decreased expression levels of Bcl-2, and increased RGC apoptosis, with severer macular edema and RGCs more loosely aligned, when compared with the normal rats. The DAPT-treated rats displayed increased expression levels of Notch1, Bax, caspase-3, and GAP-43, decreased expression levels of Bcl-2, and increased RGC apoptosis, in comparison with the OH rats and PBS-injected rats. RGCs were hardly observed and macular edema became severe in the DAPT-treated rat. CONCLUSION: The Notch signaling pathway may suppress the apoptosis of retinal ganglion cells and enhances the regeneration of the damaged optic nerves in rats with acute OH.

Monocyte chemoattractant protein 1 and fractalkine play opposite roles in angiogenesis via recruitment of different macrophage subtypes

Lei Chen, Gao-Qin Liu, Hong-Ya Wu, Ji Jin, Xue Yin, Dan Li and Pei-Rong Lu — 2018/2/6 0:00:00
AIM: To explore the interaction between macrophages and chemokines [monocyte chemoattractant protein 1 (MCP-1/CCL2) and fractalkine/CX3CL1] and the effects of their interaction on neovascularization. METHODS: Human peripheral blood mononuclear cells, donated by healthy volunteers, were separated and cultured in RPMI-1640 medium containing 10% fetal bovine serum, then induced into macrophages by stimulation with 30 μg/L granulocyte macrophage-colony stimulating factor (GM-CSF). The expression of CCR2 and/or CX3CR1 in the macrophages was examined using flow cytometry. Macrophages were then stimulated with recombinant human CCL2 (rh-CCL2) or recombinant human CX3CL1 (rh-CX3CL1). The expression of angiogenesis-related genes, including VEGF-A, THBS-1 and ADAMTS-1 were examined using real-time quantitative polymerase chain reaction (PCR). Supernatants from stimulated macrophages were used in an assay of human retinal endothelial cell (HREC) proliferation. Finally, stimulated macrophages were co-cultured with HREC in a migration assay. RESULTS: The expression rate of CCR2 in macrophages stimulated by GM-CSF was 42%±1.9%. The expression rate of CX3CR1 was 71%±3.3%. Compared with vehicle-treated groups, gene expression of VEGF-A in the macrophages was greater in 150 mg/L CCL2-treated groups (P<0.05), while expression of THBS-1 and ADAMTS-1 was significantly lower (P<0.05). By contrast, compared with vehicle-treated groups, expression of VEGF-A in 150 mg/L CX3CL1-treated groups was significantly lower (P<0.05), while expression of THBS-1 and ADAMTS-1 was greater (P<0.05). Supernatants from CCL2 treated macrophages promoted proliferation of HREC (P<0.05), while supernatants from CX3CL1-treated macrophages inhibited the proliferation of HREC (P<0.05). HREC migration increased when co-cultured with CCL2-treated macrophages, but decreased with CX3CL1-treated macrophages (P<0.05). CONCLUSION: CCL2 and CX3CL1 exert different effects in regulation of macrophage in expression of angiogenesis-related factors, including VEGF-A, THBS-1 and ADAMTS-1. Our findings suggest that CCL2 and CX3CL1 may be candidate proteins for further exploration of novel targets for treatment of ocular neovascularization.

Experimental circumferential canaloplasty with a new Schlemm canal microcatheter

Mao-Song Xie, Yong-Zheng Zheng, Li-Bin Huang and Guo-Xing Xu — 2019/1/3 0:00:00
AIM: To present a new, simple, inexpensive Schlemm canal microcatheter for circumferential canaloplasty in a rabbit model. METHODS: A rabbit glaucoma animal model was established by intravitreal injection of triamcinolone acetonide. Circumferential canaloplasty with a new Schlemm canal microcatheter (patent license number: 201220029850.0) was performed. The Schlemm canal microcatheter was composed of microcatheter wall and lumen. The wall was made of high refractive index plastic optical fiber that could be attached to an illuminant so that the whole lighted microcatheter was visible during circumferential canaloplasty. The lumen could be attached to an injector for injection of viscoelastic during catheterization. Rabbits were divided randomly into the control, model and treatment groups. Intraocular pressure (IOP) was measured with a Tono-pen tonometer pre-operation and 3, 7, 14, 21 and 28d post-operation. Ultrasound biomicroscopy was performed to visualize the Schlemm canal microcatheter in the Schlemm canal and the sclera pool. RESULTS: The Schlemm canal microcatheter could be used to perform circumferential canaloplasty in the rabbit glaucoma animal model. IOP was lower in the treatment group than that in the model group 3, 7, 14 and 28d after operation. There were no significant differences in IOP between the control group and treatment group. The differences among the three groups were statistically significant (3d: F=41.985, P<0.001; 7d: F=65.696, P<0.001; 14d: F=114.599, P<0.001; 28d: F=55.006, P<0.001). CONCLUSION: Circumferential canaloplasty is safe and effective in control of experimental glaucoma model in rabbits.

Preloaded and non-preloaded intraocular lens delivery system and characteristics: human and porcine eyes trial

2018/1/9 0:00:00
AIM: To compare characteristics of preloaded and non-preloaded intraocular lens (IOL) delivery systems during IOL delivery procedures. METHODS: Total 101 human eyes were included in this prospective observational case series. Delivery characteristics of 5 types of IOLs including iSert250 NC60 (NC60), EnVista MX60 (MX60), AcrySof IQ SN60WF (SN60WF), TECNIS ZCB00 (ZCB00), and TECNIS PCB00 (PCB00) were investigated. NC60 and PCB00 were injected via preloaded delivery systems and other IOLs were injected via non-preloaded systems. In the human trial, time taken from IOL loading to completion of implantation was measured in all eyes undergoing conventional cataract surgery. Using 4 excised porcine eyes, dynamics of ophthalmic viscosurgical device (OVD) between an IOL injector and a porcine eye was analyzed using fluorescein sodium-stained OVD. RESULTS: The average time for IOL implantation was 22.0s for NC60, 43.2s for MX60, 32.3s for SN60WF, 41.4s for ZCB00, and 14.6s for PCB00 respectively. The number of cases with IOL manipulation with a second instrument was 6 for MX60, 2 for ZCB00, 0 for SN60WF, NC60, and PCB00. Amount of OVD pushed into a porcine eye was smaller with a preloaded system than with non-preloaded systems. CONCLUSION: IOL delivery with preloaded systems is faster and more predictable. Moreover, a preloaded delivery system shows relatively less OVD pushed into a porcine eye than non-preloaded systems.

Hydrogen peroxide-induced apoptosis of human lens epithelial cells is inhibited by parthenolide

2018/1/9 0:00:00
AIM: To explore the effect of parthenolide on hydrogen peroxide (H2O2)-induced apoptosis in human lens epithelial (HLE) cells. METHODS: The morphology and number of apoptotic HLE cells were assessed using light microscopy and flow cytometry. Cell viability was tested by MTS assay. In addition, the expression of related proteins was measured by Western blot assay. RESULTS: Apoptosis of HLE cells was induced by 200 μmol/L H2O2, and the viability of these cells was similar to the half maximal inhibitory concentration (IC50), as examined by MTS assay. In addition, cells were treated with either different concentrations (6.25, 12.5, 25 and 50 μmol/L) of parthenolide along with 200 μmol/L H2O2 or only 50 μmol/L parthenolide or 200 μmol/L H2O2 for 24h. Following treatment with higher concentrations of parthenolide (50 μmol/L), fewer HLE cells underwent H2O2-induced apoptosis, and cell viability was increased. Further, Western blot assay showed that the parthenolide treatment reduced the expression of caspase-3 and caspase-9, which are considered core apoptotic proteins, and decreased the levels of phosphorylated nuclear factor-κB (NF-κB), ERK1/2 [a member of the mitogen-activated protein kinase (MAPK) family], and Akt proteins in HLE cells. CONCLUSION: Parthenolide may suppress H2O2-induced apoptosis in HLE cells by interfering with NF-κB, MAPKs, and Akt signaling.

EDIL3 depletion suppress epithelial-mesenchymal transition of lens epithelial cells via transforming growth factor β pathway

2018/1/9 0:00:00
AIM: To study the effect of discoidin I-like domaincontaining protein 3 (EDIL3) depletion on the proliferation and epithelial-mesenchymal transition (EMT) in human lens epithelial cells (LECs). METHODS: RNA interference was used to inhibit the expression of EDIL3 in human LECs in vitro. The morphology of cells was observed using an inverted microscope. Cell proliferation was assessed using EdU kit. Cell migration was investigated using Transwell chamber and EMT of LECs was assessed using confocal microscope and Western blotting. The transforming growth factor β (TGFβ) pathway was investigated using Western blotting. RESULTS: The data showed that silencing EDIL3 expression changed LECs morphology and suppressed LECs proliferation (P<0.05) and migration (P<0.01). Furthermore, the result of Western blotting showed that EDIL3 depletion reduced the expression of α-smooth muscle actin (α-SMA) (P<0.001) and vimentin (P<0.01), while increased the expression of E-cadherin (P<0.001). EDIL3 depletion could suppress the phosphorylation of Smad2 (P<0.01) and Smad3 (P<0.01) and the activation of exracellular signal regulated kinase (ERK) (P<0.05). CONCLUSION: The findings indicate that EDIL3 might participate in the proliferation and EMT in LECs via TGFβ pathway and may be a potential therapeutic target for the treatment of posterior capsule opacification.

Safety threshold of intravitreal clonidine in rabbit’s eyes

2018/1/9 0:00:00
AIM: To determine the safe dose of intravitreal clonidine (IVC), a potential drug for neuroprotection and angiogenesis inhibition in rabbits. METHODS: A total of 28 rabbits were divided into four groups. Three groups received IVC with concentrations of 15 (Group A), 25 (Group B), and 50 (Group C) μg/0.1 mL and the control group (Group D) received 0.1 mL balanced salt solution (BSS). To investigate IVC safety, electroretinography (ERG) was performed at baseline, then at 1, 4 and 8wk after injection. After last ERG, all rabbits were euthanized, their eyes were enucleated and subjected to routine histopathological evaluation, immunohistochemistry for glial fibrillary acidic protein (GFAP) and terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) test. RESULTS: Based on ERG, histopathology, GFAP and TUNEL assay findings, 15 μg IVC was determined as the safe dose in rabbit eyes. While, the results of routine histopathology and TUNEL assay were unremarkable in all groups, toxic effects attributed to 25 and 50 μg IVC were demonstrated by ERG and GFAP tests. CONCLUSION: Totally 15 μg clonidine is determined as the safe dose for intravitreal injection in rabbits. Contribution of IVC in neuroprotection and inhibition of angiogenesis deserve more studies.

A novel mutation in PRPF31, causative of autosomal dominant retinitis pigmentosa, using the BGISEQ-500 sequencer

2018/1/9 0:00:00
AIM: To study the genes responsible for retinitis pigmentosa. METHODS: A total of 15 Chinese families with retinitis pigmentosa, containing 94 sporadically afflicted cases, were recruited. The targeted sequences were captured using the Target_Eye_365_V3 chip and sequenced using the BGISEQ-500 sequencer, according to the manufacturer’s instructions. Data were aligned to UCSC Genome Browser build hg19, using the Burroughs Wheeler Aligner MEM algorithm. Local realignment was performed with the Genome Analysis Toolkit (GATK v.3.3.0) IndelRealigner, and variants were called with the Genome Analysis Toolkit Haplotypecaller, without any use of imputation. Variants were filtered against a panel derived from 1000 Genomes Project, 1000G_ASN, ESP6500, ExAC and dbSNP138. In all members of Family ONE and Family TWO with available DNA samples, the genetic variant was validated using Sanger sequencing. RESULTS: A novel, pathogenic variant of retinitis pigmentosa, c.357_358delAA (p.Ser119SerfsX5) was identified in PRPF31 in 2 of 15 autosomal-dominant retinitis pigmentosa (ADRP) families, as well as in one, sporadic case. Sanger sequencing was performed upon probands, as well as upon other family members. This novel, pathogenic genotype co-segregated with retinitis pigmentosa phenotype in these two families. CONCLUSION: ADRP is a subtype of retinitis pigmentosa, defined by its genotype, which accounts for 20%-40% of the retinitis pigmentosa patients. Our study thus expands the spectrum of PRPF31 mutations known to occur in ADRP, and provides further demonstration of the applicability of the BGISEQ500 sequencer for genomics research.

IgG4 and IgE co-positive group found in idiopathic orbital inflammatory disease

2018/1/9 0:00:00
AIM: To reveal the cytokines involved in idiopathic orbital inflammatory disease (IOID) and the relationship between Th17 cells, IgE and IOID pathogenesis. METHODS: Whole blood samples were processed immediately after collection and serological IgG4, IgG, and IgE antibodies were tested using ELISA. IOID and orbital cavernous hemangioma (CH) tissue samples underwent Bio-Plex multiplex cytokine detection. Hematoxylin-Eosin (HE) staining of all paraffin samples suggested the histological features of IOIDs, and expressions of IgG4 and IL-17A in affected tissues were detected by immunohistochemistry. RESULTS: Among 40 IOID plasma samples, 52.5% (21/40) were positive for IgG4 and 25% (10/40) were positive for IgE. Overlapped IgG4 or IgE positive samples accounted for 22.5% (9/40). Therefore, IOID samples were separated into three groups. The IgE+/IgG4+ group had a relevantly lower level of pro-inflammatory cytokine expression. IL-4 (Th2 cell related), IL-10 and TGF-β1 (Treg cell immunity related) were elevated in all three groups. Some of the Th17 cell related cytokines (i.e. IL-17A/F, IL-25, IL-23, and IL-33) displayed higher expression levels in the IgE-/IgG4- group compared to the other two groups. CONCLUSION: We discovered an IgG4-IgE co-positive group as well as Th17 cell immune involvement in IgG4-IgE co-negative subgtroup in IOID for the first time. The pathogenesis of IOID could differ from different subgroups according to the IgG4 and IgE detection. Therefore, we recommend that, Treatment stratagy should be made according to the clinical assessment of IgG4-IgE and Th17 profile detection.

Serum microRNA-221 as a biomarker for diabetic retinopathy in patients associated with type 2 diabetes

2018/12/5 0:00:00
AIM: To investigate the candidate microRNA (miRNA), miR-221 as a novel biomarker for diabetic retinopathy (DR) in patients associated with type 2 diabetes (T2D). METHODS: The subjects involved were divided into four groups: healthy control (HC), no diabetic retinopathy (NDR), non-proliferative diabetic retinopathy (NPDR) and proliferative diabetic retinopathy (PDR) group. Serum miR-221 was validated by real-time quantitative reverse-transcription polymerase chain reaction (qRT-PCR). Also, serum angiotensin II (Ang II) and vascular endothelial growth factor (VEGF) were examined by enzyme-linked immunosorbent assay. In addition, receiver operating characteristic (ROC) curve was performed to explore the diagnostic accuracy of miR-221, Ang II and VEGF for DR in patients with T2D. Spearman’s rank correlation coefficient was executed to estimate the correlations of serum miR-221 with metabolic parameters and serum markers in patients with T2D. RESULTS: Primarily, serum miR-221, Ang II and VEGF were increased significantly in T2D patients compared to HC participant respectively, and progressive up-regulated in NDR, NPDR and PDR groups (P<0.001). Additionally, miR-221 in serum was remarkably positively correlated with metabolic parameters such as glycated hemoglobin (r=0.310, P=0.002) and homeostasis model assessment for insulin resistance (r=0.413, P<0.001), as well as serum markers for instance Ang II (r=0.667, P<0.001) and VEGF (r=0.499, P<0.001). Furthermore, serum miR-221 (AUC, 0.894; 95%CI, 0.833-0.955; P<0.001), Ang II (AUC, 0.888; 95%CI, 0.828-0.949; P<0.001) and VEGF (AUC, 0.785; 95%CI, 0.695-0.875; P<0.001) had evidently diagnostic efficiency in DR, and miR-221 is the most effective among them. CONCLUSION: Serum miR-221 as a potential biomarker could be related to not only occurrence but also progression for DR in patients with T2D. However, a prospective clinical trial is warranted.

In vitro adherence of conjunctival bacteria to different oculoplastic materials

2018/12/5 0:00:00
AIM: To investigate the resistance to bacterial adhesion of materials used in oculoplastic surgery, particularly materials used in the manufacture of orbital implants. METHODS: Seven organisms of conjunctival flora (two strains of Staphylococcus epidermidis and one strain each of Staphylococcus aureus, Staphylococcus hominis, Corynebacterium amycolatum, Acinetobacter calcoaceticus, and Serratia marcescens) were selected. A lactic acid bacterium (Lactobacillus rhamnosus) was also included as positive control because of its well-known adhesion ability. Eight materials used to make oculoplastic prostheses were selected (glass, steel, polytetrafluoroethylene, polymethylmethacrylate, silicone from orbital implants, commercial silicone, porous polyethylene, and semi-smooth polyethylene). Materials surfaces and biofilms developed by strains were observed by scanning electron microscopy. Kinetics of growth and adhesion of bacterial strains were determined by spectrophotometry. Each strain was incubated in contact with plates of the different materials. After growth, attached bacteria were re-suspended and colony-forming units (CFUs) were counted. The number of CFUs per square millimetre of material was statistically analyzed. RESULTS: A mature biofilm was observed in studied strains except Staphylococcus hominis, which simply produced a microcolony. Materials showed a smooth surface on the microbial scale, although steel exhibited 1.0-μm-diameter grooves. Most organisms showed significant differences in adhesion according to the material. There were also significant differences in the total number of CFUs per square millimetre from each material (P=0.044). CFU counts were significantly higher in porous polyethylene than in silicone from orbital implants (P=0.038). CONCLUSION: Silicone orbital implants can resist microbial colonization better than porous polyethylene implants.

Ocular surface heat effects on ocular hemodynamics detected by real-time measuring device

2018/12/5 0:00:00
AIM: To investigate the ocular hemodynamic effects of applying a hot compress to the eye. METHODS: The right eyes of five New Zealand white rabbits, both male and female, were hot-compressed for 18min. An independently designed novel ocular contact-type temperature measuring device was used to measure the ocular surface temperature before and after the heating. Relevant retrobulbar hemodynamic parameters such as peak systolic velocity (PSV), end diastolic velocity (EDV), and resistance index (RI) of each of the central retinal artery (CRA), long posterior ciliary artery (LPCA), and ophthalmic artery (OA), as well as the mean velocity (Vm) of the central retinal vein (CRV), were measured using a color Doppler flow imaging (CDFI) technique and expressed as mean values with standard deviation (mean±SD). A statistical analysis was conducted based on a paired t-test and the Wilcoxon signed-rank test. RESULTS: The employed real-time temperature measuring device was able to accurately measure ocular surface temperature during the hot-compress process. The temperature increased after the hot compress was applied. Analysis showed that the PSV and EDV values of the CRA and LPCA significantly increased after the application of the hot compress, as did the Vm of the CRV. There were no significant changes in the EDV of the OA nor the RI of each artery. CONCLUSION: This experiment, which is the first of its kind, confirms that the retrobulbar blood flow velocities can increase upon heating the ocular surface. This simple method may be useful in the future.

The effect on wound healing of pazopanib and bevacizumab compared with corticosteroid in experimental glaucoma filtration surgery

Sabiha Gungor Kobat, Fatma Ulku Celiker, Adile Ferda Dagli and Kader Kasar — 2018/12/5 0:00:00
AIM: To compare the effects of bevacizumab and pazopanib with corticosteroids on wound healing after trabeculectomy. METHODS: In the study, 35 New Zealand white rabbits were randomly divided into five groups. Apart from the first group, limbus-based trabeculectomy was performed for the eyes of rabbits. No postoperative treatment was administered for group I. Topically administered saline, prednisolone acetate (1%), bevacizumab 5 mg/mL, pazopanib 5 mg/mL for group II, III, IV and V respectively were applied for groups 6h daily for 28d. On day 28 of the experiment, eyes were enucleated and histologically and immunohistochemically analyzed. RESULTS: The fibroblast counts of groups IV and V were determined to be lower than those of groups II and III (P<0.05). In the mononuclear cell (MNC) count evaluation, no statistically significant difference was determined between the treatment groups (P>0.05). The immunohistochemical staining intensity of fibroblast growth factor β (FGF-β) and vascular endothelial growth factor (VEGF) was determined to be lower in groups IV and V than in groups II and III (P<0.05). No statistically significant difference was determined between groups IV and V in respect of fibroblast count, MNC count, FGF-β and VEGF staining intensity (P>0.05). The platelet derived growth factor β (PDGF-β) intensity was lower in group V than in groups II, III and IV (P<0.05). While the PDGF-β staining intensity was significantly lower in group IV than in group II, the difference compared with group III was not statistically significant (P>0.05). CONCLUSION: Bevacizumab and pazopanib might be good alternatives of corticosteroid treatment on delaying wound healing in glaucoma surgery.

Recombination and identification of human alpha B-crystallin

Rui Wang, Ze-Hua Chen, Yi Wang, Hou-Bin Huang, Si-Jun Fan and Lan-Lan Chen — 2018/12/5 0:00:00
AIM: To recombine the human alpha B-crystallin (αB-crystallin) using gene cloning technology and prokaryotic expression vector and confirm the biological activity of recombinant human αB-crystallin. METHODS: Cloning the human αB-crystallin cDNA according to the nucleotide sequence of the human αB-crystallin, constructing the pET-28/CRYAB prokaryotic expression plasmid by restriction enzyme digestion method, and stably expressing transformed into the Escherichia coli (E. coli) DH5 alpha. The recombinant human αB-crystallin was purified by Q sepharose. By enzyme digestion analysis, Western blotting and sequencing, the recombinant human αB-crystallin was identified and the activity of its molecular protein was detected. RESULTS: Compared with the gene bank (GeneBank), the cloned human sequence of human αB-crystallin cDNA has the same open reading frame. Identification and sequencing of the cloned human αB-crystallin cDNA in prokaryotic expression vector confirmed the full length sequence, and the vector was constructed successfully. The E. coli containing plasmid pET-28/CRYAB induced by isopropyl-β-D-thiogalactoside successfully expressed the human αB-crystallin. Insulin confirmed that the recombinant human αB-crystallin has a molecular chaperone activity. CONCLUSION: The prokaryotic expression vector pET-28/CRYAB of recombinant human αB-crystallin is successfully constructed, and the recombinant human αB-crystallin with molecular chaperone activity is obtained, which lay a foundation for the research and application of the recombinant human αB-crystallin and its chaperone activity.

Increased succinate receptor GPR91 involved in the pathogenesis of Mooren’s ulcer

Lin Li, Yan-Ling Dong, Ting Liu, Dan Luo, Chao Wei and Wei-Yun Shi — 2018/11/7 0:00:00
AIM: To investigate the expression of succinate receptor GPR91 and its pathogenic roles in Mooren’s ulcer (MU). METHODS: Biopsy specimens were obtained from 7 patients with MU and 6 healthy donors. The expression of GPR91 in MU tissues was evaluated using quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) and immunohistochemistry (IHC). Succinate was used to activate GPR91 signaling, and the effect of GPR91 on the expression of interleukin-1β (IL-1β), NLRP3, vascular endothelial growth factor (VEGF) and matrix metalloproteinase-13 (MMP-13) in human peripheral blood mononuclear cells (PBMCs) was determined. The influence of GPR91 on the nuclear factor-κB (NF-κB) signaling in PBMCs was investigated by detecting the phosphorylation of p65. Moreover, the expression of IL-1β, VEGF, MMP-13 and phosphorylated p65 (p-p65) in the tissues of MU was examined by qRT-PCR or IHC. RESULTS: GPR91 mRNA expression showed a higher level in the MU group than in the healthy control group. IHC analysis also revealed that the expression of GPR91 was elevated in patients with MU compared with healthy controls. Moreover, ligation of GPR91 with succinate promoted the lipopolysaccharide-induced production of NLRP3, IL-1β, VEGF and MMP-13 in PBMCs through increased phosphorylation of p65. Pharmacological inhibition of the NF-κB signaling reversed GPR91 induced production of NLRP3, IL-1β, VEGF and MMP-13. These findings, coupled with the elevated amounts of IL-1β, VEGF, MMP-13 and p-p65 observed in the MU biopsies, constituted a rational basis for the involvement of GPR91 in the pathogenesis of MU. CONCLUSION: This study indicates the increased succinate receptor GPR91 in conjunctival or corneal tissues is involved in the pathogenesis of MU through elevated NF-κB activity, which may provide a new therapeutic target for MU.

Experimental study on the biocompatibility of keratoprosthesis with improved titanium implant

Li Li, Hua Jiang, Li-Qiang Wang and Yi-Fei Huang — 2018/11/7 0:00:00
AIM: To investigate whether hydroxyapatite (HAp) coating can improve keratoprosthesis (KPro) implant biointegration, ultimately to decrease the risk of implant-associated complications. METHODS: The modified titanium implant was designed and prepared for artificial cornea. The titanium implant was treated with sandblasting and hydroxyapatite coating by acid-base two-step method. Surface was analyzed by scanning electron microscopy (SEM), KPro implants coated with HAp and KPro implant sandblasted were implanted in rabbits. Tissue adhesion to the implant was assessed and compared to an unmodified implant by histopathology (HE), transmission electron microscopy (TEM) and SEM. RESULTS: SEM demonstrated successful deposition of HAp on titanium implant sandblasted (HA/SB-Ti). The hydroxyapatite coatings caused enhancement of keratocyte proliferation compared with unmodified implant surfaces. HAp coating significantly increased adhesion forces. HAp coating of implants reduced the inflammatory response around the KPro implants in vivo. CONCLUSION: HAp-coated surfaces for use in titanium KPro implant greatly enhanced adherence of the titanium KPro implant in the rabbit cornea.

Exploration of the glutamate-mediated retinal excitotoxic damage: a rat model of retinal neurodegeneration

2018/11/7 0:00:00
AIM: To explore the more suitable concentration of glutamate or N-methyl-D-aspartic acid (NMDA) for intravitreal injection to establish a rat model of retinal neurodegeneration. METHODS: We injected different doses of glutamate (20 or 50 nmol) or NMDA (40 nmol) into the vitreous chambers of rats, then measured the concentration of glutamate and retinal thickness, quantified apoptotic cells and determined the degree of tau hyperphosphorylation at different time points. T-test was used for comparison of two groups. One-way ANOVA and Turkey's multiple comparisons test were used for comparisons of different groups, and P values below 0.05 were considered statistically significant. RESULTS: The glutamate level in the rats treated with 50 nmol of glutamate was twice that of the control group and persisted two weeks. Seven days after intravitreal injection of 50 nmol of glutamate, three parameters [inner retinal thickness (IRT), retinal thickness (RT) and ganglion cell layer (GCL) cell number] were reduced significantly. Furthermore, numerous TUNEL-positive cells were observed in the GCL one day after intravitreal injection of 50 nmol of glutamate, the expression of the apoptosis-related factor cleaved casepase-3 was markedly increased compared with the expression levels in the other treatment groups, and the expression levels of tau s396 and tau s404 were significantly increased compared with those in the control group. CONCLUSION: This study demonstrates that the intravitreal injection of 50 nmol of glutamate can establish the more effective retinal neurodegeneration animal model relative to other treatment groups.

Effect of green flickering light on myopia development and expression of M1 muscarinic acetylcholine receptor in guinea pigs

Yuan Tao, Xiao-Li Li, Li-Yuan Sun, Yu-Hua Wei, Xiao-Ting Yu and Hong Wang — 2018/11/7 0:00:00
AIM: To investigate the effects of green flickering light on refractive development and expression of muscarinic acetylcholine receptor (mAChR) M1 in the eyes of guinea pigs. METHODS: Thirty guinea pigs (15-20 days old) were randomly divided into three groups (n=10/group). Animals in group I were raised in a completely closed carton with green flickering light illumination. Those in group II were kept in the open top closed carton under normal natural light. Guinea pigs were raised in a sight-widen cage under normal natural light in group III. The refractive status and axial length were measured before and after 8 weeks' illumination. Moreover, total RNA extracted from retinal, choroidal, and scleral tissues were determined by real-time reverse transcription polymerase chain reaction (RT-PCR). The expressions of the receptor M1 were also explored in the retina, choroid, and sclera using immunohistochemistry. RESULTS: There was a remarkable reduction in refractive error and increase in axial length after 8-weeks' green flickering light stimulation (P<0.001). The expression of M1 receptor mRNA in sclera and retina in myopia group were remarkably lower than that in group II and III (P<0.01). Significant reduced expression of M1 receptor stimulated by green flickering light in retina and sclera tissues were also observed (P<0.05). However, there was no M1 receptor expression in choroid in 3 groups. CONCLUSION: Myopia can be induced by 8 weeks' green flickering light exposure in the animal model. M1 receptor may be involved causally or protectively in myopia development.

Novel mutations in CRYBB1/CRYBB2 identified by targeted exome sequencing in Chinese families with congenital cataract

Peng Chen, Hao Chen, Xiao-Jing Pan, Su-Zhen Tang, Yu-Jun Xia and Hui Zhang — 2018/9/4 0:00:00
AIM: To summarize the phenotypes and identify the underlying genetic cause of the CRYBB1 and CRYBB2 gene responsible for congenital cataract in two Chinese families. METHODS: Detailed family histories and clinical data were collected from patients during an ophthalmologic examination. Of 523 inheritable genetic vision system-related genes were captured and sequenced by targeted next-generation sequencing, and the results were confirmed by Sanger sequencing. The possible functional impacts of an amino acid substitution were performed with PolyPhen-2 and SIFT predictions. RESULTS: The patients in the two families were affected with congenital cataract. Sixty-five (FAMILY-1) and sixty-two (FAMILY-2) single-nucleotide polymorphisms and indels were selected by recommended filtering criteria. Segregation was then analyzed by applying Sanger sequencing with the family members. A heterozygous CRYBB1 mutation in exon 4 (c.347T>C, p.L116P) was identified in sixteen patients in FAMILY-1. A heterozygous CRYBB2 mutation in exon 5 (c.355G>A, p.G119R) was identified in three patients in FAMILY-2. Each mutation co-segregated with the affected individuals and did not exist in unaffected family members and 200 unrelated normal controls. The mutation was predicted to be highly conservative and to be deleterious by both PolyPhen-2 and SIFT. CONCLUSION: The CRYBB1 mutation (c.347T>C) and CRYBB2 mutation (c.355G>A) are novel in patients with congenital cataract. We summarize the variable phenotypes among the patients, which expanded the phenotypic spectrum of congenital cataract in a different ethnic background.

Association of LOXL1 gene common sequence variants in Jordanian patients with exfoliation syndrome and exfoliative glaucoma

2018/9/4 0:00:00
AIM: To investigate the association between single nucleotide polymorphisms (SNPs) in the LOXL1 gene with exfoliation syndrome/glaucoma (XFS/XFG) among Jordanians. METHODS: Sixty-one patients with XFS/XFG and 59 healthy control individuals were recruited in the study. Patients were diagnosed with XFS/XFG using standard clinical examination techniques. The exonic rs1048661 SNP and the intronic rs2165241 SNP in LOXL1 gene were genotyped using sequencing technique. Allele and genotype frequencies were compared between cases and controls using Chi-square analysis. RESULTS: The G allele of the rs1048661 SNP and the T allele of the rs2165241 SNP were common in the sample with frequencies of 86.4% and 81.4%, respectively. In addition, there were no significant differences in the genotypic and allelic distributions between patients and controls for rs1048661 SNP (P=0.770, OR=1.21, 95%CI: 0.56-2.60) and for rs2165241 SNP (P=0.605, OR=1.12, 95%CI: 0.59-2.09). In addition, no significant associations were found between haplotypes of the examined SNPs and XFS/XFG in the sample (P>0.05). CONCLUSION: Variations in LOXL1 gene may not be associated with XFS/XFG in the Jordanian population. More studies are required to confirm the current findings.

Choroid changes in vortex vein-occluded monkeys

Lu-Lu Chen, Qiong Wang, Wei-Hong Yu and You-Xin Chen — 2018/9/4 0:00:00
AIM: To determine acute and chronic choroidal vascular changes after vortex vein occlusion in monkeys. METHODS: One or two temporal vortex veins were occluded in 8 cynomolgus monkeys. Fluorescein angiography (FA), indocyanine green angiogram (ICGA), and enhanced-depth imaging optical coherence tomography (EDI-OCT) were performed preoperatively and at 1d, 1, 4, 8 and 12wk after occlusion. EDI-OCT images were binarized to calculate the choroid vascular index (CVI). RESULTS: ICGA showed delayed filling of choroidal arteries in occluded quadrants in eyes with two occluded temporal vortex veins within 1wk. The thickness of the superotemporal choroid increased 1d and 4wk after occlusion, the thickness of the superonasal and inferonasal choroid increased 12wk after occlusion, and the CVI of the superonasal quadrant increased 8wk after occlusion in eyes with 2 occluded vortex veins. CONCLUSION: Occlusion of two vortex veins leads to hemodynamic and structural changes in choroidal layers in the acute phase, while autoregulation may play the main role in the long term. Occlusion of one vortex vein has little influence on the hemodynamic and structural status of the choroid.

Protection of tight junction between RPE cells with tissue factor targeting peptide

2018/9/4 0:00:00
AIM: To investigate the effect of tissue factor targeting peptide (TF-TP) on retinal pigment epithelium (RPE) cells tight junctions. METHODS: Cell counting kit-8 (CCK-8) was used to measure the proliferation of ARPE-19 cells. Expression of tight junction, ZO-1 in ARPE-19 cells was measured by Western blot and immunofluorescent staining. Western blot was also used to detect the expression of tissue factor (TF). CEC Transmigration Assay was used to measure the migration of ARPE-19 cells. The transport of fluorescent markers [fluorescein isothiocyanate dextrans of 4, 10, 20 (FD4, FD10, FD20)] and the transepithelial electrical resistance (TEER) were used to measure in ARPE-19 cell. RESULTS: CCK-8 assay showed that 5 μmol/L TF-TP can inhibit ARPE-19 cells abnormally proliferation stimulated by lipopolysaccharide (LPS; P<0.05). LPS increased the transport of fluorescent markers (FD4, FD10, FD20) and decreased TEER levels in ARPE-19 cells, respectively, which were prevented by 5 μmol/L TF-TP pretreatment (P<0.05). Furthermore, LPS significantly up-regulated the expression of TF and downregulated the expression of ZO-1 (P<0.05) in ARPE-19 cell which was inhibited by the TF-TP (P<0.05). In addition, TF-TP inhibited the abnormal migration induced by LPS in ARPE-19 cell (P<0.05). CONCLUSION: Our findings suggest that TF-TP suppressed proliferation and migration of ARPE-19 cells induced by LPS, and maintained the RPE tight junctions through inhibition of TF expression and increased expression of ZO-1.

Effects of miR-22 on viability, migration, invasion and apoptosis in retinoblastoma Y79 cells by targeting high-mobility group box 1

Min Liu, Shuo-Min Wang, Zheng-Xuan Jiang, Hennein Lauren and Li-Ming Tao — 2018/9/4 0:00:00
AIM: To explore the effect of miR-22 on viability, migration, invasion and apoptosis in retinoblastoma (RB) Y79 cells and to further detect the potential mechanism. METHODS: Plasmids were constructed to change the expression level of miR-22 in Y79 cells. Real-time reverse transcription polymerase chain reaction (RT-PCR) was conducted to test the expression level of miR-22. After changing the expression of miR-22, the mRNA and protein levels of high-mobility group box 1 (HMGB1) were investigated using RT-PCR and Western blotting. The effect of miR-22 on viability was analyzed by using cell counting kit-8 (CCK-8) assay and the effect on apoptosis was detected by the flow cytometry. Wound healing migration assay and Transwell invasion assay were used to detect the effects of miR-22 on cell motility. RESULTS: miR-22 inhibited viability, migration and invasion, while promoting apoptosis, in RB Y79 cells. The inhibition rate of miR-22 overexpression group at 12, 24, 48h was 11.71%±2.54%, 21.36%±1.39% and 29.44%±1.15%, respectively. Cellular apoptosis was higher in miR-22 overexpression group (17.00%±0.39%) compared with negative control (4.38%±0.38%). miR-22 negatively mediated the expression of HMGB1. Furthermore, decreased HMGB1 significantly attenuated viability, migration and invasion, while promoting apoptosis. Enforced expression of HMGB1 partially rescued the effects of miR-22 overexpression on cell viability, migration, invasion and apoptosis. Moreover, the phosphorylated protein kinase B (p-AKT) was significantly downregulated in the HMGB1 shRNA group and miR-22 overexpression group and elevated in the HMGB1 overexpression group compared with the normal control. CONCLUSION: miR-22 inhibites viability, migration and invasion and increases apoptosis in Y79 cells by targeting HMGB1. These findings may provide a therapeutic strategy for RB.

Alterations in the polysialylated neural cell adhesion molecule and retinal ganglion cell density in mice with diabetic retinopathy

Natalia Lobanovskaya, Monika Jürgenson, Anu Aonurm-Helm and Alexander Zharkovsky — 2018/9/4 0:00:00
AIM: To investigate the impact of polysialylated neural cell adhesion molecule (PSA-NCAM) on the survival of retinal ganglion cells (RGCs) in the experimentally induced diabetes in mice. METHODS: Diabetes was induced in 2.5 months old Swiss Webster mice by intraperitoneal injection of streptozotocin (STZ, 90 mg/kg) once daily for two consecutive days. Examination of the proteins of interest in the retinas from diabetic mice at 2mo after diabetes induction was performed using immunohistochemistry and Western blot analysis. RGCs were counted in the wholemounted retinas, and Brn3a marker was used. RESULTS: Examination of retinas from diabetic mice at 2mo after diabetes induction revealed a considerable reduction in RGC density. Our experiments also demonstrated a redistribution of PSA-NCAM in the retina of diabetic animals. PSA-NCAM immunoreactivity was diminished in the inner part of the retina where RGCs were located. In contrast, an enhanced PSA-NCAM immunoreactivity was detected in the outer layers of the retina. PSA-NCAM signal was co-localized with glial fibrillary acidic protein immunoreactivity in the Müller cell branches. Previous studies have shown that matrix metalloproteinase-9 (MMP-9) is responsible for the reduction in PSA-NCAM levels in neuronal cells. The reduced levels of PSA-NCAM in inner layers (nerve fiber layer, ganglion cell layer) were accompanied by the increased expression of MMP-9. In contrast, in the outer retinal layers, the expression of MMP-9 was much less pronounced. CONCLUSION: MMP-9 induces PSA-NCAM shedding in the inner part of the retina and the decreased level of PSA-NCAM in the inner part of the retina might be, at least in part, responsible for the loss of RGCs in diabetic mice.

SUMOylation and deacetylation affect NF-κB p65 activity induced by high glucose in human lens epithelial cells

2019/8/2 0:00:00
AIM: To explore the effects of IκBα SUMOylation and NF-κB p65 deacetylation on NF-κB p65 activity induced by high glucose in cultured human lens epithelial cells (HLECs). METHODS: HLECs (SRA01/04) were cultured with 5.5, 25, and 50 mmol/L glucose media for 24h, and with 50 mmol/L glucose media for 0, 12, and 24h respectively. SUMO1 and SIRT1 expressions were detected by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot (WB). IκBα and NF-κB p65 expressions were detected by WB. With NAC, DTT, MG132 or Resveratrol (RSV) treatment, SUMO1 and SIRT1 expressions were detected by WB. Protein expression localizations were examined by immunofluorescence and co-immunofluorescence. The effects of SUMO1 or SIRT1 overexpression, as well as MG132 and RSV, on the nuclear expression and activity of IκBα and NF-κB p65 were analyzed by immunoblot and dual luciferase reporter gene assay. RESULTS: SUMO1 and SIRT1 expressions were influenced by high glucose in mRNA and protein levels, which could be blocked by NAC or DTT. SUMO1 was down-regulated by using MG132, and SIRT1 was up-regulated under RSV treatment. IκBα nuclear expression was attenuated and NF-κB p65 was opposite under high glucose, while IκBα and NF-κB p65 location was transferred to the nucleus. SUMO1 or SIRT1 overexpression and MG132 or RSV treatment affected the nuclear expression and activity of IκBα and NF-κB p65 under high glucose condition. CONCLUSION: IκBα SUMOylation and NF-κB p65 deacetylation affect NF-κB p65 activity in cultured HLECs under high glucose, and presumably play a significant role in controlling diabetic cataract.

Broccoli sprouts juice prevents lens protein aggregation in streptozotocin-induced diabetic rat

Ayu Puspitasari and Nina Handayani — 2019/8/2 0:00:00
AIM: To investigate the effect of broccoli sprouts juice in preventing lens protein aggregation in diabetic rat model. METHODS: Totally 25 male Wistar rats were divided into negative control group, diabetic group without juice treatment as positive control and diabetic group given broccoli sprouts juice 0.25, 0.5 and 1 g/d for 28d. Diabetic rat model was obtained by administering a single dose streptozotocin 65 mg/kg intraperitoneal. At the end of the study, all rats were examined for fasting blood sugar level (FBS), visual cataract score using slit lamp biomicroscope and lens αB-crystallin expression using Western blot method. Statistical analysis was performed using one way ANOVA with post hoc test, correlation test, and simple linear regression. RESULTS: Positive control group had the highest cataract score and lens aggregated αB-crystallin expression. Broccoli sprout juice dose of 1 g/d group had the mildest cataract score, as well as the expression of lens aggregated αB-crystallin compared to treatments groups 1 and 2, opposite to lens native αB-crystallin expression. The broccoli sprout juice groups gave a significant decrease in cataract score, and also in lens aggregated αB-crystallin expression in diabetic rat models (P<0.05). CONCLUSION: Broccoli sprout juice has a significant effect in preventing lens protein aggregation in diabetic rat model. The higher dose gives better visual cataract scores, lower lens aggregated αB-crystallin expression and higher lens native αB-crystallin expression.

Blockade of insulin receptor substrate-1 inhibits biological behavior of choroidal endothelial cells

Yi-Yong Qian, Hong-Ya Wu, Gao-Qin Liu, Chi Ren, Pei-Rong Lu and Xue-Guang Zhang — 2019/8/2 0:00:00
AIM: To investigate the effects of blockade of insulin receptor substrate-1 (IRS-1) on the bio-function of tube formation of human choroidal endothelial cells (HCECs). METHODS: Quantitative reverse transcription-polymerase chain reaction (RT-PCR) and Western blot were performed to determine the expression level of IRS-1 and phospho-IRS-1 in HCECs. Tube formation of HCECs was analyzed using three dimensional in vitro Matrigel assay with or without IRS-1 blockage via IRS-1 inhibitor (GS-101) and vascular endothelial growth factor receptor 2 (VEGFR2) inhibitor. In addition, cell counting kit (CCK)-8 and Transwell migration assay were exerted to analyze the effects of blockade of IRS-1 on the bio-function of proliferation and migration of HCECs, respectively. The apoptosis of HCECs was examined using flow cytometry (FCM). RESULTS: RT-PCR and Western blot revealed that IRS-1 phospho-IRS-1 were expressed in HCECs and the expression level was enhanced by stimulation of VEGF-A. The number of tube formation was decreased significantly in GS-101 treated groups compared to phosphate buffered saline (PBS) treated control groups. Furthermore, both cell proliferation and migration of HCECs were decreased in the presence of GS-101. FCM analysis showed that the apoptosis of HCECs was enhanced when the cells were treated with GS-101. Western blot also showed that the expression level of cleaved-caspase 3 in GS-101 treated group was higher than that in control group. CONCLUSION: Blockade of IRS-1 can inhibit tube formation of HCECs through reducing cell proliferation and migration and promoting cell apoptosis.

Activation of autophagy in the retina after optic nerve crush injury in rats

Li-Hua Kang, Su Zhang, Sheng Jiang and Nan Hu — 2019/8/2 0:00:00
AIM: To investigate the activation of autophagy in rat retina after optic nerve crush (ONC) and evaluate its relationship with apoptosis of retinal ganglion cells (RGCs). METHODS: The ONC model was established. Western blots were performed to investigate expression of p62, LC3 and Beclin-1. Transmission electron microscopy was performed to discover the autophagosomes in the retina after ONC. Immunohistochemistry was used to confirm the distribution of LC3. TUNEL was performed to confirm the relationship between autophagy and RGC apoptosis. RESULTS: p62/Beclin-1 ratio was declined shortly after ONC until to day 7 after ONC and then restored to a normal level at day 21. There was an opposite change in the LC3-II/LC3I ratio in the retina compared to the p62/Beclin-1 ratio. Increased autophagosomes were found after ONC using transmission electron microscopy, and most of the LC3-stained cells were colocalized with RGCs and Müller cells. More LC3-immunoreactive cells and apoptotic RGCs were found on day 7 following ONC. CONCLUSION: Possible activation of autophagy in RGCs after ONC; autophagy mainly occurred in RGCs and Müller cells, and the apoptosis of RGCs after ONC may be partly associated with autophagic activation.

Pro-apoptotic and anti-proliferative effects of Physalis angulata leaf extract on retinoblastoma cells

Marsha Dechastra Chairissy, Lely Retno Wulandari and Hidayat Sujuti — 2019/8/2 0:00:00
AIM: To investigate the effect of Physalis angulata leaf extract on apoptotic and proliferation of retinoblastoma cells. Despite several previous studies evidencing the anti-cancer potential of Physalis angulata; however, certain study that proves its benefits in retinoblastoma cancer cells has been limited. METHODS: This study utilizes an in-vitro experimental study by applying Y79 human retinoblastoma cell line culture obtained from the American Type Culture Collection (ATCC; 10801 University Boulevard Manassas, VA 20110, USA). The cell was divided into 4 groups. Group I was the control group without the administration of Physalis angulata leaf extract. Whereas, group II, II and IV are engaged with 25, 50, and 100 μg/mL of Physalis angulata leaf extract respectively. After a 24h incubation, an examination with microtetrazolium (MTT) cell proliferation assay and Annexin V apoptosis detection was conducted. Statistical analysis was performed with the Tukey test. RESULTS: Physalis angulata leaf extract improved apoptosis and significantly reduced the number of living cells in retinoblastoma cells, along with the increase in the given dose. Based on the Tukey test, a significant difference was found in the treatment group at 50 μg/mL (P=0.025) and 100 μg/mL (P=0.001) in the measurement of apoptosis. Proliferation measurements also indicated a significant decrease in the number of living cells in the 50μg/mL treatment group (P=0.004), and in the 100 μg/mL treatment group (P=0.000). Meanwhile, a dose of 25 μg/mL indicated insignificant difference in the two measurements. Improved apoptosis and decreased number of living cells occured at a dose of 100 μg/mL. Decreased number of living cells (in the measurement of proliferation) was due to the inhibited proliferation or improved apoptosis. CONCLUSION: Physalis angulata leaf extract improve apoptosis in retinoblastoma cell culture, requiring further research to inhibit proliferation.

Neuroprotective effect of a dietary supplement against glutamate-induced excitotoxicity in retina

2019/7/9 0:00:00
AIM: To evaluate the neuroprotective effect of a dietary supplement (ClearVision EX®; CV) against glutamate-induced excitotoxicity in retina. METHODS: We evaluated the protective effects CV on glutamate-induced cell toxicity of an immortalized mouse hippocampal cell line (HT-22) in vitro and N-methyl-D-aspartate (NMDA) induced retinal injury in vivo. Once-daily oral administration of CV or vehicle (5% Arabic gum) was started the day before the NMDA injection and continued until the end of the study. Electroretinograms (ERGs) were recorded to evaluate the retinal function at 2d after NMDA injection. Furthermore, a histological evaluation, Western blot analysis, and immunohistochemistry were performed for assessing the signal transduction pathway. RESULTS: HT-22 cell death was induced by the addition of glutamate and co-incubation with CV protected against it. Oral administration of CV inhibited the decrease in scotopic threshold response amplitudes induced by the intravitreal injection of NMDA and those of the thickness of the inner retinal layer in the histological evaluation. The increased phosphorylated levels of extracellular signal-regulated kinase (ERK) but not cAMP response element binding protein (CREB) or Akt were observed 1h after NMDA injection in both the vehicle- and CV-treated rats; however, pERK activation was no more upregulated at 3h after NMDA injection. pERK upregulation was observed in Müller cells. CONCLUSION: CV shows a protective effect against both glutamate-induced HT-22 cell death and NMDA-induced retinal damage. pERK upregulation in the Müller cells plays a key role in the protective effect of CV against glutamate-induced retinal toxicity.

Immunohistochemical features of carcinoma ex pleomorphic adenoma and pleomorphic adenoma in the lacrimal gland

2019/7/9 0:00:00
AIM: To investigate C-myc, Ki-67, pan-cytokeratin, and vimentin immunohistochemical features of carcinoma ex pleomorphic adenoma (Ca-ex-PA) and pleomorphic adenoma (PA) in the lacrimal gland in order to find some clues in the differential diagnosis between them. METHODS: We reviewed microscopic slides and clinical records of 64 cases of PA and 15 cases of Ca-ex-PA in the lacrimal gland. Immunohistochemical antibodies for C-myc, Ki-67, pan-cytokeratin, and vimentin were employed. RESULTS: Median age of PA was 43.2y (from 21 to 75). The 35 patients (54.7%) were male and 29 patients (45.3%) were female. For the PAs, the average positivity of C-myc was 4.6%; the average proliferation index of Ki-67 was 3.2%; pan-cytokeratin was positive in ductal cells, and vimentin was positive in myoepithelial cells. Median age of Ca-ex-PA was 54.3y (from 26 to 76). There were 7 male patients (46.7%) and 8 female patients (53.3%). Among 15 Ca-ex-PAs, there were 6 myoepithelial carcinomas, 4 adenocarcinomas, 3 epithelial-myoepithelial carcinomas, and 2 squamous cell carcinomas. For the Ca-ex-PAs, the average positivity of C-myc was 36.4%; the average proliferation index of Ki-67 was 29.2%; pan-cytokeratin was positive in all cases, and vimentin was positive in myoepithelial carcinomas. CONCLUSION: PA has a lower positivity of C-myc and Ki-67, while Ca-ex-PA had a higher positivity of these two biomarkers. These four biomarkers as a set could provide valuable clues in the differential diagnosis between Ca-ex-PA and PA. Our results indicate that the activation of C-myc could play an important role in the pathogenesis of Ca-ex-PA and PA.

Activation of the TRAAK two-pore domain potassium channels in rd1 mice protects photoreceptor cells from apoptosis

2019/7/9 0:00:00
AIM: To investigate the expression of TWIK-related arachidonic acid-stimulated K+ channel (TRAAK) in retinal degeneration mice (rd1) and further evaluate how TRAAK affect photoreceptor cell apoptosis. METHODS: The rd1 mice were distributed into blank (no treatment), control (1.4% DMSO, intraperitoneal injection) and riluzole groups (4 mg/kg·d, intraperitoneal injection) from postnatal 7d to 10, 14 and 18d; C57 group (no treatment), as age-matched wild-type control. The thickness of the outer nuclear layer (ONL) of retina was detected by paraffin section hematoxylin and eosin staining. The expression of TRAAK and the apoptosis of the ONL cells were detected by immunostaining, Western blotting, and real-time polymerase chain reaction. RESULTS: The channel agonist riluzole activated TRAAK and delayed the apoptosis of photoreceptor cells in ONL layer of rd1 mice. Both at mRNA and protein levels, after riluzole treatment, TRAAK expression was significantly upregulated, when compared with the control and blank group. Then we detected a series of apoptosis related mRNA and protein. The anti-apoptotic factor Bcl-2 downregulated and the pro-apoptotic factors Bax and cleaved-caspase-3 upregulated significantly. CONCLUSION: Riluzole elevates the expression of TRAAK and inhibits the development of apoptosis. Activation of TRAAK may have some potential effects to put off photoreceptor apoptosis.

Establishment of an adult zebrafish model of retinal neurodegeneration induced by NMDA

2019/7/9 0:00:00
AIM: To establish a model of retinal neurodegeneration induced by N-Methyl-D-aspartic acid (NMDA) in adult zebrafish. METHODS: We compared the effects of three different NMDA delivery methods on retinal neurodegeneration in adult zebrafish: immersion (I.M.), intravitreal injection (I.V.), and intraperitoneal injection (I.P.), and examined retinal pathology and degeneration by hematoxylin and eosin and TUNEL staining in the treated zebrafish. Effects of the NMDA receptor antagonist MK-801 and the natural product resveratrol on NMDA-induced retinal neurodegeneration were also assessed. RESULTS: The thickened inner retina was seen in histology with 100 μmol/L NMDA by I.M. administration. Significant apoptosis in the retinal ganglion cell layer and retinal thickness reduction occurred in 0.5 mol/L NMDA I.P. administration group.Seizure-like behavioral changes, but no retinal histological alteration occurred in 16 mg/kg NMDA I.P. administration group. Resveratrol and MK-801 prevented NMDA-induced retinal neurodegeneration in the zebrafish. CONCLUSION: Among the three drug administration methods, I.V. injection of NMDA is the most suitable for establishment of an acute retinal damage model in zebrafish. I.M. with NMDA is likely the best for use as a chronic retinal damage model. I.P. treatment with NMDA causes brain damage. Resveratrol and MK801 may be a clinically valuable treatment for retinal neurodegeneration.

Protective effects of lipoic acid-niacin dimers against blue light-induced oxidative damage to retinal pigment epithelium cells

2019/7/9 0:00:00
AIM: To evaluate the protective effects of lipoic acid-niacin (N2L) dimers against blue light (BL)-induced oxidative damage to human retinal pigment epithelium (hRPE) cells in vitro. METHODS: hRPE cells were divided into a control group (CG), a BL group, an N2L plus BL irradiation group, an α-lipoic acid (ALA) plus BL group, an ALA-only group, and an N2L-only group. hRPE cellular viability was detected by performing 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium (MTT) bromide assays, and apoptosis was evaluated by annexin-V-PE/7-AAD staining followed by flow cytometry. Ultrastructural changes in subcellular organelles were observed by transmission electron microscopy. Reactive oxygen species formation was assayed by flow cytometry. The expression levels of the apoptosis-related proteins BCL-2 associated X protein (BAX), B-cell leukmia/lymphoma 2 (BCL-2), and caspase-3 were quantified by Western blot analysis. RESULTS: BL exposure with a light density of 4±0.5 mW/cm2 exceeding 6h caused hRPE toxicity, whereas treatment with a high dose of N2L (100 mol/L) or ALA (150 mol/L) maintained cell viability at control levels. BL exposure caused vacuole-like degeneration, mitochondrial swelling, and reduced microvillus formation; however, a high dose of N2L or ALA maintained the ultrastructure of hRPE cells and their organelles. High doses of N2L and ALA also protected hRPE cells from BL-induced apoptosis, which was confirmed by Western blot analysis: BCL-2 expression significantly increased, while BAX and caspase-3 expression slightly decreased compared to the CG. CONCLUSION: High-dose N2L treatment (>100 mol/L) can reduce oxidative damage in degenerating hRPE cells exposed to BL with an efficacy similar to ALA.

Dynamic changes of activator protein 1 and collagen I expression in the sclera of myopia guinea pigs

Xin Zhan, Zi-Cheng Zhu, Si-Qin Sun and Yue-Chun Wen — 2019/7/9 0:00:00
AIM: To investigate the dynamic changes of activator protein 1 (AP1) and collagen I expression in the sclera of form-deprivation myopic model in guinea pigs. METHODS: A form-deprivation myopic model in guinea pigs were established with the left eye covered for 2 to 6wk (FDM group). Normal control group (n=25) were untreated. Changes in refractive power and axial length (AL) were measured and recorded at different time points. Expressions of AP1 and collagen 1 of the sclera were measured with Western blotting and reverse transcription-polymerase chain reaction (RT-PCR). The relationship between AP1 and collagen I levels was analyzed. RESULTS: After 0, 2, 4, 6wk, and 4/-1wk of form-deprivation, the diopter in the FDM group was gradually changed (2.08±0.31, -1.23±0.68, -4.17±0.58, -7.07±0.55, and -2.67±0.59 D, respectively, P<0.05), and the AL was gradually increased (5.90±0.38, 6.62±0.37, 7.30±0.35, 7.99±0.31, and 6.97±0.32 mm, respectively, P<0.05). With the prolongation of covered time, the protein expressions of AP1 and collagen I in the FDM group were gradually down-regulated (all P<0.05); the mRNA expressions of them were also gradually down-regulated (all P<0.05); and there was positive correlation between them. The control group had no obvious change in each index (all P>0.05). CONCLUSION: AP1 may be an important transcription factor involved in the regulation of collagen I synthesis and degradation during myopic scleral remodeling.

Novel mutation in OCRL leading to a severe form of Lowe syndrome

2019/5/20 0:00:00
AIM: To investigate the phenotype and genotype of a family with X-linked recessive Lowe syndrome. METHODS: All the members in the Chinese pedigree underwent comprehensive ophthalmologic and systemic examinations. Genomic DNA was isolated from peripheral blood of the pedigree members and 100 unrelated healthy Chinese subjects. Direct sequencing was performed to screen the exons and intron boundaries of OCRL. RESULTS: The ophthalmological and systemic examinations suggested that the affected individual had Lowe syndrome. The phenotype in the pedigree is severe and consistent among all the affected individuals except for an individual who additionally suffered from congenital heart disease and laryngeal cartilage dysplasia. Directional Sanger sequencing identified a complex mutation c.(2368_2368delG; c.2370A>C) in the Rho-GTPase activating protein domain. This complex mutation causes termination of protein synthesis at amino acid 824 and result in a new peptide with 823 amino acids (p.Ala790ProfsX34). This mutation was not detected in 100 unrelated healthy Chinese subjects. CONCLUSION: Our findings expand the phenotypic and genotypic spectrum of Lowe syndrome.

High glucose: activating autophagy and affecting the biological behavior of human lens epithelial cells

Dan Li, Gao-Qin Liu and Pei-Rong Lu — 2019/6/11 0:00:00
AIM: To clarify the effect of autophagy on human lens epithelial cells (HLECs) under high glucose conditions. METHODS: HLECs were cultured with different concentrations of glucose and 3-methyladenine (3-MA); the expression of autophagy-related protein LC3B was detected by Western blotting and immunofluorescence histochemistry. The migration of HLECs was quantified by scratch wound assay and the expression of transforming growth factor-β (TGF-β) was measured by real-time polymerase chain reaction. RESULTS: Compared with 5 mmol/L normal glucose treatment, 40 mmol/L glucose treatment can significantly increase the generation of autophagosome in HLECs, which could be inhibited by 0.375 mmol/L 3-MA treatment. The migration of HLECs and the expression of TGF-β in HLECs induced by high glucose were significantly suppressed by 0.375 mmol/L 3-MA treatment. CONCLUSION: Autophagy promotes HLECs cell migration and increases the expression of TGF-β after exposed to high glucose, which may relate to the development of diabetic cataract.

Reactive oxygen species mediates a metabolic memory of high glucose stress signaling in bovine retinal pericytes

Li-Wei Zhang, Han Zhao and Bai-Hua Chen — 2019/6/11 0:00:00
AIM: To investigate the role of reactive oxygen species (ROS) and antioxidant mechanism underlying the metabolic memory of bovine retinal pericytes (BRPs) induced by high glucose. METHODS: Effects of high glucose levels and culture time on BRPs viability were evaluated by CCK-8. BRPs were grown in high-glucose media (30 mmol/L) for 4d followed by culture in normal glucose condition (5.6 mmol/L) for 4d in an experimental group. In contrast, in negative and positive control groups, BRPs were grown in either normal-glucose media or high-glucose media for 8d, respectively. The ROS levels, apoptosis, the expression and activity of manganese superoxide dismutase (MnSOD) in BRPs, as well as the protective effect of adeno-associated viral (AAV)-mediated over expression of MnSOD were determined separately by DCHFA, ELISA and Western blot. RESULTS: Comparing the result of cells apoptosis, activity and protein expression of MnSOD and caspase-3, the cell culture system that exposed in sequence in 30 mmol/L and normal glucose for 4d was demonstrated as a suitable model of metabolic memory. Furthermore, delivery of antioxidant gene MnSOD can decrease BRPs apoptosis, reduce activated caspase-3, and reverse hyperglycemic memory by reducing the ROS of mitochondria. CONCLUSION: Increased ROS levels and decreased MnSOD levels may play important roles in pericyte loss of diabetic retinopathy. BRPs cultured in high glucose for 4d followed by normal glucose for 4d could be an appropriate model of metabolic memory. rAAV-MnSOD gene therapy provides a promising strategy to inhibit this blinding disease.

Pirfenidone suppresses the abnormal activation of human Müller cells after platelet-derived growth factor-BB stimulation

Yi-Jin Tao, Qin Chen, Li Wang, Xiao Yang, Qing Cun, Wen-Yan Yang and Hua Zhong — 2019/6/11 0:00:00
AIM: To determine the effect of pirfenidone on the activated human Müller cells by platelet-derived growth factor-BB (PDGF-BB). METHODS: The primary human Müller cells were separated from retinal tissues and established the pathogenic model by stimulated with PDGF-BB. The Müller cells behaviour of normal group and the model group was measured by MTT assay, Trypan blue assay, cell migration assay, and collagen contraction assay. The expression of transforming growth factor (TGF)-β1, -β2, and pigment epithelium-derived factor (PEDF) was estimated with real-time polymerase chain reaction (PCR), Western blot and immunofluorescence analyses. RESULTS: A pathogenic/proliferative model of Müller cells was established by stimulating normal cultured Müller cells with 10 ng/mL PDGF-BB for 48h. After treated with 0.2 and 0.3 mg/mL pirfenidone, the proliferation, migration and collagen contraction was statistically significantly depressed in the model group compared with the normal groups. The expression levels of TGF-β1 and TGF-β2 were significantly down-regulated, while the PEDF expression was significantly up-regulated after treated with 0.2 and 0.3 mg/mL pirfenidone in the model group. CONCLUSION: Pirfenidone effectively suppress the proliferation, migration and collagen contraction of the human Müller cells stimulated with PDGF-BB through down- regulation of TGF-β1/TGF-β2 and up-regulation of PEDF.

Effects of etanercept on the apoptosis of ganglion cells and expression of Fas, TNF-α, caspase-8 in the retina of diabetic rats

2019/6/11 0:00:00
AIM: To evaluate the effects of etanercept on the expression of Fas, tumor necrosis factor-alpha (TNF-α) and caspase-8 in the early stage of the apoptotic pathway in diabetic rats, and to explore the therapeutic effect of etanercept on diabetic retinopathy. METHODS: A total of 60 Sprague-Dawley (SD) rats were randomly and evenly divided into 3 groups with 20 rats each, including control group, and diabetic groups with or without treatment. Streptozotocin (STZ)-induced diabetic rats were established for diabetic groups. Blood glucose and body weight were measured weekly. All the rats were sacrificed at the 12wk after treatment. The expressions of Fas, TNF-α and caspase-8 in rat retina were quantitatively detected by PCR and Western blot. The leakage of Evan blue was adopted to measure the retinal vascular leakage quantitatively, and to compare it among different groups. TUNEL method was used to compare the amount of apoptotic bodies quantitatively in rat retina ganglion cells under electron microscope. RESULTS: The expressions of Fas, TNF-α and caspase-8 in each group were compared via PCR and Western blot, in which the diabetic group with treatment was lower than those without treatment (P<0.01), but all the diabetic groups were higher than the control group (P<0.01). Evans blue leakage in the diabetic treatment group was lower than those without treatment (P<0.01), but those in the control group was the lowest compared with the other two groups (P<0.01). TUNEL method showed that the apoptotic bodies of retina in the diabetic treatment group was lower than those without treatment (P<0.01), while those in the control group was the lowest compared with the other two groups (P<0.01). CONCLUSION: Etanercept can effectively reduce the expression of Fas, TNF-α and caspase-8, as well as the retinal leakage and retinal cell apoptosis in diabetic rats.

Down regulation of UCP2 expression in retinal pigment epithelium cells under oxidative stress: an in vitro study

Ying Liu, Yuan Ren, Xia Wang, Xu Liu, Yun Xu and Yuan He — 2019/6/11 0:00:00
AIM: To evaluate the expression of uncoupling protein 2 (UCP2) in a retinal pigment epithelium cell line (ARPE-19), under oxidative stress (OS). METHODS: ARPE-19 cells were divided into groups treated with various concentrations of hydrogen peroxide (H2O2; 0, 150, 300, 500, 700, and 900 μmol/L) for 24h, to induce oxidative damage and cell viability was assessed by MTT assay. UCP2 mRNA expression in cells treated with H2O2 was investigated by reverse transcription-polymerase chain reaction (RT-PCR). UCP2 protein expression was assessed by Western blotting and ROS levels analyzed by flow cytometry (FCM). Further, UCP2-siRNA treated cultures were exposed to H2O2 (0, 75, 150, and 300 μmol/L) for 2h and cell viability determined by MTT assay. RESULTS: Cells treated with higher concentrations of H2O2 appeared shrunken; their adhesion to adjacent cells was disrupted, and the number of dead cells increased. The results of cell viability assays demonstrated that the numbers of cells were decreased in a dose-dependent manner following treatment with H2O2. Compared with untreated controls, cell viability was significantly reduced after treatment with >300 μmol/L H2O2 (P<0.05). Cell metabolic activity was decreased with increased concentrations of H2O2 as detected by MTT assay. Levels of OS were further decreased in cells treated with UCP2-siRNA compared with those treated with H2O2 alone (P<0.05). The results of RT-PCR and Western blotting demonstrated that UCP2 expression was reduced in H2O2-treated groups compared with controls (P<0.05). FCM analysis showed that cell reactive oxygen species (ROS) levels were increased in H2O2-treated groups and further upregulated by UCP2-siRNA treatment (P<0.05). CONCLUSION: Expression levels of UCP2 are decreased in ARPE-19 cells treated with H2O2. ROS levels are further increased in cells treated with UCP2-siRNA relative to those treated with H2O2 alone. UCP2 may have a protective role in ARPE-19 cells during oxidative injury.

Inhibitory effect of Houttuynia cordata Thunb on LPS-induced retinal microglial activation

Ying-Hui Zhang, Le-Meng Ren and Xiao-Yun Wang — 2019/6/11 0:00:00
AIM: To identify the effect of Houttuynia cordata Thunb (HCT) on lipopolysaccharide (LPS)-induced microglial activation and investigate its possible molecular mechanisms. METHODS: The primary retinal microglial cells were cultured from the retinas of newborn Sprague-Dawley rats and exposed to LPS, and/or HCT with different concentrations. The survival ability of retinal microglia cells was tested by standard MTT method. BrdU cell proliferation assay was used to evaluate the proliferation of retinal microglia. Inflammatory factors in the culture supernatants, including TNF-α, iNOS and IL-1β, were measured using ELISA. Microglia cells’ migration was determined with Transwell migration assay. The total p38-MAPK and phosphorylation of p38-MAPK (p-p38-MAPK) were detected with Western blot. RESULTS: Primary retinal microglia in culture exposed to LPS to induce microglia activation. Pretreatment with HCT significantly inhibited the LPS-induced cell proliferation, but not the cell viability. LPS induced inflammatory reaction in microglia and cell migration. HCT significantly reduced LPS-stimulated release of pro-inflammatory factors and decreased the number of migrating cells substantially in a concentration-dependent manner. Moreover, the protein levels of p-p38 MAPK were identified as the up regulation and co-treatment with HCT obviously inhibited the upregulation of p-p38 MAPK, but had no effect on the levels of total p38-MAPK. CONCLUSION: The data suggest that HCT inhibits LPS-induced retinal microglial activation via suppression of the p-p38-MAPK. HCT may be used for the treatment of ocular diseases characterized by over-activated microglia.

Effects of the long wavelength-filtered continuous spectrum on natural refractive development in juvenile guinea pigs

2019/5/6 0:00:00
AIM: To investigate the effects of spectral composition and light intensity on natural refractive development in guinea pigs. METHODS: A total of 124 pigmented guinea pigs (2-week-old) were randomly assigned to three groups at high (Hi; 4000 lx), medium (Me; 400 lx) and low (Lo; 50 lx) light intensities under a 12:12 light/dark cycle for 6wk. Each group was subdivided into subgroups with the following spectra: broad spectrum Solux halogen light (BS), 600 nm above-filtered continuous spectrum (600F), 530 nm above-filtered continuous spectrum (530F), and 480 nm above-filtered continuous spectrum (480F; HiBS: n=10, Hi600F: n=10, Hi530F: n=10, Hi480F: n=10, MeBS: n=10, Me600F: n=10, Me530F: n=10, Me480F: n=10, LoBS: n=11, Lo600F: n=12, Lo530F: n=10, Lo480F: n=11). Refractive error, corneal curvature radius, and axial dimensions were determined by cycloplegic retinoscopy, photokeratometry, and A-scan ultrasonography before and after 2, 4, and 6wk of treatment. Average changes from both eyes in the ocular parameters and refractive error were compared among different subgroups. RESULTS: After 6wk of exposure, high-intensity lighting enhanced hyperopic shift; medium- and low-intensity lighting enhanced myopic shift (P<0.05). Under the same spectrum, axial increase was larger in the low light intensity group than in the medium and high light intensity groups (HiBS: 0.65±0.02 mm, MeBS: 0.67±0.01 mm, LoBS: 0.82±0.02 mm; Hi600F: 0.64±0.02 mm, Me600F: 0.67±0.01 mm, Lo600F: 0.81±0.01 mm; Hi530F: 0.64±0.02 mm, Me530F: 0.67±0.01 mm, Lo530F: 0.73±0.02 mm; Hi480F: 0.64±0.01 mm, Me480F: 0.66±0.01 mm, Lo480F: 0.72±0.02 mm; P<0.05). Under 400 lx, there was a faster axial increase in the MeBS group than in the Me480F group (P<0.05). Under 50 lx, axial length changes were significantly larger in LoBS and Lo600F than in Lo530F and Lo480F (P<0.01). CONCLUSION: Under high-intensity lighting, high light intensity rather than spectrum distributions that inhibits axial increase. Under medium- and low-intensity lighting, filtering out the long wavelength inhibits axial growth in juvenile guinea pigs.

Semaphorin 7a participants in pterygium by regulating vascular endothelial growth factor

2019/5/6 0:00:00
AIM: To investigate the relationship between semaphorin 7a expression and cell proliferation and migration in pterygium fibroblasts. METHODS: Twenty-six patients with surgically diagnosed pterygium were enrolled, including 15 cases of primary pterygium and 11 cases of recurrent pterygium. In addition, 12 cases of normal conjunctival tissue were collected. The expression of semaphorin 7a in normal conjunctival tissue, primary pterygium and recurrent pterygium was detected by real-time polymerase chain reaction. Recurrent pterygium fibroblasts were isolated and cultured, and the expression of semaphorin 7a was silenced by small interfering RNA (siRNA) interference technique. Furthermore, the effects of si-semaphorin 7a interference on the mRNA and protein levels of β1-integrin, vascular endothelial growth factor A (VEGFA) and vascular endothelial growth factor receptor (VEGFR), and on fibroblast proliferation were analyzed. Transwell assay was used to detect the effect of semaphorin 7a interference on fibroblast migration. RESULTS: Semaphorin 7a was highly expressed in the primary pterygium and recurrent pterygium samples than that of the normal conjunctival tissue. Compared with the primary pterygium, the expression of semaphoring 7a in the recurrent pterygium samples was significantly increased (P<0.05). The mRNA and protein expression levels of β1-integrin, VEGFA and VEGFR were decreased after si-semaphorin 7a transfection, and as well as the cell proliferation and migration. CONCLUSION: Semaphorin 7a might play important roles in the pathogenesis of pterygium by affecting the expression of β1-integrin, VEGFA and VEGFR.

Inhibition of LOX-1 alleviates the proinflammatory effects of high-mobility group box 1 in Aspergillus fumigatus keratitis

2019/5/6 0:00:00
AIM: To investigate the inflammatory amplification effect of high-mobility group box 1 (HMGB1) in Aspergillus fumigatus (A. fumigatus) keratitis and the relationship between lectin-like oxidized low-density lipoprotein receptor 1 (LOX-1) and HMGB1 in keratitis immune responses. METHODS: Phosphate buffer saline (PBS), and Boxb were injected into BALB/c mice subconjunctivally before the corneas were infected with A. fumigatus. RAW264.7 macrophages and neutrophils were pretreated with PBS and Boxb to determine the HMGB1 inflammatory amplification effects. Abdominal cavity extracted macrophages were pretreated with Boxb and Poly (I) (a LOX-1 inhibitor) before A. fumigatus hyphae stimulation to prove the the relationship between the two molecules. LOX-1, interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α), macrophage inflammatory protein-2 (MIP-2) and IL-10 were assessed by polymerase chain reaction and Western blot. RESULTS: Pretreatment with Boxb exacerbated corneal inflammation. In macrophages and neutrophils, A. fumigatus induced LOX-1, IL-1β, TNF-α and MIP-2 expression in Boxb group was higher than those in PBS group. Poly (I) treatments before infection alleviated the proinflammatory effects of Boxb in abdominal cavity extracted macrophages. Pretreatment with Boxb did not influence Dectin-1 mRNA levels in macrophages and neutrophils. CONCLUSION: In fungal keratitis, HMGB1 is a proinflammatory factor in the first line of immune response. HMGB1 mainly stimulates neutrophils and macrophages to produce inflammatory cytokines and chemokines during the immune response. LOX-1 participates in HMGB1 induced inflammatory exacerbation in A. fumigatus keratitis.

Acute lens opacity induced by different kinds of anesthetic drugs in mice

Xiao-Tong Li, Yu Qin, Jiang-Yue Zhao and Jin-Song Zhang — 2019/5/6 0:00:00
AIM: To study whether specific anesthetic drugs or tear layer evaporation was primarily responsible for the acute cataract and what the change of lens structure is in anesthetized mice. METHODS: Five groups were set up in the experiment: Group A (topicamide and phenylephrine mixed eye drop+ chloral hydrate), Group B (tropicamide and phenylephrine mixed eye drop+sevoflurane), Group C (tropicamide and phenylephrine mixed eye drop), Group D (topicamide and phenylephrine mixed eye drop+chloral hydrate, carbomer eye drop in the right eyes), and Group E (tropicamide and phenylephrine mixed eye drop+sevoflurane, carbomer eye drop in the right eyes). A simple classification system was used to assess the severity of lens opacity. And a numerical value from 0 to 3 to each grade was assigned for the cataract index calculation and data analysis. The gross appearance and time course of development of lens opacity were assessed. Hematoxylin and eosin staining was used to observe the lens structure changes in the reversible cataract. RESULTS: Tropicamide did not induce lens opacification in mice. Lens opacity caused by inhaled sevoflurane was similar to injected cholral hydrate. Both inhaled-anesthetic-induced lens opacity and injected-anesthetic-induced lens opacity could be prevented by carbomer eye drop. In the severe opacity lens, a wide range of lens fiber cell structure had disordered. The fiber cells became uneven thickness. CONCLUSION: The acute reversible lens opacity can unilaterally develop or be induced by a local cause. The structure of lens fiber cells changed in the lens opacity which may influence the permanent connection of the lens fiber cells. This study was not only of practical significance to help maintain lens transparency for eye research, but also of the deeper consideration about the reversible lens opacification phenomenon.

Compound heterozygous mutations in CYP1B1 gene leads to severe primary congenital glaucoma phenotype

2019/5/6 0:00:00
AIM: To identify the novel mutation alleles in the CYP1B1 gene of primary congenital glaucoma (PCG) patients at Shandong Province of China, and investigate their correlation with glaucomatous features. METHODS: The DNA from the peripheral blood of 13 congenital glaucoma patients and 50 ethnically matched healthy controls from the affiliated hospital of Qingdao University were extracted. The coding region of the CYP1B1 gene was amplified by PCR and direct DNA sequencing was performed. Disease causing-variants were analyzed by comparing the sequences and the structures of wild type and mutant CYP1B1 proteins by PyMOL software. RESULTS: Two missense mutations, including A330F caused by c.988G>T&c.989C>T, and R390H caused by c.1169G>A, were identified in one of the 13 PCG patients analyzed in our study. A330F mutation was observed to be novel in the Chinese Han population, which dramatically altered the protein structure of CYP1B1 gene, including the changes in the ligand-binding pocket. Furthermore, R390H mutation caused the changes in heme-protein binding site of this gene. In addition, the clinical phenotype displayed by PCG patient with these mutations was more pronounced than other PCG patients without these mutations. Multiple surgeries and combined drug treatment were not effective in reducing the elevated intraocular pressure in this patient. CONCLUSION: A novel A330F mutation is identified in the CYP1B1 gene of Chinese PCG patient. Moreover, in combination with other mutation R390H, this PCG patient shows significant difference in the CYP1B1 protein structure, which may specifically contribute to severe glaucomatous phenotype.

Whole-exome sequencing identifies novel mutations in genes responsible for retinitis pigmentosa in 2 nonconsanguineous Chinese families

Yan-Shan Hu, Hui Song, Yin Li, Zi-Yun Xiao and Tuo Li — 2019/5/6 0:00:00
AIM: To detect the pathogenetic mutations responsible for nonsyndromic autosomal recessive retinitis pigmentosa (RP) in 2 nonconsanguineous Chinese families. METHODS: The clinical data, including detailed medical history, best corrected visual acuity (BCVA), slit-lamp biomicroscope examination, fundus photography, optical coherence tomography, static perimetry, and full field electroretinogram, were collected from the members of 2 nonconsanguineous Chinese families preliminarily diagnosed with RP. Genomic DNA was extracted from the probands and other available family members; whole-exome sequencing was conducted with the DNA samples provided by the probands, and all mutations detected by whole-exome sequencing were verified using Sanger sequencing in the probands and the other available family members. The verified novel mutations were further sequenced in 192 ethnicity matched healthy controls. RESULTS: The patients from the 2 families exhibited the typical symptoms of RP, including night blindness and progressive constriction of the visual field, and the fundus examinations showed attenuated retinal arterioles, peripheral bone spicule pigment deposits, and waxy optic discs. Whole-exome sequencing revealed a novel nonsense mutation in FAM161A (c.943A>T, p.Lys315*) and compound heterozygous mutations in RP1L1 (c.56C>A, p.Pro19His; c.5470C>T, p.Gln1824*). The nonsense c.5470C>T, p.Gln1824* mutation was novel. All mutations were verified by Sanger sequencing. The mutation p.Lys315* in FAM161A co-segregated with the phenotype, and all the nonsense mutations were absent from the ethnicity matched healthy controls and all available databases. CONCLUSION: We identify 2 novel mutations in genes responsible for autosomal recessive RP, and the mutation in FAM161A is reported for the first time in a Chinese population. Our result not only enriches the knowledge of the mutation frequency and spectrum in the genes responsible for nonsyndromic RP but also provides a new target for future gene therapy.

Elevated expression of TREK-TRAAK K2P channels in the retina of adult rd1 mice

2019/5/6 0:00:00
AIM: To examine the expression of Twik-related K+ channel 1 (TREK-1), Twik-related K+ channel 2 (TREK-2), and Twik-related arachidonic acid-stimulated K+ channel (TRAAK) in the retina of adult rd1 mice and to detect the protective roles of TREK-TRAAK two-pore-domain K+ (K2P) channels against retinal degeneration. METHODS: Twenty-eight-day-old C57BL/6J mice and 28-day-old rd1 mice were used in this study. Retinal protein, retinal RNA, and embedded eyeballs were prepared from these two groups of mice. Real-time quantitative polymerase chain reaction and Western blot analyses were used to assess the gene transcription and protein levels, respectively. Retinal structures were observed using hematoxylin and eosin (H&E) staining. Immunohistochemistry was utilized to observe the retinal localization of TREK-TRAAK channels. Current changes in retinal ganglion cells (RGCs) after activation of TREK-TRAAK channels were examined using a patch-clamp technique. RESULTS: Compared with C57BL/6J mice, rd1 mice exhibited significantly higher retinal mRNA and protein expression levels of TREK-1, TREK-2, and TRAAK channels. In both groups, immunohistochemistry showed expression of TREK-TRAAK channels in retinal layers. After addition of the TREK-TRAAK channel agonist arachidonic acid (AA), whole-cell voltage step evoked currents were significantly higher in RGCs from rd1 mice than in RGCs from control C57BL/6J mice, suggesting that TREK-TRAAK channels were opened in RGCs from rd1 mice. CONCLUSION: TREK-TRAAK K2P channels’ expression is increased in adult rd1 mice. AA induced the opening of TREK-TRAAK K2P channels in adult rd1 mice and may thus counterbalance depolarization of RGCs and protect the retina from excitotoxicity. TREK-TRAAK channels may play a protective role against retinal degeneration.

Effects of astaxanthin on antioxidant parameters in ARPE-19 cells on oxidative stress model

2019/5/6 0:00:00
AIM: To observe the protective effect of astaxanthin (AST) against hydroquinone (HQ) mediated cell death in the apoptotic cascade and evaluate intracellular Ca2+ release, caspase-3, and -9 activation, reactive oxygen species (ROS) production in ARPE-19 cells. METHODS: We cultured ARPE-19 cells in special mediums and performed MTT tests to determine protective effect of AST, before exposing the cells to HQ in an incubator. We analyzed intracellular Ca2+ release experiments, mitochondrial membrane depolarization, glutathione (GSH), glutathione peroxidase (GSH-Px) and ROS experiments, and apoptosis assay. RESULTS: ROS production ranges depend on the amount of cell death. We computed the correlation between ROS ranges and cell death by 20,70-dichlorofluorescein fluorescence, and Ca2+ levels by Fura-2-AM. HQ-induced cell death found out to rise ranges of caspase-3 and -9, and mitochondrial depolarization. These three steps were delayed by AST management. CONCLUSION: ARPE-19 cells are avoided from HQ-induced ROS production and caspase-3 and -9 activation by AST. AST may limit the range of caspase synthesis, Ca2+ release and excess production of ROS with antiapoptotic effect. This study proposes a new therapeutic approach for the treatment of age-related macular degeneration.

Chronic photodamage in the chicken retina using 650-nm semiconductor laser

Yi-Peng Wang, Ze-Yu Liang, Song Chen, Wen-Chao Yang and Jia-Hui Kong — 2019/5/6 0:00:00
AIM: To investigate the occurrence of chronic photodamage in the cone-based retina, following long-term exposure to a 650-nm semiconductor laser (power: 2 mW). METHODS: Chickens fed for 1mo under natural light after hatching were irradiated with 650-nm laser light at different times each day. Fifteen animals were included in each group. Group A was a control group, irradiated with natural light during the entire study. Group B was irradiated with laser for 3 min/d. Group C was irradiated with laser for 6 min/d. Group D was irradiated with laser for 30 min/d. The duration of the light experiment was 6mo. We obtained data at 1, 3, and 6mo, including measuring the retinal thickness in vivo using optical coherence tomography, hematoxylin and eosin staining, TUNEL assay, apoptosis staining, malondialdehyde (MDA) content, superoxide dismutase (SOD) activity, and Western blotting to detect changes in L/M opsins and rhodopsin. RESULTS: At 1mo, the MDA content in Group D was higher than that observed in Group A (P=0.019). At 3mo the MDA content in Groups C and D was higher than that reported in Group A (P=0.026, 0.003). At 6mo, the MDA content in Groups B, C, and D was higher than that observed in Group A (P=0.038, 0.032, 0.000, respectively). There was no difference in SOD activity, and L/M opsin and rhodopsin content between the groups at 1 and 3mo. The SOD activity in group D was significantly decreased at 6mo (P=0.000), as was the content of rhodopsin. There was no significant reduction observed in retinal thickness, abnormal cell arrangement, and positive staining of TUNEL in the groups during the 6-month study period. CONCLUSION: Irradiation using a 650 nm semiconductor laser (power: 2 mW) for 6min per day over 6mo do not cause photodamage. Similarly, a 3-month exposure of 30min per day do not cause damage. However, irradiation for 6mo resulted in a significant increase in the content of free radicals and a decrease in the content of rhodopsin in the retina, suggesting the presence of photodamage.

Expression and role of calcitonin gene-related peptide in mouse Aspergillus fumigatus keratitis

2019/3/27 0:00:00
AIM: To investigate the expression and role of calcitonin gene-related peptide (CGRP) in the mouse models induced by Aspergillus fumigatus (A. fumigatus). METHODS: C57BL/6 mice were randomized into a control group and A. fumigatus keratitis group. The cornea photography was assessed under the slit lamp and the clinical score was recorded after infection. Western blot, real-time polymerase chain reaction (PCR) and immunohistofluorescence analysis were applied to detect CGRP expression in cornea of both groups. In vitro, tests were conducted with C57BL/6 mice macrophages to investigate CGRP expression after interaction with A. fumigatus. Cytokines expression induced by exogenous CGRP and the antagonist CGRP8-37 in A. fumigatus-exposed macrophages was evaluated by real-time PCR and ELISA. RESULTS: The cornea expression of CGRP was significantly elevated in C57BL/6 mice corneas and macrophages after A. fumigatus infection. After treatment with exogenous CGRP, the levels of interleukin-1β (IL-1β), tumor necrosis factor-α (TNF-α) and IL-6 were reduced, and IL-10 level was increased in the A. fumigatus stimulated-macrophages. However, IL-1β, TNF-α and IL-6 levels were upregulated after pretreatment of CGRP8-37. But the mRNA levels of MIP-2, TGF-β and IL-10 were not changed. CONCLUSION: This study provides evidence that A. fumigatus increased CGRP expression. CGRP may play a protective role against inflammation in A. fumigatus keratitis.

Disparate expression of autophagy in corneas of C57BL/6 mice and BALB/c mice after Aspergillus fumigatus infection

2019/3/27 0:00:00
AIM: To determine the disparate expression of autophagy in the Aspergillus fumigatus (A. fumigatus) keratitis between susceptible C57BL/6 mice and resistant BALB/c mice. METHODS: C57BL/6 and BALB/c mice were used to establish fungal keratitis models. Disease severity and inflammatory response were observed by slit lamp microscopy in A. fumigatus-infected corneas of C57BL/6 and BALB/c mice at 1, 3 and 5d. Hematoxylin-eosin (H&E) staining was used to detect pathological changes of corneas. The expression of autophagy-related proteins Beclin-1, LC3, SQSTM1/p62, and LAMP-1 was assessed by Western blot in C57BL/6 and BALB/c mice at 1, 3 and 5d post infection (p.i.). Immunofluorescent staining was used to test the expression of LC3 in corneas after A. fumigatus infection. RESULTS: Keratitis severity was higher in C57BL/6 mice versus BALB/c mice at 1, 3 and 5d p.i. H&E staining showed that the number of inflammatory cells was larger and the severity of ulcer was higher in C57BL/6 mice than in BALB/c mice after stimulation with A. fumigatus. Higher expression of LAMP-1, Beclin-1, and LC3 was shown in C57BL/6 mice corneas than in BALB/c mice corneas at 1, 3 and 5d p.i., while the expression of p62 was lower in C57BL/6 mice. The fluorescence of LC3 was significantly increased in corneas of C57BL/6 mice compared with BALB/c mice after A. fumigatus infection. CONCLUSION: The expression of autophagy is higher in corneas of C57BL/6 mice than in BALB/c mice after A. fumigatus infection. Autophagy may be positively correlated with keratitis severity and pathological changes.

Expression of macrophage migration inhibitory factor in Aspergillus fumigatus keratitis

Qiang Xu, Li-Ting Hu, Qian Wang, Jing Lin, Nan Jiang, Cui Li and Gui-Qiu Zhao — 2019/3/27 0:00:00
AIM: To investigate the expression of macrophage migration inhibitory factor (MIF) and detect its role in the innate immune response of fungal keratitis (FK). METHODS: We collected the paraffin-embedded cornea tissues from 10 FK and 6 ocular trauma patients to explore the MIF expression by immunohistochemistry. Then we cultured telomease-immortalized human corneal epithelial cells (THCEs), stimulated by the hyphae suspension of Aspergillus fumigatus (A. fumigatus) to detect the change of MIF with or without the pretreatment of MIF inhibitor [4-Iodo-6-phenylpyrimidine (4-IPP)] by real-time polymerase chain reaction (PCR). The protein level of MIF was also tested by immunohistochemistry, and the level of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) mRNA were compared between normal, hyphae stimulated and 4-IPP pretreated groups by real-time PCR to study the influence of MIF on the expression of TNF-α and IL-6. Corneal severity of rats’ FK models was documented by clinical scores, and real-time PCR. Western blot and immunohistochemistry were used to test the expression of MIF, TNF-α and IL-6 in rats’ corneas. RESULTS: In the corneas of FK patients, there was much stronger expression of MIF than that in the normal group showed by immunohistochemistry. In cultured THCEs stimulated by A. fumigatus, the expression of MIF became stronger in both immunohistochemistry and PCR at 16, 24, 32 and 48h post infection (p.i.; P<0.01, P<0.01, P<0.01, P<0.05). After pretreated with 4-IPP, the expression of MIF reduced at 4, 8, 16h p.i. (P<0.05, P<0.05, P<0.05) and the downstream TNF-α and IL-6 decreased obviously (P<0.05, P<0.01). In rats with A. fumigatus keratitis, the relative mRNA and protein level of MIF increased than those in the normal group by PCR (at 1d: P<0.01, 3d: P<0.01, 5d: P<0.01), Western blot and immunohistochemistry. After blocked MIF with 4-IPP, the clinical outcomes of rat keratitis showed markedly reduced inflammatory response (P<0.01), with TNF-α and IL-6 decreased in accordance with those in THCEs by PCR (P<0.05, P<0.01). CONCLUSION: The expression of MIF increased significantly in FK patients, THCEs and rats stimulated by A. fumigatus. After blocked with 4-IPP, the expression of MIF reduced, and so did its downstream cytokines: TNF-α and IL-6. The inflammation reaction of the rats’ corneas lightened after pretreated with 4-IPP. MIF may play a role in the innate immune response of the corneal resistance against A. fumigatus.

Differentiation of human embryonic stem cells derived mesenchymal stem cells into corneal epithelial cells after being seeded on decellularized SMILE-derived lenticules

2019/3/27 0:00:00
AIM: To evaluate the feasibility of mesenchymal stem cells (MSCs) to differentiate into corneal epithelial cells after being seeded on the decellularized small incision lenticule extraction (SMILE)-derived lenticules. METHODS: The fresh lenticules procured from patients undergoing SMILE for the correction of myopia were decellularized. The MSCs were subsequently cultivated on those denuded lenticules. The MSCs without lenticules were used as a control. The proliferation activity of the MSCs after seeding 24h was quantitatively determined with the Cell Counting Kit-8 (CCK-8) assay. Immunofluorescence staining and quantitative reverse transcription polymerase chain reaction (qRT-PCR) were used to assess the marker expression in differentiated MSCs. RESULTS: The data showed that both fresh and decellularized lenticules could significantly promote the proliferation of MSCs, compared to that in control (P=0.02 for fresh lenticules, P=0.001 for decellularize ones, respectively). The MSCs seeded on both lenticules were positive for cytokeratin 3 (CK3) staining. The expression of CK3 increased 5-fold in MSCs seeded on fresh lenticules and 18-fold on decellularized ones, compared to that in control. There was a significant difference in the expression of CK3 in MSCs seeded on fresh and decellularized lenticules (P<0.001). The expression of CK8 and CK18 was similar in pure MSCs and MSCs seeded on fresh lenticules (P>0.05), while the expression of these markers was decreased in MSCs seeded on decellularized ones. CONCLUSION: These results suggest that the decellularized lenticules might be more suitable for MSCs to differentiate into corneal epithelial cells, which offers the prospect of a novel therapeutic modality of SMILE-derived lenticules in regenerative corneal engineering.

A novel mutation in FBN1 gene in autosomal dominant Marfan syndrome and macular degeneration in a Chinese consanguineous family

Ping-Bo Ouyang, Yuan Zhao, Ying-Qian Peng, Lu-Si Zhang, Jian Cao and Yun Li — 2019/3/27 0:00:00
AIM: To report a novel mutation in FBN1 gene in a Chinese consanguineous family with common Marfan syndrome (MFS) phenotype and an unusual bilateral macular degeneration. METHODS: Ophthalmic, cardiovascular and systemic examinations were performed, and genomic DNA extracted from all living family members. The 24-32 exon mutations of FBN1 gene were screened by Sanger Sequencing in all family members and 100 unrelated healthy Chinese individuals. RESULTS: In the four-generation family, classic MFS phenotypes were observed in all 5 patients, 2 of them had peculiar phenotype of bilateral macular degeneration. Mutation screening in FBN1 identified a heterozygous missense mutation (c.3932A>G, p.Y1311C) with co-segregation. This mutation was found with the MFS phenotypes in all 5 patients but not in unaffected members or unrelated controls. CONCLUSION: A Chinese consanguineous MFS family with uncommon bilateral macular degeneration and an unreported c.3932A>G mutation in FBN1 was identified. Our finding expands the FBN1 mutation spectrum and its possible role in the pathogenesis of Marfan syndrome.

Effect of etanercept on post-traumatic proliferative vitreoretinopathy

Xiao-Feng Chen, Mei Du, Xiao-Hong Wang and Hua Yan — 2019/3/27 0:00:00
AIM: To evaluate the safety and efficacy of intravitreal etanercept in the inhibiting of proliferative vitreoretinopathy (PVR) in a model of penetrating ocular injury. METHODS: Penetrating ocular injury on the retina of rabbit was induced, which was subsequently treated using 0.1 ?mL of sterile water or 0.1? mL of 12.5 mg/mL etanercept. The development of PVR was evaluated by fundus images, the B-scan, and the histopathology. The mRNA and protein expressions of tumor necrosis factor-α (TNF-α), transforming growth factor β (TGF-β) as well as connective tissue growth factor (CTGF) were examined at various time points after the etanercept injection with the reverse transcriptase-polymerase chain reaction (RT-PCR) and Western blotting, respectively. The safety of etanercept was evaluated by injection of 12.5 mg/mL etanercept into a normal rabbit eye without penetrating trauma. RESULTS: Clinical assessment and grading clearly demonstrated that the PVR formation was prevented in etanercept-treated animals, which was confirmed via fundus images, B-scan and histopathology. The RT-PCR and Western blotting showed increased mRNA and protein expression of TNF-α, TGF-β as well as CTGF in the retina of rabbits following penetrating ocular injury, and these factors were dramatically mitigated by ocular etanercept treatment. In addition, there was no adverse effect of etanercept intravitreal injection in normal eyes without penetrating trauma, it showed normal structure and histology. CONCLUSION: The etanercept is a potential therapy for inhibiting PVR development. To assess the clinic application of the etanercept in preventing PVR, further clinical studies are required.

Identification of altered microRNAs in retinas of mice with oxygen-induced retinopathy

2019/3/27 0:00:00
AIM: To identify disease-related miRNAs in retinas of mice with oxygen-induced retinopathy (OIR), and to explore their potential roles in retinal pathological neovascularization. METHODS: The retinal miRNA expression profile in mice with OIR and room air controls at postnatal day 17 (P17) were determined through miRNA microarray analysis. Several miRNAs were significantly up- and down-regulated in retinas of mice with OIR compared to controls by quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR). Two databases including Targetscan7.1 and MirdbV5 were used to predict target genes that associated with those significantly altered miRNAs in retinas of mice with OIR. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analyses were also conducted to identify possible biological functions of the target genes. RESULTS: In comparison with room air controls, 3 and 8 miRNAs were significantly up- and down-regulated, respectively, in retinas of mice with OIR. The qRT-PCR data confirmed that mmu-miR-350-3p and mmu-miR-202-3p were significantly up-regulated, while mmu-miR-711 and mmu-miR-30c-1-3p were significantly down-regulated in mice with OIR compared to controls. GO analysis demonstrated that the identified target genes were related to functions such as cellular macromolecule metabolic process. KEGG pathway analysis showed a group of pathways, such as Wnt signaling pathway, transcriptional misregulation in cancer, Mucin type O-glycan biosynthesis, and mitogen-activated protein kinase (MAPK) signaling pathway might be involved in pathological process of retinal neovascularization. CONCLUSION: Our findings suggest that the differentially expressed miRNAs in retinas of mice with OIR might provide potential therapeutic targets for treating retinal neovascularization.

Dose-dependent effects of NMDA on retinal and optic nerve morphology in rats

2019/3/27 0:00:00
AIM: To investigate dose-dependent effects of N-methyl-D-aspartate (NMDA) on retinal and optic nerve morphology in rats. METHODS: Sprague Dawley rats, 180-250 g in weight were divided into four groups. Groups 1, 2, 3 and 4 were intravitreally administered with vehicle and NMDA at the doses 80, 160 and 320 nmol respectively. Seven days after injection, rats were euthanized, and their eyes were taken for optic nerve toluidine blue and retinal hematoxylin and eosin stainings. The TUNEL assay was done for detecting apoptotic cells. RESULTS: All groups treated with NMDA showed significantly reduced ganglion cell layer (GCL) thickness within inner retina, as compared to control group. Group NMDA 160 nmol showed a significantly greater GCL thickness than the group NMDA 320 nmol. Administration of NMDA also resulted in a dose-dependent decrease in the number of nuclei both per 100 μm GCL length and per 100 μm2 of GCL. Intravitreal NMDA injection caused dose-dependent damage to the optic nerve. The degeneration of nerve fibres with increased clearing of cytoplasm was observed more prominently as the NMDA dose increased. In accordance with the results of retinal morphometry analysis and optic nerve grading, TUNEL staining demonstrated NMDA-induced excitotoxic retinal injury in a dose-dependent manner. CONCLUSION: Our results demonstrate dose-dependent effects of NMDA on retinal and optic nerve morphology in rats that may be attributed to differences in the severity of excitotoxicity and oxidative stress. Our results also suggest that care should be taken while making dose selections experimentally so that the choice might best uphold study objectives.

Hydrogen sulfide intervention in cystathionine-β-synthase mutant mouse helps restore ocular homeostasis

2019/3/27 0:00:00
AIM: To investigate the applications of hydrogen sulﬁde (H2S) in eye-specific ailments in mice. METHODS: Heterozygous cystathionine-β-synthase (CBS+/-) and wild-type C57BL/6J (WT) mice fed with or without high methionine diet (HMD) were administered either phosphate buffered saline (PBS) or the slow-release H2S donor: GYY4137. Several analyses were performed to study GYY4137 effects by examining retinal lysates for key protein expressions along with plasma glutamate and glutathione estimations. Intraocular pressure (IOP) was monitored during GYY4137 treatment; barium sulfate and bovine serum albumin conjugated fluorescein isothiocyanate (BSA-FITC) angiographies were performed for examining vasculature and its permeability post-treatment. Vision-guided behavior was also tested employing novel object recognition test (NORT) and light-dark box test (LDBT) recordings. RESULTS: CBS deficiency (CBS+/-) coupled with HMD led disruption of methionine/homocysteine (Hcy) metabolism leading to hyperhomocysteinemia (HHcy) in CBS+/− mice as reflected by increased Hcy, and s-adenosylhomocysteine hydrolase (SAHH) levels. Unlike CBS, cystathionine-γ lyase (CSE), methylenetetrahydrofolate reductase (MTHFR) levels which were reduced but compensated by GYY4137 intervention. Heightened oxidative and endoplasmic reticulum (ER) stress responses were mitigated by GYY4137 effects along with enhanced glutathione (GSH) levels. Increased glutamate levels in CBS+/− strain were prominent than WT mice and these mice also exhibited higher IOP that was lowered by GYY4137 treatment. CBS deficiency also resulted in vision-guided behavioral impairment as revealed by NORT and LDBT findings. Interestingly, GYY4137 was able to improve CBS+/− mice behavior together with lowering their glutamate levels. Blood-retinal barrier (BRB) appeared compromised in CBS+/− with vessels’ leakage that was mitigated in GYY4137 treated group. This corroborated the results for occludin (an integral plasma membrane protein of the cellular tight junctions) stabilization. CONCLUSION: Findings reveal that HHcy-induced glutamate excitotoxicity, oxidative damage, ER-stress and vascular permeability alone or together can compromise ocular health and that GYY4137 could serve as a potential therapeutic agent for treating HHcy induced ocular disorders.

Identification of pathogenic genes of pterygium based on the Gene Expression Omnibus database

Xiao-Li Yue and Zi-Qing Gao — 2019/3/6 0:00:00
AIM: To identify the pathogenic genes in pterygium. METHODS: We obtained mRNA expression profiles from the Gene Expression Omnibus database (GEO) to identify differentially expressed genes (DEGs) between pterygium tissues and normal conjunctiva tissues. The Gene Ontology, Kyoto Encyclopedia of Genes and Genomes pathway analysis, protein-protein interaction (PPI) network and transcription factors (TFs)-target gene regulatory network was performed to understand the function of DEGs. The expression of selected DEGs were validated by the quantitative real-time polymerase chain reaction (qRT-PCR). RESULTS: A total of 557 DEGs were identified between pterygium and normal individual. In PPI network, several genes were with high degrees such as FN1, KPNB1, DDB1, NF2 and BUB3. SSH1, PRSS23, LRP5L, MEOX1, RBM14, ABCA1, JOSD1, KRT6A and UPK1B were the most downstream genes regulated by TFs. qRT-PCR results showed that FN1, PRSS23, ABCA1, KRT6A, ECT2 and SPARC were significantly up-regulated in pterygium and MEOX1 and MMP3 were also up-regulated with no significance, which was consistent with the our integrated analysis. CONCLUSION: The deregulated genes might be involved in the pathology of pterygium and could be used as treatment targets for pterygium.

Rapamycin liposome gutta inhibiting fungal keratitis of rats

2019/3/6 0:00:00
AIM: To study the therapeutic effect of rapamycin liposome eyedrops on fungal keratitis (FK) and its effect on the expression of monocyte chemotactic protein-1 (MCP-1). METHODS: This study adopted the thin film dispersion method to prepare rapamycin liposomes eyedrops, as well as used the orthogonal design to analyze and study main influencing factors that affected the quality of liposomes. Totally 96 healthy Wistar rats were randomly divided into four groups: normal control group (A), FK blank control group (B), FK blank liposomes control group (C), and 30 FK rapamycin liposome treatment group (D). Groups B, C, and D were first prepared as FK animal models. The corneal response was recorded in details on day 1, 3, 5, 7, and 14 after modeling. Six rats were obtained and immunohistochemistry and semi-quantitative reverse transcription polymerase chain reaction (RT-PCR) were used to detect the expression of MCP-1 protein and mRNA, respectively. RESULTS: The severity of corneal lesions in the rapamycin treatment group was reduced, and the clinical score of the slit lamp examination was lower than that of Groups B and C (P<0.01). The expression of MCP-1 in rapamycin treatment group was significantly inhibited, comparing to that of groups B and C (P<0.01). CONCLUSION: Liposome is a good drug carrier for rapamycin. Rapamycin has a good therapeutic effect on FK. It can reduce FK fungal burden and significantly inhibit the expression of MCP-1 protein and mRNA.

Effects of chronic elevated intraocular pressure on parameters of optical coherence tomography in rhesus monkeys

2019/3/6 0:00:00
AIM: To determine the progression of parameters from optical coherence tomography (OCT) in chronic elevated intraocular pressure (IOP) monkeys. METHODS: A chronic elevated IOP model of rhesus monkeys was induced by laser photocoagulation. Representative OCT parameters, including the average and four-quadrant retinal nerve fiber layer (RNFL) thickness, and parameters from optic nerve head (ONH) analysis were collected before and after laser treatments biweekly for up to 28wk. The performance of each parameter for early progression detection was analyzed. The progressive trends toward elevated IOP were analyzed using a linear mixed-effects model. RESULTS: There were 10 successfully maintained high IOP eyes in 7 monkeys. The follow-up time was 24±5.37wk. With cumulative IOP elevation, the cup area, rim area and C/D area ratio were statistically significantly changed as early as 2wk after elevated IOP induction (P<0.05). The quadrant RNFL thickness changed at 6wk after high IOP induction, and the superior and inferior RNFL thicknesses exhibited more obvious reductions than other quadrants. The average RNFL thickness was the last one to show a significant decrease at 8wk. CONCLUSION: The parameters of ONH are most sensitive to elevated IOP in a primate glaucomatous model. These findings suggest that we should focus on those parameters instead of RNFL thickness in patients with elevated IOP, as they might present with earlier glaucomatous changes.

Role of the IL-33/ST2/p38 signaling pathway in the immune response of corneal epithelial cells to Aspergillus fumigatus infection

2019/3/6 0:00:00
AIM: To investigate the expression of interleukin (IL)-33 in the cornea and human corneal epithelial cells (HCECs) exposed to Aspergillus fumigatus (A. fumigatus), and to determine the function of IL-33/ST2/p38 signaling pathway in the immune response of corneal epithelial cells to A. fumigatus infection. METHODS: The mRNA and protein expression of IL-33 in HCECs and mice corneas were examined by quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) and Western blot analysis, respectively. IL-33 expression was also detected in cornea samples from healthy donors and patients with fungal keratitis with immunohistochemistry. The cultured HCECs were treated with inactive A. fumigatus hyphae at various concentrations with or without recombinant human IL-33 protein, soluble recombinant ST2 protein, specific ST2 neutralizing antibody, or the mitogen-activated protein kinase (MAPK) p38 inhibitor SB203580 for evaluation of the expression and activation of IL-33/ST2/p38 signaling in the regulation of proinflammatory cytokines. The production levels of IL-6 and IL-1β were determined by qRT-PCR and enzyme-linked immunosorbent assay (ELISA). The proliferation of HCECs was determined by a Cell Counting Kit-8 (CCK8) assay and cell count. RESULTS: IL-33 expression levels increased in the corneal tissues of patients with fungal keratitis and in mice corneas of experimental A. fumigatus infection, as well as in HCECs with infection of A. fumigatus. A. fumigatus strongly stimulated HCECs-generated proinflammatory cytokine (IL-6 and IL-1β) production at both the mRNA and protein levels. This production of pro-inflammatory mediators stimulated by A. fumigatus was further stimulated by IL-33 and was prevented by soluble ST2 protein or ST2 neutralizing antibody. Moreover, IL-33 naturally promoted the p38 phosphorylation induced by A. fumigatus, which was suppressed by soluble ST2 protein. The MAPK p38 inhibitor SB203580 also inhibited the A. fumigatus-induced proinflammatory cytokine production. IL-33 administration for 48h and 72h promoted the proliferation of HCECs, which was attenuated by treatment with soluble recombinant human ST2 protein. CONCLUSION: A. fumigatus elevates IL-33 expression in human and mice corneas and HCECs. Thus, IL-33/ST2/p38 signaling may play an important role in amplifying the immune response of corneal epithelial cells to A. fumigatus infection. Besides, IL-33 promotes the cell proliferation of HCECs via its receptor ST2. These findings suggest a novel autocrine mechanism of amplification of the fungal-induced inflammatory response in the corneal epithelium, highlighting a potential therapeutic target for fungal keratitis.

Autophagy: a new mechanism for regulating VEGF and PEDF expression in retinal pigment epithelium cells

Rong Li, Jun-Hui Du, Guo-Min Yao, Yang Yao and Jin Zhang — 2019/3/6 0:00:00
AIM: To investigate the regulation of vascular endothelial growth factors (VEGF) and pigment epithelium-derived factor (PEDF) expression by autophagy in retinal pigment epithelium (RPE) cells on exposure to hypoxia. METHODS: ARPE-19, an RPE cell line, was treated as following: the control group was kept in a normoxic incubator; the hypoxia group was incubated in a hypoxic incubator with 1% O2/5% CO2/94% N2 for 24h; the hypoxia + 3-methyladenine (3-MA) group was pretreated with 10 mmol/L 3-MA for 1h and then in the hypoxic incubator for 24h; and the hypoxia + chloroquine (CQ) group was pretreated with 50 μmol/L CQ for 1h and then in the hypoxic incubator for 24h. The morphology and ultrastructure of the cells was observed by an inverted microscope or a transmission electronic microscope (TEM). Western blot was performed to assay the expression of autophagy-associated markers, including microtubule associated protein 1 light chain 3 B (LC3B), Beclin-1, Atg5 and p62. The concentration of VEGF and PEDF in the culture supernatant was determined by ELISA, and the ratio of VEGF/PEDF was calculated. RESULTS: There were no obvious differences in cell morphology among different groups and autolysosomes could be observed in the cytoplasm in all groups. Compared to the control cells, the LC3B-II/I ratio and levels of Beclin-1 and Atg5 were significantly increased and p62 level was significantly decreased in the hypoxia group. With the increase of VEGF and decrease of PEDF concentration, the VEGF/PEDF ratio was significantly increased in the hypoxia group compared to the control cells. The LC3B-II/I ratio was significantly reduced by 3-MA treatment and increased by CQ treatment. The expressions of Beclin-1 and Atg5 were significantly reduced by 3-MA or CQ treatment, while expression of p62 was increased in the 3-MA or CQ treated cells. The concentration of VEGF was significantly decreased and PEDF increased, thereby the VEGF/PEDF ratio was decreased in the hypoxia + 3-MA group and hypoxia + CQ group compared with that in the hypoxia group. CONCLUSION: Hypoxia leads to elevated autophagy in RPE cells, and expression of VEGF and PEDF might be regulated by autophagy on exposure to hypoxia to further participate in regulating the formation of retinal neovascularization.

A novel xeno-free culture system for human retinal pigment epithelium cells

Han Shen, Min Wang, Duo Li, Song-Tao Yuan and Qing-Huai Liu — 2019/3/6 0:00:00
AIM: To find out an animal-free, xeno-free culture method for human fetal retinal pigment epithelium (fRPE) cells aiming for cell-replacement therapy. METHODS: Human AB serum, knock-out serum replacement (KSR) and B27 were supplemented as a substitute of fetal bovine serum (FBS) in culture medium of human fRPE cells. Cell morphology was examined by light microscope and transmission electron microscope. Proliferation ability was detected by cell cycle analysis and examination of KI67 expression. Apoptosis was analyzed using FACS. The expression of RPE-specific markers was demonstrated by quantitative real-time polymerase chain reaction (qPCR), Western blot (WB) and immunocytochemistry. Paracrine function was determined using enzyme-linked immunosorbent assay method. RESULTS: Our results indicated that the optimum concentration of KSR was 15%, the optimum concentration of B27 was 2%, and the optimum concentration of human AB serum was 10%. fRPE cells cultured in 15% KSR and 2% B27 media showed repressed propagation and differentiation ability, and gradually lost epithelial morphology and RPE function. While fRPE cells cultured in 10% human AB serum media showed a typical cobblestone morphology with pigmentation, elevated proliferation ability, satisfying paracrine function and expressed RPE-specific markers. CONCLUSION: Our study indicates that culturing fRPE cells in 10% human AB serum-supplemented medium is more favorable compared with KSR, B27 and traditional FBS-supplemented mediums when fRPE cells are to be applied in cell-based therapy.

Neurofibromatosis type 2 gene mutation and progesterone receptor messenger RNA expression in the pathogenesis of sporadic orbitocranial meningioma

2019/3/6 0:00:00
AIM: To investigate neurofibromatosis type 2 (NF2) gene mutation at mRNA levels in sporadic orbitocranial meningioma and its association with progesterone receptor (PR) mRNA expression. METHODS: This was a case-control study. Thirty-four sporadic meningioma patients with no familial NF2-related meningioma history were recruited. They were interviewed for their obstetric, gynecologic, and contraception history. PR investigation was performed with real-time polymerase chain reaction (PCR). NF2 mutation was investigated using Qbiomarker Somatic Mutation PCR Assay at NF2 mRNA level after its cDNA extraction (four mRNA mutation cytoband coordinates for nucleotide change: c.634C>T/p.Q212, c.655G>A/p.V219M, c.784C>T/p.R262 and c.1228C>T/p. Q410). RESULTS: After mutation analysis at mRNA level, NF2 gene mutation was found in 35.29% patients. Non-mutation group was strongly associated with exogenous hormonal exposure (non-mutation vs mutation: 95.5% vs 83.3%, P<0.001). PR mRNA was found significantly lower in non-mutation group (P=0.033) which presumed as long term exogenous progesterone exposure. However, mutation group was associated with higher rate of progression to grade II (mutation vs non-mutation, 18.2% vs 5%, P<0.001) and was associated more in fibrous and anaplastic tumor tissue. CONCLUSION: NF2 mutation-meningioma is associated with higher grade of meningioma. Non NF2 mutation-meningioma is strongly associated with exogenous progesterone exposure and lower PR expression.

Construction of a full-thickness human corneal substitute from anterior acellular porcine corneal matrix and human corneal cells

Kai Zhang, Xiao-Xiao Ren, Ping Li, Kun-Peng Pang and Hong Wang — 2019/2/11 0:00:00
AIM: To construct functional human full-thickness corneal replacements. METHODS: Acellular porcine corneal matrix (APCM) was developed from porcine cornea by decellulariztion. The biomechanical properties of anterior-APCM (AAPCM) and posterior-APCM (PAPCM) were checked using uniaxial tensile testing. Human corneal cells were obtained by cell culture. Suspending ring was designed by deformation of an acupuncture needle. MTT cytotoxicity assay was used to check the cytotoxicity of suspending ring soaking solutions. A new three-dimensional organ culture system was established by combination of suspending ring, 48-well plate and medium together. A human full-thickness corneal substitute was constructed from human corneal cells with AAPCM in an organ coculture system. Biochemical marker expression of the construct was measured by immunofluorescent staining and morphological structures were observed using scanning electron microscopy. Pump function and biophysical properties were examined by penetrating keratoplasty and follow-up clinical observations. RESULTS: There were no cells in the AAPCM or PAPCM, whereas collagen fibers, Bowman’s membrane, and Descemet’s membrane were retained. The biomechanical property of AAPCM was better than PAPCM. Human corneal cells grew better on the AAPCM than on the PAPCM. There was no cytotoxicity for the suspending ring soaking solutions. For the constructed full-depth human corneal replacements keratocytes scattered uniformly throughout the AAPCM and expressed vimentin. The epithelial layer was located on the surface of Bowman’s membrane and composed of three or four layers of epithelial cells expressing cytokeratin 3. One layer of endothelial cells covered the stromal surface of AAPCM, expressed Na+/K+ATPase and formed the endothelial layer. The construct was similar to normal human corneas, with many microvilli on the epithelial cell surface, stromal cells with a long shuttle shape, and zonula occludens on the interface of endothelial cells. The construct withstood surgical procedures during penetrating keratoplasty. The corneal transparency increased gradually and was almost completely restored 7d after surgery. CONCLUSION: AAPCM is an ideal scaffold for constructing full-thickness corneal replacement, and functional human full-thickness corneal replacements are successfully constructed using AAPCM and human corneal cells.

Remodeled structure and reduced contractile responsiveness of ocular ciliary artery in spontaneously hypertensive rats

Ya-Ru Dong, Claire E Gustafson, Jun Wang, Ji-Zhe Cui and Takeshi Yoshitomi — 2019/2/11 0:00:00
AIM: To investigate the alterations in both structure and contractile responsiveness of ocular ciliary artery (OCA) in spontaneously hypertensive rat (SHR). METHODS: In this experiment, 20-week-old male SHR and Wistar Kyoto rat (WKY) were studied. The heart rate (HR), the blood pressure (BP; the systolic BP and the diastolic BP) of rats with an electronic sphygmomanometer were measured. Vascular morphometry and isometric tension measurement were used to investigate the alterations in structure and contractility of OCA. RESULTS: A general narrowing of OCAs was observed in SHR compared to the control WYK. In SHR, the media of OCAs were thicker, the luminal diameters were smaller, and the media-to-lumen ratios were higher when compared with WKY (P<0.05). The contractions of OCAs evoked by norepinephrine were smaller in SHR compared to control (P<0.05). Then, OCAs were pretreated with iberiotoxin, L-NAME, or indomethacin 30min before norepinephrine-induced contraction. Iberiotoxin (0.1 μmol/L) has not changed the norepinephrine-induced contractions in OCAs from both groups. However, L-NAME (100 μmol/L) increased the vasoconstrictions, the increased extents were similar in SHR and WKY (P>0.05). Indomethacin (10 μmol/L) decreased the contractions induced by norepinephrine in OCAs from WKY (P<0.05), but did not change those contractions in vessels from SHR (P>0.05). CONCLUSION: Our results demonstrate that the structure and function of OCAs are altered in hypertension. OCAs from SHR are remodeled with decreased lumen diameter and increased media-to-lumen ratio. Moreover, the contractile responsiveness of OCAs from SHR is diminished due to the disruption of vasoconstrictive effect of prostaglandins.

The protective effect of zeaxanthin on human limbal and conjunctival epithelial cells against UV-induced cell death and oxidative stress

Yue Huang, Chun Shi and Jing Li — 2019/2/11 0:00:00
AIM: To explore the protective effect of zeaxanthin on human limbal and conjunctival epithelial cells against UV-radiation and excessive oxidative stress. METHODS: Human limbal and conjunctival epithelial cells were isolated from cadaver and cultured in vitro. They were challenged with UVB radiation and H2O2 with and without zeaxanthin pretreatment. Cell viability, p38 and c-JUN NH(2)-terminal kinase (JNK) phosphorylation, IL-6, IL-8 and MCP-1 secretion and malondialdehyde (MDA) content were measured. RESULTS: Zeaxanthin had no measurable cytotoxicity on limbal or conjunctival epithelial cells when used at concentrations of 5 μg/mL and below. At 30 mJ/cm2 UVB, the pretreatment of zeaxanthin increased the percentage of live cells from 50% to 69% (P=0.01) and from 66% to 75% (P=0.05) for limbal and conjunctival epithelial cells, respectively. The concentrations of IL-6, IL-8 and MCP-1 in the culture medium reduced to 66% (for IL-6 and MCP-1) and 56% (for IL-8) of the levels without zeaxanthin. This was accompanied by reduced p38 and JNK protein phosphorylation. Pretreatment of zeaxanthin also reduced intracellular MDA content caused by H2O2 stimulation from 0.86 μmol/L to 0.52 μmol/L (P=0.02) in limbal epithelial cells and from 0.96 μmol/L to 0.56 μmol/L in conjunctival epithelial cells (P=0.03). However, zeaxanthin did not have significant effect on H2O2-induced cell death in limbal or conjunctival epithelial cells. CONCLUSION: Zeaxanthin is an effective reagent in reducing the detrimental effect of UV-radiation and oxidative stress on ocular surface epithelial cells.

Decreased uncoupling protein 2 expression in aging retinal pigment epithelial cells

Yuan He, Xia Wang, Xu Liu, Zhi Ji and Yuan Ren — 2019/2/11 0:00:00
AIM: To analyze the expression of uncoupling protein 2 (UCP2) in retinal pigment epithelium (RPE) cells at the different human age, further explore the possible new target of RPE cells protection. METHODS: Adult retinal pigment epithelial-19 (ARPE-19) cells and the primary RPE cells at the different age (9-20y, RESULTS: Cells from the donors more than 60y are larger and more fibroblastic in appearance compared to ARPE-19 cells and those primary cultures obtained from the younger individuals by using phase-contrast micrographs. Results of RT-PCR, Western blot and confocal microscopy all showed that UCP2 was highly expressed in ARPE-19 cells and in the younger primary cultured human RPE cells at the age of 9-20y and 50-55y, whereas lower expression of UCP2 was measured in the older primary cultured human RPE cells at the age more than 60y. CONCLUSION: Expression of UCP2 gene is decreased in aged RPE cells, promoting the lower ability of anti-oxidation in these cells. It is indicated that UCP2 gene might be a new target for protecting the cells from oxidative stress damage.

Effects of perfluorooctane on the retina as a short-term and small amounts remnant in rabbits

Qing-Chen Li, Jian Yu, Chun-Hui Jiang, Hao-Hao Zhu, Kun Liu and Jin-Chuan Zhao — 2019/2/11 0:00:00
AIM: To investigate changes in the rabbit retina after short-term and small amounts tamponade of perfluorooctane (PFO). METHODS: New Zealand rabbits were used, and 48 eyes were randomly and evenly assigned into four different groups. The PFO groups received a residue of 0.1 mL of PFO for ophthalmic surgery or 0.1 mL of F-Octane at the end of surgery; eyes from the pars plana vitrectomy (PPV) group were filled with balanced salt solution and those having not received surgical intervention served as controls. Eyes were collected at 1, 4 and 12wk and studied. RESULTS: Under a microscope, nuclear counts of the inner nuclear layer (INL) and outer nuclear layer (ONL) did not differ among the four groups at all time points; however, slight disarrangement of the ONL and occasional vacuolization of the INL were found in the inferior retina only at 12wk in two PFO groups. Four of the groups had similar results of Caspase-3 and TNF-α staining at all time points. Alternatively, IL-8 was increased in PFOa and PPV control groups at 4wk and in all three PPV groups at 12wk; also, the apoptotic index (%) was similarly increased in all three PPV groups at 4 and 12wk. CONCLUSION: Both PFOs are well tolerated in rabbit eyes for up to 12wk, which suggests that they can be used safely as intraoperative tools or for short-term and small amounts tamponade after surgery.

Effect of topical 0.05% cyclosporine A on the tear protein lacritin in a rat model of dry eye

Fen-Dui Zhang, Zhao-Qin Hao, Wei Gao and Yi-Qiao Xing — 2019/1/3 0:00:00
AIM: To observe the effect of topical 0.05% cyclosporine A (CsA) on the ocular surface and tear protein lacritin in a botulinum B-induced dry eye rat model. METHODS: A total of 36 female SD rats were randomly divided into 3 groups, botulinum B was injected into the right lacrimal gland of all rats. Group A and group B were treated with 0.05% CsA and 0.1% sodium hyaluronate, respectively, 3 times daily. The control group was not treated. Basal tear flow, corneal epithelial defects, and lacritin levels were measured. RESULTS: Tear secretion in all rats was reduced on day 3 and was even lower on day 7 postoperation (P<0.05). Tear secretion in group A increased by day 14 and was at the preoperative level on day 42. Tear secretion in group B and control rats was lower on days 14 and 42 compared with preoperative level (P<0.05). Corneal fluorescein staining in group A was higher on day 3, peaked on day 7, and then decreased gradually from day 7 until day 14, returning to normal by day 42 post-procedure. However, in group B, corneal fluorescein staining had improved, but was not fully recovered by day 42. Corneal fluorescein staining was more intense than before the operation and then in the control group at all time points. Tear protein lacritin levels reached the lowest levels on day 7 in all groups. In group A, tear protein lacritin levels began to increase on day 14 and were normal on day 42. In group B, tear protein lacritin levels began to increase on day 14, but had not completely recovered on day 42. In the control group, tear protein lacritin levels remained low post-procedure. CONCLUSION: CsA 0.05% prompts tear protein lacritin expression in a rat model of dry eye and improves the signs and symptoms of dry eye disease.

Conjunctival microbiome changes associated with fungal keratitis: metagenomic analysis

Cheng Ge, Chao Wei, Bao-Xia Yang, Jun Cheng and Yu-Sen Huang — 2019/1/3 0:00:00
AIM: To investigate the ocular surface microbiome profile of patients with fungal keratitis (FK) through bacterial 16S rDNA sequencing. METHODS: The swab samples were collected from 8 patients with FK (Group 1 from the corneal ulcer, Group 2 from the conjunctival sac of the infected eyes, and Group 3 from the conjunctival sac of the fellow eyes) and 10 healthy eyes (Group 4 from the conjunctival sac). Bacterial 16S rDNA V4-V5 region sequencing was performed to characterize the bacterial communities on the ocular surfaces of the patients with FK. RESULTS: Our metagenomic data showed that 97% of the sequence reads were categorized into 245 distinct bacterial genera, with 67.75±7.79 genera detected in Group 1, 73.80±13.44 in Group 2, 74.57±14.14 in Group 3, and 89.60±27.49 in Group 4. Compared with the healthy eyes (Group 4), both infected (Groups 1 and 2) and fellow eyes (Group 3) of the patients with FK showed reduced bacterial diversity and altered ocular surface microbiota compositions, with lower abundance of Corynebacterium and Staphylococcus and higher abundances of Pseudomonas, Achromobacter, Caulobacter and Psychrobacter. CONCLUSION: Our report depicts the altered ocular surface bacterial community structures both in the affected and fellow eyes of patients with FK. These changes may contribute to the pathogenesis of FK or the increased risk for FK.

Expression of visual system homeobox 1 in human keratoconus

2019/1/3 0:00:00
AIM: To investigate the expression of visual system homeobox 1 (VSX1) and myofibroblast marker alpha smooth muscle actin (α-SMA) in keratoconus (KC). METHODS: Thirty corneal tissue were collected from KC patients after corneal transplantation and 15 normal donor corneas were obtained. All corneal tissues divided into 4 parts for different detections. Scanning electron microscopy was used to observe the ultrastructure of the specimens. VSX1 and α-SMA localization in cornea tissues was detected using immunofluorescence histochemistry. Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) and Western blot were performed to analyze the expression level of VSX1 and α-SMA. RESULTS: Compared to normal cornea tissue, the collagen fibers in KC stroma were distortional and attenuated and keratocytes were abnormally changed. VSX1 and α-SMA located in the corneal stroma. The mRNA and protein expression level of VSX1 in KC were about 3 times as high as that of normal tissue (P<0.001). α-SMA was hardly expressed in the normal corneas, however, its expression in the KC was about 1.5 times higher than that of the normal corneas (P<0.0001). CONCLUSION: Compared with normal corneal the expression of VSX1 and α-SMA in KC both increased. VSX1 is related to the activation of keratocytes and involved in the pathogenesis of keratoconus.

Th lymphocyte subsets in patients with Vogt-Koyanagi-Harada disease

Liang Liang, Xiao-Yan Peng and Hong Wang — 2019/1/3 0:00:00
AIM: To assess helper T (Th) lymphocyte subset balance in patients with Vogt-Koyanagi-Harada (VKH) disease. METHODS: Sixty-eight active VKH patients and seventy-two inactive VKH patients were included in this study. One hundred healthy individuals served as controls. Peripheral blood was obtained from VKH patients and healthy controls. Th lymphocyte subsets were analyzed by flow cytometry. Plasma concentration of interleukin (IL)-17, IL-10, transforming growth factor (TGF)-β, IL-23 and IL-6 was examined by enzyme-linked immunosorbent assay (ELISA). RESULTS: VKH patients with active uveitis had significantly higher percentages of both Th1 and Th17 cells and lower percentages of regulatory T (Treg) cells as compared with inactive VKH patients and healthy controls. Th1/Th2 and Th17/Treg ratios were also significantly elevated in active VKH patients. The percentages of Th1, Th17 and Treg cells and the Th1/Th2, Th17/Treg ratio did not differ between inactive VKH patients and healthy controls. There was no difference concerning the percentage of Th2 cells among all the groups. VKH patients with active uveitis showed an elevated level of peripheral Th17 related cytokines levels (TGF-β, IL-6, IL-23, and IL-17) and a decreased level of Treg related cytokines (IL-10) compared with inactive VKH patients and healthy controls. Inactive VKH patients showed no differences in peripheral Th17 related cytokines (TGF-β, IL-6, IL-23, and IL-17) and Treg related cytokines (IL-10) levels compared with healthy controls. CONCLUSION: Th1 and Th17 cells are significantly increased and Treg cells significantly decreased in active VKH compared with inactive VKH or healthy controls. Therefore, Th lymphocyte subset analysis may serve as a disease biomarker for VKH.

Attenuation of periostin in retinal Müller glia by TNF-α and IFN-γ

2019/1/3 0:00:00
AIM: To investigate the regulation and mechanisms of periostin expression in retinal Müller glia, and to explore the relevance to retinal neovascularization. METHODS: The oxygen-induced retinopathy (OIR) mouse model and the human Moorfield/Institute of Ophthalmology-Müller 1 (MIO-M1) cell line were used in the study. Immunofluorescence staining was used to determine the distribution and expression of periostin and a Müller glial cell marker glutamine synthetase (GS). Cytokines TNF-α and IFN-γ were added to stimulate the MIO-M1 cells. ShRNA was used to knockdown periostin expression in MIO-M1 cells. Quantitative real-time reverse transcription polymerase chain reaction (qRT-PCR) was conducted to assess the mRNA expression of periostin. RESULTS: Immunofluorescence staining showed that periostin was expressed by MIO-M1 Müller glia. GS-positive Müller glia and periostin increased in OIR retinas, and were partially overlaid. The stimulation of TNF-α and IFN-γ reduced the mRNA expression of periostin significantly and dose-dependently in MIO-M1 cells. Knockdown of periostin reduced mRNA expression of vascular endothelial growth factor A (VEGFA) in MIO-M1 cells, while VEGFA expression was not changed in periostin knock-out OIR retinas. CONCLUSION: Müller glia could be one of the main sources of periostin in the retina, and might contribute to the pathogenesis of retinal neovascularization. Proinflammatory cytokines TNF-α and IFN-γ attenuate the periostin expression in retinal Müller glia, which provides a potential and novel method in treating retinal neovascular diseases.

5-aza-2’-deoxycytidine in the regulation of antioxidant enzymes in retinal endothelial cells and rat diabetic retina

Man-Yun Xie, Yan Yang, Ping Liu, Yan Luo and Shi-Bo Tang — 2019/1/3 0:00:00
AIM: To investigate the roles of a DNA methyltransferase (DNMT) inhibitor 5-aza-2’-deoxycytidine (5-aza-dC) in the regulation of antioxidant enzymes in diabetic retinopathy (DR) models. METHODS: DNMTs expressions and activity, and changes of two key antioxidant enzymes in DR, MnSOD (encoded by SOD2 gene) and glutathione S-transferase theta 1 (GSTT1), were quantified in the isolated human retinal endothelial cells (HRECs) exposed to high glucose (HG) with or without 5-aza-dC treatment. The downstream exacerbating factors including vascular endothelial growth factor (VEGF), intercellular adhesion molecule 1 (ICAM-1) and matrix metalloproteinase 2 (MMP2), which are implicated in the pathogenesis of DR and closely related to oxidative stress were also analyzed. The key parameters were confirmed in the retina from streptozotocin (STZ) diabetic rats. RESULTS: DNMTs expression and DNMT activity was induced in HRECs exposed to HG. Hyperglycemia decreased MnSOD and GSTT1 expression. 5-aza-dC administration effectively suppressed DNMTs expression and activity and reversed the MnSOD and GSTT1 expression under HG condition. VEGF, ICAM-1 and MMP2 induced by HG were also suppressed by 5-aza-dC treatment. Similar results were observed in the retina from STZ diabetic rats. CONCLUSION: Our findings suggest that DNA methylation may serves as one of the mechanisms of antioxidant defense system disruption in DR progression. Modulation of DNA methylation using pharmaceutic means such as DNMT inhibitors could help maintain redox homeostasis and prevent further progression of DR.

Two novel variants in CYP1B1 gene: a major contributor of autosomal recessive primary congenital glaucoma with allelic heterogeneity in Pakistani patients

2019/1/3 0:00:00
AIM: To find the CYP1B1 mutations associated with primary congenital glaucoma (PCG) in Pakistani consanguineous pedigrees. METHODS: After getting informed consent, 11 consanguineous pedigrees belonging to different ethnic groups were enrolled. Detailed medical history was recorded and pedigrees were drawn. The standard ophthalmological examination was done to characterize the phenotype. Genomic DNA was extracted from 10 mL whole blood and coding exons and exon intron boundaries of CYP1B1 gene were directly sequenced. Bioinformatics tools were used to model the mutant protein and predict the effect of novel variants on protein structure and function. RESULTS: Sequencing analysis revealed 5 different CYP1B1 variants in 7 families (7/11; 64%), including two novel variants. A common mutation, p.R390H was found in four families, whereas p.P437L was found once in a family. Two novel variants, a homozygous non sense variant p.L13* and a compound heterozygous variant, p.P350T along with p.V364M were segregating with PCG in two families. All the patients had the variable onset and severity of the disease. The success rate of early clinical interventions was observed dependent on mutation types and position. Two different haplotypes were associated with frequently found mutation, p.R390H. CONCLUSION: Identification of novel CYP1B1 variants reassert the genetic heterogeneity of Pakistani PCG patients. The patients with missense mutations show severe phenotypic presentations and poor vision after surgical interventions as compare to patients with null variants. This may help to better understand the role of CYP1B1 mutations in the development of PCG and its course of pathogenicity.

Metabolic profile analysis of free amino acids in experimental autoimmune uveoretinitis rat plasma

Jun-Guo Guo, Xin-Miao Guo, Xing-Rong Wang, Jing-Zhen Tian and Hong-Sheng Bi — 2019/1/3 0:00:00
AIM: To determine the differences of amino acid (AA) levels in experimental autoimmune uveoretinitis (EAU). METHODS: AA analysis of the plasma samples in EAU rats induced by interphotoreceptor retinoid-binding protein emulsion were performed with high performance liquid chromatography (HPLC) and phenylisothiocyanate (PITC) pre-column derivation methods were performed. Using partial least squares discriminant analysis (PLS-DA), the potential biomarkers were identified in EAU rat plasma, and the metabolic pathways related to EAU were further analyzed. RESULTS: The method results showed that linear (r≥0.9957), intra-day reproducible [relative standard deviation (RSD)=0.04%-1.33%], inter-day reproducible (RSD=0.06%-2.07%), repeatability (RSD=0.03%-0.89%), stability (RSD=0.05%-2.48%) and recovery (RSD=1.98%-4.39%), with detection limits of 0.853-11.4 ng/mL. The metabolic profile in EAU rats was different from that in the control groups five AAs concentrations were increased and nine AAs were reduced. Moreover, five metabolic pathways were related to the development of EAU. CONCLUSION: The developed method is a simple, rapid and convenient for determination of AAs in EAU rat plasma, and these findings will provide a comprehensive insight on the metabolic profiling of the pathological changes in EAU.

TNF-α gene polymorphisms: association with age-related macular degeneration in Russian population

2019/1/3 0:00:00
AIM: To study polymorphisms in promotor regions of tumor necrosis factor (TNF)-α TNF-863A/C (rs1800630), TNF-308A/G (rs1800629), and TNF-238A/G (rs361525) in patients with age-related macular degeneration (AMD) and associations of complex TNF-α genotypes with AMD. METHODS: One hundred and two patients (82 women, 20 men; mean age 64.2±1.2y) with AMD and 100 healthy age- and sex-matched controls (82 women, 18 men; 60±1.4y) were included in the study. All subjects were Caucasian, all subjects and their parents were inhabitants of Russia. Genomic DNA was obtained from EDTA-preserved blood using the standard phenol-chloroform method. Polymorphisms were detected by polymerase chain reaction followed by the restriction fragment length polymorphism method. The following TNF-α genotypes were studied: TNF-α-238 AA, GA, GG, TNF-α-308 AA, GA, GG, TNF-α-863 AA, CA, CC. RESULTS: Differences in TNF-α-863 and TNF-α-238 genotypes frequencies in patients with AMD and healthy controls were not found. The distribution of TNF-α-308 AA and TNF-α-308 GA genotypes was significantly different between the studied group and the controls [odds ratios (OR) =0.22, P=0.0287 and OR=2.91, P=0.0063, respectively]. TNF-863CC/TNF-308GA and TNF-308GA/TNF-238GG genotypes were associated with the increased risk of AMD (OR=2.48, P=0.0332 and OR=2.51, P=0.0187, respectively). Five genotypes combinations appeared to be protective. CONCLUSION: In the present study, single nucleotide polymorphisms and complex polymorphisms of one of the key inflammatory cytokines TNF-α, and a number of significant associations of these polymorphisms with AMD in Russian population have been shown. Complex analysis of genotypes could be important in AMD risk factors detection and studying pathogenesis.

Genome-wide DNA hypermethylation and homocysteine increase a risk for myopia

2019/1/3 0:00:00
AIM: To test for the association between genome-wide methylation and myopia in human and mice. METHODS: Long interspersed nucleotide element 1 (LINE-1) methylation levels were used to surrogate genome-wide methylation level. We first tested for the association between high myopia (<-6 D) and LINE-1 methylation in leukocytes in 220 cases and 220 control subjects. Secondly, we validated the results of LINE-1 methylation in eyes from the form deprivation myopia (FDM) mice. Furthermore, we calculated the correlation of LINE-1 methylation levels between leukocyte DNA and ocular DNA in the mice. We also tested whether dopamine can alter LINE-1 methylation levels. RESULTS: The LINE-1 methylation level was significantly higher in the myopic human subjects than controls. The upper and middle tertiles of the methylation levels increased an approximately 2-fold (P≤0.002) risk for myopia than the lower tertile. Similarly, FDM mice had high LINE-1 methylation levels in the leukocyte, retina and sclera, and furthermore the methylation levels detected from these three tissues were significantly correlated. Immunohistochemical staining revealed higher levels of homocysteine and methionine in the rodent myopic eyes than normal eyes. Dopamine treatment to the cells reduced both LINE-1 methylation and DNA methyltransferase levels. CONCLUSION: LINE-1 hypermethylation may be associated with high myopia in human and mice. Homocysteine and methionine are accumulated in myopic eyes, which may provide excess methyl group for genome-wide methylation.

Riboflavin/ultraviolet A-induced collagen cross-linking in rabbit corneal scar

You-Huan Cai, Tai-Xiang Liu and Hai-Xiang Li — 2019/1/3 0:00:00
AIM: To evaluate the biomechanical stability of the corneal scar treating with riboflavin and ultraviolet A (UVA). METHODS: Totally 86 New Zeal rabbits were divided into control group (group A, n=8) and trauma groups [group B (n=27), group C (n=24) and group D (n=27)]. Then groups B, C and D were divided into three sub-groups according to the time points of sacrifice, i.e. groups Ba, Ca and Da (4wk, n=8); Bb, Cb and Db (6wk, n=8); Bc (n=11), Cc (n=8) and Dc (8wk, n=11). The right corneas of these 78 rabbits in the trauma groups were penetrated. Group B were only sutured. Group C were treated with corneal cross-linking (CXL) immediately after suturing. Group D were treated with CXL seven days after suturing. The corneal scar strips of 4.0×10.0 mm2 were cut and the stress and Young’s modulus at 10% strain were evaluated. Samples from the three rabbits of group Bc and three of group Dc were used to measure the expression of alpha smooth muscle action (α-SMA). RESULTS: The mechanical strength of the corneal scar increased with time, and was strongest at 8wk after the injury. The ultimate stress of corneal scar (group D) were 2.17±0.52 MPa, 2.92±0.63 MPa, and 4.21±0.68 Mpa at 4wk, 6wk and 8wk, respectively; Young’s modulus were 10.94±1.57 MPa, 11.16±2.50 MPa, and 13.36±2.10 Mpa, which were higher than that of other groups except for normal control. The expression of α-SMA in group B and group D were 0.28±0.11 and 0.65±0.20, respectively, and the difference was statistically significant (P=0.048). CONCLUSION: CXL with riboflavin/UVA at seven days after suturing improved the biomechanical properties of corneal scars most effectively in the present study.

High glucose causes apoptosis of rabbit corneal epithelial cells involving activation of PERK-eIF2α-CHOP-caspase-12 signaling pathway

2019/11/6 0:00:00
AIM: To investigate the effect of high concentration of glucose (HCG) on double stranded RNA-activated protein kinase-like ER kinase (PERK)-eukaryotic initiation factor-2α (eIF2α)-transcription factor C/EBP homologous protein (CHOP)-cysteine aspartate specific proteinase (caspase-12) signaling pathway activation and apoptosis in rabbit corneal epithelial cells (RCECs). METHODS: RCECs were treated by different concentrations of glucose for 0-48h. The expressions of PERK, p-PERK, eIF2α, p-eIF2α, 78 kDa glucose-regulated protein 78 (GRP78), CHOP, B-cell lymphoma 2 (Bcl-2), B-cell lymphoma-2-associated X protein (Bax) and caspase-12 were determined by Western blot. Apoptosis was detected by TUNEL assay. Meanwhile, the function of PERK-eIF2α-CHOP-caspase-12 signaling pathway activation in high glucose-induced apoptosis was evaluated using PERK inhibitor, GSK2606414. RESULTS: HCG significantly promoted the expression of p-PERK, p-eIF2α, GRP78, CHOP, Bax and cleaved caspase-12 in RCECs (P<0.05), while remarkably decreased the expression of Bcl-2 and caspase-12 (P<0.05), and the alterations caused by glucose were in concentration- and time-dependent manners. Meanwhile, PERK and eIF2α expressions were not affected in all groups (P>0.05). TUNEL assay showed that the apoptosis rate of RCECs in the HCG group increased significantly in contrast with that in the normal concentration of glucose or osmotic pressure control group (P<0.05), and the apoptosis rate increased with the increase of glucose concentration within limits (P<0.05). GSK2606414 down-regulated the expression of p-PERK and p-eIF2α in the HCG group (P<0.05), while still did not affect the expression of PERK and eIF2α among groups (P>0.05). Correspondingly, GSK2606414 also significantly reduced the apoptosis rate induced by high glucose (P<0.05). CONCLUSION: HCG activates PERK-eIF2α-CHOP-caspase-12 signaling pathway and promotes apoptosis of RCECs.

Tocilizumab promotes corneal allograft survival in rats by modulating Treg-Th17 balance

Xiao-Song Wu, Xiao-Li Lu, Jing Wu, Ming Ma, Jian Yu and Zhen-Yu Zhang — 2019/11/6 0:00:00
AIM: To examine the therapeutic effects of tocilizumab on experimental corneal transplantation and its effect on Treg/Th17 balance. METHODS: Allograft corneal graft was performed between host Sprague Dawley and Wistar donor rats. The rats were randomly divided into four groups: normal, autograft, allograft, and allograft treated with tocilizumab. Kaplan-Meier was performed to draw the survival curve. The protein levels of interleukin-17A (IL-17A), vascular endothelial growth factor (VEGF), and forkhead box protein 3 (Foxp3) were measured by immunohistochemistry. The mRNA levels of IL-17A, VEGF, retinoid-related orphan receptor gammat (RORγt), interleukin-6 (IL-6) and Foxp3 were detected by reverse transcription real-time polymerase chain reaction (RT-PCR). The Treg and Th17 cells were investigated by flow cytometry. RESULTS: The survival time of tocilizumab group was (24±1.27d) longer than that of allograft group (10±0.55d). Moreover, immunohistochemical examination revealed that IL-17A and VEGF protein levels in the allograft group were significantly higher than that of tocilizumab group (P<0.01), while Foxp3 levels in the allograft group was significantly lower than that of the tocilizumab treated group (P<0.001). Flow cytometry showed that the number of Th17 cells in allograft group was significantly higher than that in tocilizumab group (P<0.001). Meanwhile, the number of Tregs was significantly lower than in tocilizumab group (P<0.001). Simultaneously, Foxp3 mRNA expression level in corneal tissues of tocilizumab treated group was significantly higher than other groups (P<0.001). CONCLUSION: These findings suggest that tocilizumab may promote corneal allograft survival, possibly by modulating Treg-Th17 balance.

The role of mechanical stretch and TGF-β2 in epithelial-mesenchymal transition of retinal pigment epithelial cells

2019/11/6 0:00:00
AIM: To explore the effects and mechanisms of mechanical stress and transforming growth factor-beta2 (TGF-β2) on epithelial-mesenchymal transition (EMT) in cultured human retinal pigment epithelial (RPE) cells. METHODS: Human RPE cells were inoculated on BioFex 6-well plates and RPE cells received 0, 1, 2, 3, or 4 mild stretch injuries delivered 3h apart after 24h of culture. The device of mechanical stress parameters were set to sine wave, frequency 1 Hz, stretch strength 20%. For treatment with TGF-β2, when the inoculated RPE cells in 6-well plates were around 60% con?uent, serum was reduced to 0 for 12h and recombinant human TGF-β2 (0, 1, 5, 10 ng/mL) was added for 48h. α-SMA, Vimentin and N-Cadherin, fibronectin proteins expressions were detected by Western blotting, confocal cell immunofluorescence and quantitative real-time polymerase chain reaction (qRT-PCR). Then we detected the change of miRNA-29b and ascertained the changes of phosphatidylinositol 3-kinase-serine threonine protein kinase (PI3K/Akt) pathway after RPE cells were stretched by the device of mechanical stress and induced by TGF-β2 by Western blotting, confocal cell immunofluorescence and qRT-PCR. RESULTS: Mechanical stress induce EMT and activate the PI3K/Akt pathway in ways that lead to the EMT process. TGF-β2 induce RPE cells EMT and in a certain range and TGF-β2 decrease the miRNA-29b expression in RPE cells, and the inhibitory effect is more obvious with the increase of TGF-β2 concentration. CONCLUSION: Our findings are crucial steps in determining the critical roles of the PI3K/Akt signaling pathway and miRNA-29b in pathogenesis of proliferative vitreoretinopathy (PVR) which may be a potential target for preventing or treating PVR.

Rescue of human corneal epithelial cells after alkaline insult using renalase derived peptide, RP-220

Luke Potts, Casie Phillips, Munok Hwang, Samuel Fulcher and Hosoon Choi — 2019/10/8 0:00:00
AIM: To study the effect of renalase peptide, RP-220, on cell viability of human corneal epithelial cells after alkali insult. METHODS: A dose-response relationship between cell viability and exposure to NaOH solution were characterized using cultured human corneal epithelial cells. Viability of corneal epithelial cells was determined using commercially available MTT and CyQUANT® assays. RESULTS: At a concentration of 6 mmol/L, insult with NaOH leads to reduced corneal epithelial cell viability by approximately 30%. This reduced viability was prevented by treating the cells after initial insult with the 20-amino acid renalase derived peptide (RP-220). CONCLUSION: RP-220 has a pro-survival role for RP-220 following alkaline insult to corneal epithelial cells.

Mutation analysis of FBN1 gene in two Chinese families with congenital ectopia lentis in northern China

2019/10/8 0:00:00
AIM: To summarize the phenotypes and identify the underlying genetic cause of the fibrillin-1 (FBN1) gene responsible for congenital ectopia lentis (EL) in two Chinese families in northern China. METHODS: A detailed family history and clinical data from all participants were collected by clinical examination. The candidate genes were captured and sequenced by targeted next-generation sequencing, and the results were confirmed by Sanger sequencing. Haplotyping was used to confirm the mutation sequence. Real-time PCR was used to determine the FBN1 messenger ribonucleic acid (mRNA) levels in patients with EL and in unaffected family members. RESULTS: The probands and other patients in the two families were affected with congenital isolated EL. A heterozygous FBN1 mutation in exon 21 (c.2420_IVS20-8 delTCTGAAACAinsCGAAAG) was identified in FAMILY-1. A heterozygous FBN1 mutation in exon 14 (c.1633C>T, p.R545C) was identified in FAMILY-2. Each mutation co-segregated with the affected individuals in the family and did not exist in unaffected family members and 200 unrelated normal controls. CONCLUSION: The insertion-deletion mutation (c.2420 IVS20-8delTCTGAAACA insCGAAAG) in the FBN1 gene is first identified in isolated EL. The mutation (c.1633C>T) in the FBN1 gene was a known mutation in EL patient. The variable phenotypes among the patients expand the phenotypic spectrum of EL in a different ethnic background.

Calpastatin participates in the regulation of cell migration in BAP1-deficient uveal melanoma cells

Han Yue, Feng-Xi Meng, Jiang Qian, Bin-Bin Xu, Gang Li and Ji-Hong Wu — 2019/10/8 0:00:00
AIM: To detect how BRCA-associated protein 1 (BAP1) regulates cell migration in uveal melanoma (UM) cells. METHODS: Wound healing and transwell assays were performed to detect UM cell migration abilities. Protein chip, immunoprecipitations and surface plasmon resonance analyses were applied to identify BAP1 protein partners. Western blot and calpain activity assays were used to test the expression and function of calpastatin (CAST). RESULTS: CAST protein was confirmed as a new BAP1 protein partner, and loss of BAP1 reduced the expression and function of CAST in UM cells. The overexpression of CAST rescued the cell migration phenotype caused by BAP1 loss. CONCLUSION: BAP1 interacts with CAST in UM cells, and CAST and its subsequent calpain pathway may mediate BAP1-related cell migration regulation.

Increased interleukin-26 expression in proliferative diabetic retinopathy

Peng Wang, Wen-Yan Wang and Xue-Dong Zhang — 2019/10/8 0:00:00
AIM: To detect the possible role of interleukin (IL)-26 in diabetic retinopathy (DR) patients. METHODS: Subjects were divided into diabetes without retinopathy (DWR) group (n=20), non-proliferative diabetic retinopathy (NPDR) group (n=20), proliferative diabetic retinopathy (PDR) group (n=20) and normal control group (n=20). The protein expression of IL-26 in the serum and vitreous fluid were measured by enzyme-linked immunosorbent assay (ELISA). The mRNA change of IL-26 in peripheral blood mononuclear cells (PBMCs) was assessed by real-time polymerase chain reaction. RESULTS: The serum expression of IL-26 in PDR group was significantly elevated compared with the normal control group, DWR group and NPDR group. The vitreous fluid concentration of IL-26 in PDR patients (without anti-VEGF therapy) was also higher compared to normal controls. However, no obvious significance was found concerning the expression of IL-26 in vitreous fluid between PDR after anti-VEGF therapy and normal controls. In PDR group, the mRNA level of IL-26 significantly increased compared with the normal controls and DWR patients in the PBMCs. CONCLUSION: Protein and mRNA expression of IL-26 are increased in serum, vitreous fluid and PBMCs in PDR patients, suggesting that IL-26 may be associated with the pathogenesis of PDR.

Inhibition of β-elemene on the expressions of HIF-lα, VEGF and iNOS in diabetic rats model

Yun Zhou, Yan Liu, Jun Chen, Yi-Zhou Sun, Li-Hua Li and Lei Chen — 2019/10/8 0:00:00
AIM: To evaluate the effect of β-elemene on the expressions of hypoxia-inducible factor (HIF)-lα, vascular endothelial growth factor (VEGF) and inducible nitric oxide synthase (iNOS) in a streptozotocin (STZ) induced diabetic Sprague-Dawley (SD) rat model. METHODS: SD rats were administered an abdominal injection of STZ and induced to a diabetic model. After 6wk course of diabetes, the treatment groups were given β-elemene through periocular and intravitreous injection separately and the control groups were given blank emulsion injection. HE staining was used to observe the morphology of retina. The mRNA expressions of HIF-1α, VEGF and iNOS was assayed by real-time polymerase chain reaction (PCR) and the protein expression was measured by Western blot and immunocytochemistry methods. RESULTS: The results indicated that the protein and mRNA expressions of HIF-1α, VEGF and iNOS after treated by β-elemene periocularly and intravitreally injections were all found to be reduced compared with the levels in the diabetic rats group (P<0.05). The inhibitory effect of intravitreal injection was more remarkable. CONCLUSION: The results show β-elemene protect the retina of diabetic rats from high glucose damage by downregulating the expression of HIF-1α, VEGF and iNOS.

Inhibitive effect of TAK-242 on Tenon’s capsule fibroblasts proliferation in rat eyes

Liang Liang, Meng-Nan Zhu, Bao-Ji Chen, Zheng Wang, Li-Ye He and Rang Zhang — 2019/10/8 0:00:00
AIM: To study the inhibition effect of TAK-242 on the proliferation of rat eye Tenon’s capsule fibroblasts via the toll-like receptor 4 (TLR4) signaling pathway. METHODS: SD rat Tenon’s capsule fibroblasts were extracted and cultured, then the cells were divided into normal control group, lipopolysaccharide (LPS) group (10 g/mL LPS) and TAK-242 group (1 μmol/L TAK-242, and 10 μg/mL LPS after 30min). The expressions of TLR4, transforming growth factor-β1 (TGF-β1) and interleukin-6 (IL-6) in each group were detected by Western blot and reverse transcriptase-polymerase chain reaction (RT-PCR). Cell proliferation was detected by cell counting kit-8 (CCK-8). RESULTS: Double immunofluorescent labeling in the extracted cells showed negative keratin staining and positive vimentin staining. Western blot showed that the LPS group had the highest expression of TLR4 and TGF-β1 (P<0.01). Enzyme linked immunosorbent assay (ELISA) also showed that the secretion of IL-6 was the highest in LPS group (P<0.01). But there was no significant difference in TLR4 and TGF-1, as well as IL-6 expressions between the TAK-242 group and the normal control group (P>0.05). RT-PCR showed that the IL-6 mRNA expression in LPS group was the highest in the three groups (P<0.01). CONCLUSION: TAK-242 inhibits the proliferation of LPS-induced Tenon’s capsule fibroblasts and the release of inflammatory factors by regulating the TLR4 signaling pathway, providing a new idea for reducing the scarring of the filter passage after glaucoma filtration surgery.

Celastrol inhibits migration, proliferation and transforming growth factor-β2-induced epithelial-mesenchymal transition in lens epithelial cells

Li-Ping Wang, Bao-Xin Chen, Yan Sun, Jie-Ping Chen, Shan Huang and Yi-Zhi Liu — 2019/9/2 0:00:00
AIM: To investigate the mechanism of celastrol in inhibiting lens epithelial cells (LECs) fibrosis, which is the pathological basis of cataract. METHODS: Human LEC line SRA01/04 was treated with celastrol and transforming growth factor-β2 (TGF-β2). Wound-healing assay, proliferation assay, flow cytometry, real-time polymerase chain reaction (PCR), Western blot and immunocytochemical staining were used to detect the pathological changes of celastrol on LECs. Then, we cultured Sprague-Dawley rat lens in medium as a semi-in vivo model to find the function of celastrol further. RESULTS: We found that celastrol inhibited the migration of LECs, as well as proliferation (P<0.05). In addition, it induced the G2/M phase arrest by cell cycle-related proteins (P<0.01). Moreover, celastrol inhibited epithelial-mesenchymal transition (EMT) by the blockade of TGF-β/Smad and Jagged/Notch signaling pathways. CONCLUSION: Our study demonstrates that celastrol could inhibit TGF-β2-induced lens fibrosis and raises the possibility that celastrol could be a potential novel drug in prevention and treatment of fibrotic cataract.

Gatifloxacin inducing apoptosis of stromal fibroblasts through cross-talk between caspase-dependent extrinsic and intrinsic pathways

Bin Xu, Yun-Long Sui and Ting-Jun Fan — 2019/9/2 0:00:00
AIM: To reveal the cytotoxicity and related mechanisms of gatifloxacin (GFX) to stromal fibroblasts (SFs) in vitro. METHODS: SFs were treated with GFX at different concentrations (0.009375%-0.3%), and their viability was detected by MTT method. The cell morphology was observed using light/transmission electron microscope. The plasma membrane permeability was measured by AO/EB double-staining. Then cell cycle, phosphatidylserine (PS) externalization, and mitochondrial transmembrane potential (MTP) were analyzed by flow cytometry. DNA damage was analyzed by electrophoresis and immunostaining. ELISA was used to evaluate the caspase-3/-8/-9 activation. Finally, Western blotting was applied for detecting the expressions of apoptosis-related proteins. RESULTS: Morphological changes and reduced viability of GFX-treated SFs demonstrated that GFX above 0.009375% had cytotoxicity to SFs with dependence of concentration and time. GFX-treating cells also showed G1 phase arrest, increased membrane permeability, PS externalization and DNA damage, which indicated that GFX induced apoptosis of SFs. Additionally, GFX could activate the caspase-8, caspase-9, and caspase-3, induce MTP disruption, downregulate B-cell leukemia-2 (Bcl-2) and B-cell leukemia-XL (Bcl-XL), and upregulate Bcl-2 assaciated X protein (Bax), Bcl-2-associated death promoter (Bad), Bcl-2 interacting domain (Bid) and cytoplasmic cytochrome C in SFs, suggesting that caspase-dependent extrinsic and intrinsic pathways were related to GFX-contributed apoptosis of SFs. CONCLUSION: The cytotoxicity of GFX induces apoptosis of SFs through triggering the caspase-dependent extrinsic and intrinsic pathways.

Parthenolide inhibits the proliferation and induces the apoptosis of human uveal melanoma cells

Song-Tian Che, Li Bie, Xu Li, Hui Qi, Peng Yu and Ling Zuo — 2019/9/2 0:00:00
AIM: To explore the effect of parthenolide (PTL) on human uveal melanoma (UM) cells (C918 and SP6.5 cells) and its molecular mechanism. METHODS: Carboxyfluorescein succinimidyl amino ester (CFSE) assays and cell counting kit-8 (CCK-8) were performed to detect the cell viability. Flow cytometry was used to analyze cell cycle and apoptosis. Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot assays were performed to measure proliferation-related and apoptosis-related factors. RESULTS: Firstly, PTL decreased the viability of C918 and SP6.5 cells in a dose-dependent manner, and the effect of PTL on C918 cells was stronger than on SP6.5; however, it did not affect normal cells. Secondly, PTL increased the proportion of cell number at cell cycle G1 phase in C918 cells, and decreased the proportion of cell number at S phase, but the proportion did not change at G2 phase. In addition, PTL induced the apoptosis of C918 cells, and decreased the expressions of Cyclin D1, B-cell lymphoma-2 (Bcl-2) and B-cell lymphoma-extra large (Bcl-XL). Also, PTL increased Cyclin inhibition protein 1 (P21), Bcl-2-associated X protein (Bax), Cysteinyl aspartate specific proteinas-3 (Caspase-3) and Caspase-9 expression. However, the expression of Caspase-8 was not changed. CONCLUSION: PTL inhibites proliferation and induces apoptosis in UM cells by arresting G1 phase and regulating mitochondrial pathway, however, it does not affect normal cells.

Inhibition of Obtusifolin on retinal pigment epithelial cell growth under hypoxia

2019/9/2 0:00:00
AIM: To explore the effect of Obtusifolin on retinal pigment epithelial cell growth under hypoxia. METHODS: In vitro chemical hypoxia model of ARPE-19 cells was established using cobalt chloride (CoCl2). Cell viability was tested by cell counting kit-8 (CCK-8) assay. Western blot and real-time quantitative polymerase chain reaction were applied to detect proteins and mRNAs respectively. Flow cytometry was used to examine the cell cycle. Secretion of vascular endothelial growth factor (VEGF) was tested by using enzyme linked immunosorbent assay (ELISA). RESULTS: Under the chemical hypoxia model established by CoCl2, hypoxia inducible factor-1α (HIF-1α) mRNA and protein levels was up-regulated. Cell viability was increased and the proportion of S phase was higher. Obtusifolin could reduce cell viability under hypoxic conditions and arrest cells in G1 phase. Obtusifolin reduced the expression of Cyclin D1 and proliferating cell nuclear antigen (PCNA) in the hypoxic environment and increased the expression of p53 and p21. The levels of VEGF, VEGFR2 and eNOS proteins and mRNA were significantly increased under hypoxia while Obtusifolin inhibited the increasing. CONCLUSION: Obtusifolin can inhibit cell growth under hypoxic conditions and down-regulate HIF-1/VEGF/eNOS secretions in ARPE-19 cells.

All-trans retinoic acid increases ARPE-19 cell apoptosis via activation of reactive oxygen species and endoplasmic reticulum stress pathways

Juan Wu, Zhen-Ya Gao, Dong-Mei Cui, Hong-Hui Li and Jun-Wen Zeng — 2020/7/21 0:00:00
AIM: To explore the apoptosis of ARPE-19 cells after the treatment with different doses of all-trans-retinoic acid (ATRA). METHODS: ARPE-19 cells were used in the in-vitro experiment. Flow cytometry assay was employed to evaluate the level of reactive oxygen species (ROS) and apoptosis. The effects of ATRA (concentrations from 2.5 to 20 μmol/L) on the expression of endoplasmic reticulum stress (ERS) markers in vitro were evaluated by Western blot and real-time quantitative polymerase chain reaction (qRT-PCR) assays. The contribution of ROS and ERS-induced apoptosis in vitro was determined by using N-acetyl-L-cysteine (NAC) and Salubrinal, an antagonist of NAC and ERS, respectively. RESULTS: Flow cytometry showed that ATRA significantly increased ARPE-19 cell apoptosis and ROS levels in each group (F=86.39, P<0.001; F=116.839, P<0.001). Western blot and qRT-PCR revealed that levels of CHOP and BIP were elevated in a concentration-dependent pattern after the cells were incubated with ATRA (2.5-20 μmol/L). The upregulation of VEGF-A and CHOP induced by ATRA could be inhibited by NAC (antioxidant) and Salubrinal (ERS inhibitor) in vitro. CONCLUSION: ATRA induces the apoptosis of ARPE-19 cells via activated ROS and ERS signaling pathways.

Preliminary report on screening IGSF3 gene mutation in families with congenital absence of lacrimal puncta and canaliculi

2020/7/21 0:00:00
AIM: To investigate the variation of IGSF3 gene in three families with congenital absence of lacrimal puncta and canaliculi, and to lay a foundation for further research on the pathogenic gene of congenital lacrimal duct agenesis. METHODS: The members of the three families were recruited. The ophthalmologic examinations in details, including slit-lamp biomicroscope, intraocular pressure and fundus examination, etc. were carried out. All patients were checked with paracentesis of puncta membrane and lacrimal duct probing, as well as the computed tomography-dacryocystography (CT-DCG). Peripheral blood of 14 participants (3 normal) from three families were collected, 4 mL each, for genomic DNA extraction, and 11 exon fragments of IGSF3 gene were amplified and sequenced by polymerase chain reaction (PCR) to determine whether there were IGSF3 genetic variation. RESULTS: A total of 14 members from three families were screened for 4 synonymous variants: c.930C>T (p.Pro366=), c.1359T>C (p.Ser709=), c.1797G>A (p.Ser855=), c.1539G>A (p.Ser769=), and 6 missense variants: c.1507G>A (p.Gly759Ser), c.1783T>C (p.Trp851Arg), c.1952G>T (p.Ser 907Ile), c.3120C>G (p.Asp1040Glu), c.3123C>G (p.Asp1041Glu), c.3139_3140insGAC (p.Asp1046_Pro1047insAsp), and the latter three were only found in two patients with absence of lacrimal puncta and canaliculi combined with congenital osseous nasolacrimal canal obstruction from the first family. CONCLUSION: The same IGSF3 gene mutation c.3139_3140insGAC is found in the patients with congenital absence of lacrimal puncta and canaliculi combine with osseous nasolacrimal canal obstruction.

Experimental study of trabecular tissue repair for corneal defect in rabbits

Xia Li, Yun Xiao, Xiao-Wei Gao, Yi Liu and Dai-Kun Lei — 2020/7/21 0:00:00
AIM: To investigate the mechanism and effect of trabecular tissue repair for corneal defect, and to provide a theoretical basis for its clinical application. METHODS: Trabeculectomy was performed on 40 (80 eyes) of 70 New Zealand white rabbits. Take trabecular tissue for backup. Thirty (30 eyes) corneal defect models were made, trabecular tissue was filled in the corneal defect, and the oblique cross stitch was used to suture the corneal laceration and debridement. Anterior segment image and optical coherence tomography (OCT) were performed at the time 1d, 1wk, 1 and 3mo after the model was made. After the observation, the cornea was taken and stained with trypanosome blue-alizarin red and the pathological tissue was examined. RESULTS: Observation 1wk after surgery, the area of corneal defect was edema, but the corneal curvature was basically normal, and the anterior chamber existed under slit lamp. After 3mo of observation, most corneal defects were repaired in the form of corneal leucoma and corneal macula (73.3%), the filled trabecular tissue gradually became transparent, fused tightly with the corneal tissue, and the corneal curvature was relatively smooth. But in one case, the trabecular planter was partially detached, no serious complications such as corneal laceration occurred after the stitches were removed. CONCLUSION: The trabecular tissue structure is similar to the corneal, and it can be used as a substitute for the corneal tissue defect by providing fiber scaffolds and cell amplification differentiation, and lay a foundation for the second-stage surgical treatment.

Acetylcholinesterase inhibition ameliorates retinal neovascularization and glial activation in oxygen-induced retinopathy

Qiu-Ping Liu, Xian Zhang, Ya-Zhou Qin, Jing-Lin Yi and Jing-Ming Li — 2020/7/21 0:00:00
AIM: To investigate whether inhibition of acetylcholinesterase (AChE) by donepezil ameliorate aberrant retinal neovascularization (RNV) and abnormal glial activation in oxygen-induced retinopathy (OIR). METHODS: A mouse model of RNV was induced in postnatal day 7 (P7) mice by exposure to 75% oxygen. Donepezil was administrated to P12 mice by intraperitoneal injection. Expression and localization of AChE in mouse retinas were determined by immunofluorescence. RNV was evaluated by paraffin sectioning and hematoxylin and eosin (HE) staining. Activation of retinal Müller glial cells were examined by immunoblot of glial fibrillary acidic protein (GFAP). rMC-1, a retinal Müller cell line, was used for in vitro study. Expression of hypoxia-induced factor 1α (HIF-1α) and vascular endothelial growth factor (VEGF) were determined by Western-blot analysis, enzyme-linked immunosorbent assay (ELISA) or immunostaining. RESULTS: Aberrant RNV and glial activation was observed after OIR. Of note, retinal AChE was mainly expressed by retinal Müller glial cells and markedly increased in OIR mice. Systemic administration of donepezil significantly reduced RNV and abnormal glial activation in mice with OIR. Moreover, ischemia-induced HIF-1α accumulation and VEGF upregulation in OIR mouse retinas and cultured rMC-1 were significantly inhibited by donepezil intervention. CONCLUSION: AchE is implicated in RNV with OIR. Inhibition of AChE by donepeizl is likely to be a potential therapeutic approach for retinal neovascular diseases.

Hydrogen promotes the activation of Cu, Zn superoxide dismutase in a rat corneal alkali-burn model

2020/6/22 0:00:00
AIM: To investigate the effects of hydrogen (H2) on Cu, Zn superoxide dismutase (SOD1) activation in a rat model of corneal alkali burn. METHODS: In each rat, one cornea was subjected to alkali exposure. Physiological saline (saline group) or H2-dissolved saline (H2 group) was instilled continuously on the cornea for 5min before and after alkali exposure. Inflammatory cells, neovascularization, and cytoplasmic SOD1 levels were evaluated immunohistochemically in enucleated eyes from both groups. Three-dimensional ultrastructural tissue changes in the eyes were analyzed using low-vacuum scanning electron microscopy. RESULTS: The numbers of both inflammatory and vascular endothelial cells were significantly reduced in the corneas of the H2 group (P<0.01). Furthermore, H2 treatment increased both cytoplasmic SOD1 levels (P<0.01) and activity in corneal epithelial cells (P<0.01). Notably, the SOD1 activity level in the H2 group was approximately 2.5-fold greater than that in the saline group. CONCLUSION: H2 treatment suppresses inflammation and neovascularization in the injured cornea and indirectly suppresses oxidative insult to the cornea by upregulating the SOD1 enzyme protein level and activity.

Cytotoxic effect of specific T cells from mice with experimental autoimmune uveitis on murine photoreceptor cells

Zheng-Feng Liu, Feng Zhang, Da-Dong Guo, Xue-Mei Pan and Hong-Sheng Bi — 2020/6/22 0:00:00
AIM: To investigate the cytotoxic effect of specific T cells from mice with experimental autoimmune uveitis (EAU) as well as their secreted interferon (IFN)-γ and interleukin (IL)-17A on murine photoreceptor (661W) cells. METHODS: An EAU model was established in female mice by injection of interphotoreceptor retinoid binding protein (IRBP) emulsion supplemented with complete Freund’s adjuvant (CFA) and Mycobacterium tuberculosis (TB). On day 12 after induction of EAU, specific T cells from spleen and lymph node tissues were isolated and cultured for 4d and the levels of IFN-γ and IL-17A in the supernatants were determined by enzyme-linked immunosorbent assays (ELISAs). T cells and their supernatants were added to 661W cells to observe the alteration of cell morphology; IFN-γ and IL-17A were separately added to 661W cells to observe the effect of IFN-γ and IL-17A on cell proliferation. RESULTS: The levels of IFN-γ and IL-17A in the T cell supernatants were 1568.64±38.79 pg/mL and 1456.57±46.98 pg/mL, respectively. The supernatants apparently inhibited 661W cell proliferation (P<0.05). T cells could also attach to the surface of 661W cells, and IFN-γ showed a more serious cytotoxic effect on 661W cells than IL-17A, inhibiting cell proliferation (P<0.01). CONCLUSION: IFN-γ and IL-17A from T cells of EAU mice model can exert cytotoxic effects on murine photoreceptor cell proliferation, and IFN-γ shows more serious cytotoxic effects on murine photoreceptor cells than IL-17A.

A modified laser-induced choroidal neovascularization animal model with intravitreal oxidized low-density lipoprotein

2020/6/22 0:00:00
AIM: To investigate whether intravitreal injection of oxidized low-density lipoprotein (OxLDL) can promote laser-induced choroidal neovascularization (CNV) formation in mice and the mechanism involved, thereby to develop a better animal model. METHODS: C57BL6/J mice were randomized into three groups. Immediately after CNV induction with 532 nm laser photocoagulation, 1.0 μL of OxLDL [100 μg/mL in phosphate-buffered saline (PBS)] was intravitreally injected, whereas PBS and the same volume low-density lipoprotein (LDL; 100 μg/mL in PBS) were injected into the vitreous as controls. Angiogenic and inflammatory cytokines were measured by quantitative real-time polymerase chain reaction (qRT-PCR) and Western blotting (WB) after 5d, and CNV severity was analyzed by choroid flat mount and immunofluorescence staining after 1wk. In vitro, retinal pigment epithelial (RPE) cell line (ARPE19) were treated with OxLDL (LDL as control) for 8h. Angiogenic and inflammatory cytokine levels were measured. A specific inhibitor of lectin-like oxidized low-density lipoprotein receptor 1 (LOX1) was used to evaluate the role of LOX1 in this process. RESULTS: At 7d after intravitreal injection of 1 μL (100 μg/mL) OxLDL, T15-labeled OxLDL was mainly deposited around the CNV area, and the F4/80-labeled macrophages, the CD31-labeled vascular endothelial cells number and CNV area were increased. Meanwhile, WB and qRT-PCR results showed that vascular endothelial growth factor (VEGF), CC chemokine receptor 2 (CCR2), interleukin-6 (IL-6), IL-1β, and matrix metalloproteinase 9 (MMP9) expressions were increased, which was supported by in vitro experiments in RPE cells. LOX1 inhibitors significantly reduced expressions of inflammatory factors IL-1β and VEGF. CONCLUSION: A modified laser-induced CNV animal model is established with intravitreal injection of 1 μL (100 μg/mL) of OxLDL at 7d, which at least partially through LOX1. This animal model can be used as a simple model for studying the role of OxLDL in age-related macular degeneration.

LncRNA SNHG15 predicts poor prognosis in uveal melanoma and its potential pathways

Xue Wu, Xiao-Feng Li, Qian Wu, Rui-Qi Ma, Jiang Qian and Rui Zhang — 2020/6/22 0:00:00
AIM: To evaluate the role of long noncoding RNA (lncRNA) SNHG15 and its potential pathways in uveal melanoma (UM). METHODS: The SNHG15 mRNA expression level and corresponding clinicopathological characteristics of 80 patients with UM were obtained from the Cancer Genome Atlas (TCGA) database and further analyzed. The SPSS 24.0 statistical software package was used for statistical analyses. To investigate the potential function of SNHG15 in UM, we conducted in-depth research on Gene Set Enrichment Analysis (GSEA). RESULTS: The univariate analysis revealed that the age, tumor diameter, pathological type, extrascleral extension, cancer status, and high expression of SNHG15 were statistical risk factors for death from all causes. The multivariate analysis suggested that the mRNA expression level of SNHG15 was an independent risk factor for death from all causes, as was age and pathological type. Kaplan-Meier survival analysis confirmed that UM patients with high SNHG15 expression might have a poor prognosis. In addition, SNHG15 was significantly differentially expressed in the different groups of tumor pathologic stage, metastasis and living status. Besides, the logistic regression analysis indicated that high SNHG15 expression group in UM was significantly associated with cancer status, pathologic stage, metastasis, and living status. Moreover, the GSEA indicated the potential pathways regulated by SNHG15 in UM. CONCLUSION: Our research suggests that SNHG15 may play a vital role as a potential marker in UM that predicts poor prognosis. Besides, GSEA indicates the underlying signaling pathways enriched differentially in SNHG15 high expression phenotype.

Regulation of opticin on bioactivity of retinal vascular endothelial cells cultured in collagen

Yue Xing, Xue-Ke Li, Si-Duo Lu and Jin Ma — 2020/6/22 0:00:00
AIM: To investigate the effects of collagen and opticin on the bioactivity of human retinal vascular endothelial cells (hRVECs), and explore its regulations by integrins and RhoA/ROCK1 signal pathway. METHODS: hRVECs were cultured in collagen and treated by opticin, and cell-based bioactivity assays of cell proliferation, migration, and adhesion were performed. The expression of integrin α2, integrin β1, RhoA and ROCK1 were examined with real-time PCR and Western blotting. RESULTS: Collagen could promote cell viability of proliferation and migration (all P<0.05), and enhance the mRNA expression of integrin α2, integrin β1, RhoA and ROCK1 (all P<0.05). Opticin could inhibit proliferation and migration ability of hRVECs cultured in collagen, and reduce the mRNA expression of integrin α2, integrin β1, RhoA and ROCK1 (all P<0.05). CONCLUSION: Collagen and opticin can affect bioactivity of hRVECs, which may be regulated by α2-, β1-integrins and RhoA/ROCK1 signal pathway.

Whole transcriptome analysis on blue light-induced eye damage

2020/6/22 0:00:00
AIM: To analyze abnormal gene expressions of mice eyes exposed to blue light using RNA-seq and analyze the related signaling pathways. METHODS: Kunming mice were divided into an experimental group that was exposed to blue light and a control group that was exposed to natural light. After 14d, the mice were euthanized and their eyeballs were collected. Whole transcriptome analysis was attempted to analyze the gene expression of the eyeballs using RNA-seq to reconstruct genetic networks. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis were used to reveal the related signaling pathways. RESULTS: The 737 differentially expressed genes were identified, including 430 up and 307 down regulated genes, by calculating the gene FPKM in each sample and conducting differential gene analysis. GO and KEGG pathway enrichment analysis showed that blue light damage may associated with the visual perception, sensory perception of light stimulus, phototransduction, and JAK-STAT signaling pathways. Differential lncRNA, circRNA and miRNA analysis showed that blue light exposure affected pathways for retinal cone cell development and phototransduction, among others. CONCLUSION: Exposure to blue light can cause a certain degree of abnormal gene expression and modulate signaling pathways in the eye.

Effect of natural extract eye drops in dry eye disease rats

2020/5/27 0:00:00
AIM: To investigate the therapeutic effect of natural extract eye drops containing bee venom, musk, and deer antlers in dry eye disease (DED) animal models. METHODS: Scopolamine-injected DED rats and lacrimal gland-excised rats were allocated into control, saline, and natural extract groups respectively and a normal group (lacrimal gland excision was not performed) in lacrimal gland-excised rats. After eye drop instillation 4 times a day for 5d, corneal fluorescein staining (CFS) scores, tear MUC5AC levels, and tear lactic dehydrogenase (LDH) levels were measured. RESULTS: In scopolamine-injected rats, the natural extract-treated group had significantly lower CFS scores (1.7±0.5, 4.7±1.4, 3.8±1.9, P=0.006) and tear LDH levels (0.10±0.01, 0.19±0.01, 0.16±0.08 OD, P=0.014) but higher tear MUC5AC levels (12.9±3.7, 7.9±2.0, 9.7±3.6 ng/mL, P=0.041) compared with the control and saline-treated groups. There were no significant differences between the control and saline-treated groups. In lacrimal gland-excised rats, the natural extract-treated group also had lower CFS scores (4.3±1.2, 11.5±2.3, 9.0±1.9, P<0.001, P=0.001) and tear LDH levels (0.30±0.08, 0.48±0.12, 0.39±0.05 OD, P<0.05) but higher tear volume (4.3±0.9, 1.9±0.7, 2.8±1.1 mm, P=0.005, P=0.124) and tear MUC5AC levels (8.2±2.0, 2.9±1.2, 5.4±2.2 ng/mL, P<0.001, P=0.047) compared with the control and saline-treated groups. There were no significant differences in the CFS scores, tear MUC5AC level, and tear LDH level between the normal and natural extract-treated groups. CONCLUSION: The natural extract consisting of bee venom, musk, and deer antlers may have effectiveness in DED treatment by restoring the damaged ocular surface, increasing tear volume, and recovering the tear mucin layer in DED rats.

Alarmins from conjunctival fibroblasts up-regulate matrix metalloproteinases in corneal fibroblasts

2020/5/27 0:00:00
AIM: To explore the effects of alarmins produced by necrotic human conjunctival fibroblasts on the release of matrix metalloproteinases (MMPs) by human corneal fibroblasts (HCFs). METHODS: A necrotic cell supernatant (NHCS) was prepared by subjecting human conjunctival fibroblasts to three cycles of freezing and thawing. The amounts of interleukin (IL)-1β and tumor necrosis factor (TNF)-α in NHCS were determined by enzyme-linked immunosorbent assays. HCFs exposed to NHCS or other agents in culture were assayed for the release of MMPs as well as for intracellular signaling by immunoblot analysis. The abundance of MMP mRNAs in HCFs was examined by reverse transcription and real-time polymerase chain reaction analysis. RESULTS: NHCS increased the release of MMP-1 and MMP-3 by HCFs as well as the amounts of the corresponding mRNAs in the cells. NHCS also induced activation of mitogen-activated protein kinase (MAPK) signaling pathways mediated by extracellular signal-regulated kinase (ERK), p38, and c-Jun NH2-terminal kinase (JNK) as well as elicited that of the nuclear factor (NF)-κB signaling pathway by promoting phosphorylation of the endogenous NF-κB inhibitor IκB-α. Inhibitors of MAPK and NF-κB signaling as well as IL-1 and TNF-α receptor antagonists attenuated the NHCS-induced release of MMP-1 and MMP-3 by HCFs. Furthermore, IL-1β and TNF-α were both detected in NHCS, and treatment of HCFs with these cytokines induced the release of MMP-1 and MMP-3 in a concentration-dependent manner. CONCLUSION: Alarmins, including IL-1β and TNF-α, produced by necrotic human conjunctival fibroblasts triggered MMP release in HCFs through activation of MAPK and NF-κB signaling. IL-1β and TNF-α are therefore potential therapeutic targets for the amelioration of corneal stromal degradation in severe ocular burns.

Blocking VEGF signaling augments interleukin-8 secretion via MEK/ERK/1/2 axis in human retinal pigment epithelial cells

Lin-Bin Zhou, Ye-Qi Zhou and Xin-Yu Zhang — 2020/5/27 0:00:00
AIM: To identify proangiogenic factors engaged in neovascular age-related macular degeneration (AMD) except vascular endothelial growth factor (VEGF) from human retinal pigment epithelial (hRPE) cells and investigate the underlying mechanisms. METHODS: VEGF receptor 2 (VEGFR2) in ARPE-19 cells was depleted by siRNA transfection or overexpressed through adenovirus infection. The mRNA and the protein levels of interleukin-8 (IL-8) in ARPE-19 cells were measured by quantitative real-time polymerase chain reaction and enzyme-linked immunosorbent assay respectively. The protein levels of AKT, p-AKT, MEK, p-MEK, ERK1/2, p-ERK1/2, JNK, p-JNK, p38 and p-p38 were detected by Western blotting. A selective chemical inhibitor, LY3214996, was employed to inhibit phosphorylation of ERK1/2. Cell viability was determined by MTT assay. RESULTS: Knockdown of VEGFR2 in ARPE-19 cells robustly augmented IL-8 production at both the mRNA and the protein levels. Silencing VEGFR2 substantially enhanced phosphorylation of MEK and ERK1/2 while exerted no effects on phosphorylation of AKT, JNK and p38. Inhibiting ERK1/2 phosphorylation by LY3214996 reversed changes in VEGFR2 knockdown-induced IL-8 upregulation at the mRNA and the protein levels with no effects on cell viability. VEGFR2 overexpression significantly reduced IL-8 generation at the mRNA and the protein levels. CONCLUSION: Blockade of VEGF signaling augments IL-8 secretion via MEK/ERK1/2 axis and overactivation of VEGF pathway decreases IL-8 production in hRPE cells. Upregulated IL-8 expression after VEGF signaling inhibition in hRPE cells may be responsible for being incompletely responsive to anti-VEGF remedy in neovascular AMD, and IL-8 may serve as an alternative therapeutic target for neovascular AMD.

Identification of differentially expressed metastatic genes and their signatures to predict the overall survival of uveal melanoma patients by bioinformatics analysis

Dan-Dan Zhao, Xin Zhao and Wen-Tao Li — 2020/5/27 0:00:00
AIM: To identify metastatic genes and miRNAs and to investigate the metastatic mechanism of uveal melanoma (UVM). METHODS: GSE27831, GSE39717, and GSE73652 gene expression profiles were downloaded from the Gene Expression Omnibus (GEO) database, and the limma R package was used to identify differentially expressed genes (DEGs). Gene Ontology (GO) term enrichment analysis and Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis were performed using the DAVID online tool. A comprehensive list of interacting DEGs was constructed using the Search Tool for the Retrieval of Interacting Genes (STRING) database and Cytoscape software. The Cytoscape MCODE plug-in was used to identify clustered sub-networks and modules of hub genes from the protein-protein interaction network. GEPIA online software was used for survival analysis of UVM patients (n=80) from the The Cancer Genome Atlas (TCGA) cohort. OncomiR online software was used to find that the miRNAs were associated with UVM prognosis from the TCGA cohort. TargetScan Human 7.2 software was then used to identify the miRNAs targeting the genes. RESULTS: There were 1600 up-regulated genes and 1399 down-regulated genes. The up-regulated genes were mainly involved in protein translation in the cytosol, whereas the down-regulated genes were correlated with extracellular matrix organization and cell adhesion in the extracellular space. Among the 2999 DEGs, five genes, Znf391, Mrps11, Htra3, Sulf2, and Smarcd3 were potential predictors of UVM prognosis. Otherwise, three miRNAs, hsa-miR-509-3-5p, hsa-miR-513a-5p, and hsa-miR-1269a were associated with UVM prognosis. CONCLUSION: After analyzing the metastasis-related enriched terms and signaling pathways, the up-regulated DEGs are mainly involved in protein synthesis and cell proliferation by ribosome and mitogen-activated protein kinase (MAPK) pathways. However, the down-regulated DEGs are mainly involved in processes that reduced cell-cell adhesion and promoted cell migration in the extracellular matrix through PI3K-Akt signaling pathway, focal adhesion, and extracellular matrix-receptor interactions. Bioinformatics and interaction analysis may provide new insights on the events leading up to the development and progression of UVM.

Dystrophia canthorum in Waardenburg syndrome with a novel MITF mutation

2020/5/27 0:00:00
AIM: To reveal a novel MITF gene mutation in Waardenburg syndrome (WS), which is an autosomal dominant inherited neurogenic disorder that consists of various degrees of sensorineural deafness and pigmentary abnormalities in the eyes, hair and skin. METHODS: The genetic analysis of the Chinese family was conducted by whole-exome sequencing, then the results were confirmed by Sanger sequencing. RESULTS: WS is classified into type I to IV, which are identified by the W index, clinical characteristics and additional features. The MITF gene mostly accounts for WS type II. In this study, a de novo heterozygous mutation in the MITF gene, c.638A>G in exon 7, was identified in the patient diagnosed with WS type I features, as the W index was 2.17 (over 2.10), with dystrophia canthorum, congenital bilateral profound hearing loss, bilateral heterochromia irides, premature greying of the hair, and excessive freckling on the face at birth. She also underwent refractive errors and esotropia, reduced pigmentation of the choroid and visible choroid vessels. The mutation was not found in previous studies or mutation databases. CONCLUSION: The novel mutation in the MITF gene, which altered the protein in amino acids 213 from the glutamic acid to glycine, is the genetic pathological cause for WS features in the patient. Those characteristics of this family revealed a novel genetic heterogeneity of MITF in WS, which expanded the database of MITF mutations and offered a possible in correcting the W index value of WS in distinct ethnicities. Moreover, ocular symptoms should be emphasized in all types of WS patients.

PPARγ: the dominant regulator among PPARs in dry eye lacrimal gland and diabetic lacrimal gland

Peng-Yue Mu, Chen-Chen Chu, Di Yu, Yan Shao and Shao-Zhen Zhao — 2020/4/28 0:00:00
AIM: To investigate the regulatory roles of the members of the peroxisome proliferator-activated receptor (PPAR) family in lacrimal gland dysfunction under conditions of desiccating stress or diabetes. METHODS: Quantitative polymerase chain reaction (qPCR) was used to examine the expression of PPARs in the cornea, conjunctiva, meibomian gland, and lacrimal gland in adult rats. The rats were divided into 3 groups: a control group, dry eye group, and diabetic group. The phenol red threads test, tear film break-up time (BUT) test and fluorescein staining were carried out to evaluate the development of dry eye. Based on bioinformatics research, qPCR was used to examine the expression level of PPARγ, tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), interleukin-6 (IL-6), sirtuin 1 (Sirt1), myeloid differentiation factor 88 (MyD88) and transforming growth factor-β (TGF-β) in the lacrimal glands. RESULTS: PPARα and PPARβ/δ were mainly expressed in the conjunctiva and the lacrimal gland, respectively. However, PPARγ was expressed in both the conjunctiva and lacrimal gland, at much higher levels than those measured for PPARα and PPARβ/δ. Dry eye rats and diabetic rats both showed decreased tear secretion, shortened BUT, and increased corneal staining. Significant changes in gene expression were observed compared with the control group. In the lacrimal glands of dry eye rats and diabetic rats, expression of PPARγ decreased (P<0.05), expression of Sirt1 also decreased (P<0.01), whereas expression of TNF-α, IL-1β, IL-6, MyD88, and TGF-β increased (P<0.05). CONCLUSION: Among PPARs, PPARγ might play a dominant role in the regulation of metabolic- and inflammatory-signaling pathways on the ocular surfaces and in lacrimal glands. Down-regulation of PPARγ is highly relevant to lacrimal gland dysfunction under desiccating-stress and diabetic conditions. PPARγ, thus, is a potential therapeutic target in the treatment of environment- or diabetes-induced dry eye diseases.

Regulation of LOX-1 on adhesion molecules and neutrophil infiltration in mouse Aspergillus fumigatus keratitis

2020/4/28 0:00:00
AIM: To determine whether lectin-like ox-LDL receptor (LOX-1) regulates adhesion molecules expression and neutrophil infiltration in Aspergillus fumigatus (A. fumigatus) keratitis of C57BL/6 mice. METHODS: C57BL/6 mice were pretreated with a neutralizing antibody to LOX-1 (5 μg/5 μL) or control nonspecific IgG (5 μg/5 μL), LOX-1 inhibitor Poly-I (2 μg/5 μL) or PBS by subconjunctival injection. Fungal keratitis (FK) mouse models of C57BL/6 mice were established by scraping corneal central epithelium, smearing A. fumigatus on the corneal surface and covering the eye with contact lenses. The corneal response to infection was assessed via clinical score. The mRNA levels of the adhesion molecules intercellular cell adhesion molecule-1 (ICAM-1), vascular cell adhesion molecule-1 (VCAM-1), P-selectin and E-selectin were tested in control and infected corneas by reverse transcription-polymerase chain reaction (RT-PCR). The protein levels of ICAM-1 were evaluated by immunofluorescence (IF) and Western blot. Neutrophils were extracted from the abdominal cavity of C57BL/6 mice followed by pretreatment using antibody to LOX-1 (10 μg/mL) or control nonspecific IgG (10 μg/mL), the Poly-I (4 μg/mL) or PBS. The cells were then stimulated with A. fumigatus and tested mRNA and protein levels of lymphocyte function-associated antigen-1 (LFA-1) using RT-PCR and Western blot. IF and myeloperoxidase (MPO) assays were used to assess neutrophil infiltration in mice corneas. RESULTS: Pretreatment of LOX-1 antibody or the Poly-I reduced the degree of inflammation of cornea and decreased the clinical FK score compared with pretreatment of IgG or PBS (both P<0.01). And these pretreatment also displayed an obvious decline in the mRNA levels of ICAM-1, VCAM-1, P-selectin, E-selectin and LFA-1 expression compared with control groups (all P<0.01). Furthermore, pretreated with LOX-1 antibody or Poly-I, the protein levels of ICAM-1 and LFA-1 also decreased compared with control groups (all P<0.05). Neutrophil infiltration in the cornea was significantly reduced after pretreatment of LOX-1 antibody or Poly-I compared with control groups by IF and MPO assays (both P<0.01). CONCLUSION: Inhibition of LOX-1 can decrease the expression of adhesion molecules and reduce neutrophil infiltration in A. fumigatus infected corneas of C57BL/6 mice.

Effect of nintedanib thermo-sensitive hydrogel on neovascularization in alkali burn rat model

Yan Gong, Guo-Hai Wu, Ling-Yi Zhang, Zhe Zhang, Yan-Hong Liao and Xiao-Tian Liu — 2020/4/28 0:00:00
AIM: To investigate the effects of nintedanib thermo-sensitive hydrogel (NTH) on neovascularization and related markers in corneal alkali burns of Wistar rats. METHODS: NTH was prepared by grinding, and its phase-transition temperature was determined. Thirty specific-pathogen-free Wistar rats served as a model of corneal alkali burn in the right eye were randomly divided into 3 groups (n=10, each): model group treated with 0.9% saline once a day, NTH group with 0.2% nintedanib b.i.d, and dexamethasone group with dexamethasone ointment once a day. The left eye of rats served as the controls. The corneal transparency was observed under a slit-lamp microscope, and the area of neovascularization was calculated. On day 7, the rats were sacrificed, and the cornea was removed and embedded with paraffin, then stained with hematoxylin-eosin, and the expression of vascular endothelial growth factor receptor 2 (VEGFR-2) and CD31 in the corneal tissues of each group was detected by immunofluorescence. RESULTS: The phase-transition temperature of nintedanib obtained by grinding was 37℃ after adding artificial tears. The results of the alkali burn model indicated that the growth rate of neovascularization in the NTH group was slower than that in the model group, and the neovascularization area was significantly smaller than that in the model group (P<0.05). Moreover, CD31 and VEGFR-2 expression levels in the NTH group were significantly lower than those in the model group. CONCLUSION: NTH becomes colloidal at body temperature, which is beneficial for releasing the drug slowly and can significantly inhibit the neovascularization of corneal induced by alkali burn in rats.

Intravitreal injection of resveratrol inhibits laser-induced murine choroidal neovascularization

Hui-Ming Zhang, Xiao-Hua Li, Mingjiazi Chen and Jing Luo — 2020/4/28 0:00:00
AIM: To determine the effects of intravitreal resveratrol (RSV) on murine laser-induced choroidal neovascularization (CNV). METHODS: The toxicity of RSV to choroidal endothelial cell (CEC) was measured using thiazolyl blue tetrazolium bromide (MTT) assay. Effects of RSV on choroidal endothelial cell (CEC) migration were evaluated with a modified Boyden chamber assay, while tube formation was evaluated in a 2-D gel assay. CNV was induced by laser photocoagulation in mice. The effects of intravitreal injection of RSV on CNV development were evaluated by fluorescein angiography (FA), confocal analysis of isolectin B4 labeled choroidal flat mounts, and histologic examination of CNV membranes. Immunostaining was used to analyze the expression and phosphorylation of vascular endothelial growth factor receptor 2 (VEGFR2). RESULTS: No significant cell toxicity was observed in CEC if the concentration of RSV was less than 200 μmol/L (P>0.05). RSV inhibited vascular endothelial growth factor (VEGF)-induced CEC migration (P<0.05) and tube formation (P<0.05) in vitro. Furthermore, intravitreal injection of RSV significantly inhibited laser induced CNV formation in mice. The FA leakage, CNV volume and CNV area analysis revealed that there were 41%, 45%, and 58% reduction in RSV-treated eyes (1.691±0.1032, 178 163±78 623 μm3 and 6508±619.0 μm2, respectively) compared with those in control (2.724±0.08447, 379 676±98 382 μm3 and 16 576±2646 μm2, respectively; P<0.05). Phospho-VEGFR2 expression was much weaker in the sections of CNV lesions in RSV injected mice compared with that in control (P<0.05). CONCLUSION: Intravitreal injection of RSV exerts an inhibitory effect on CNV, which may through suppressing endothelial cell migration, tube formation and VEGFR2 phosphorylation.

Cross-talk between microRNA-let7c and transforming growth factor-β2 during epithelial-to-mesenchymal transition of retinal pigment epithelial cells

Qu-Zhen Deji, Feng Yan, Wang-Dui Zhaba, Ya-Jun Liu, Jie Yin and Zhen-Ping Huang — 2020/3/30 0:00:00
AIM: To explore the roles of microRNA-let7c (miR-let7c) and transforming growth factor-β2 (TGF-β2) and cellular signaling during epithelial-to-mesenchymal transition (EMT) of retinal pigment epithelial cells. METHODS: Retinal pigment epithelial (ARPE-19) cells were cultured with no serum for 12h, and then with recombinant human TGF-β2 for different lengths of time. ARPE-19 cells were transfected with 1×106 TU/mL miR-let7c mimcs (miR-let7cM), miR-let7c mimcs negative control (miR-let7cMNC) and miR-let7c inhibitor (miR-let7cI) using the transfection reagent. The expression of keratin-18, vimentin, N-cadherin, IKB alpha, p65 were detected by Western blot, quantitative polymerase chain reaction and immunofluorescence. RESULTS: The expression of miR-let7c was dramatically reduced and the nuclear factor-kappa B (NF-κB) signaling pathway was activated after induction by TGF-β2 (P<0.05). In turn, overexpressed miR-let7c significantly inhibited TGF-β2-induced EMT (P<0.05). However, miR-let7c was unable to inhibit TGF-β2-induced EMT when the NF-κB signaling pathway was inhibited by BAY11-7082 (P<0.01). CONCLUSION: The miR-let7c regulates TGF-β2-induced EMT through the NF-κB signaling pathway in ARPE-19 cells.

The anti-inflammatory regulation of calcitonin gene-related peptide in mouse Aspergillus fumigatus keratitis

2020/3/30 0:00:00
AIM: To analyze the impact of calcitonin gene-related peptide (CGRP) in mouse keratitis after Aspergillus fumigatus (A. fumigatus) infection. METHODS: C57BL/6 mice were treated subconjunctivally with different concentrations of exogenous CGRP, and BALB/c mice were treated with CGRP8-37 (a CGRP antagonist) before corneas were infected with A. fumigatus. The cornea was assessed under the slit-lamp and the clinical score was recorded. The mRNA levels of IL-1β, TNF-α, IL-6, and MIP-2 were detected by quantitative real-time polymerase chain reaction (PCR), while the protein level of IL-1β was determined by Western blotting. In vitro, RAW264.7 cells were used to investigate NLRP3 and IL-1β expression induced by A. fumigatus after the pretreatment of exogenous CGRP or CGRP8-37. Cytokines expression in RAW264.7 cells was evaluated by real-time PCR and Western blotting. RESULTS: Using exogenous CGRP resulted in down-regulated synthesis of IL-1β and MIP-2 stimulated by A. fumigatus in C57BL/6 mice keratitis, and the synthesis of IL-1β, MIP-2 and IL-6 was up-regulated in BALB/c mice corneas after the pretreatment with CGRP8-37. Pretreatment with exogenous CGRP and CGRP8-37 did not influence TNF-α mRNA levels either in BALB/c or C57BL/6 mice keratitis. The levels of NLRP3 and IL-1β were both reduced in A. fumigatus stimulated-macrophages after treatment with exogenous CGRP. And CGRP8-37 pretreatment would increase NLRP3 and IL-1β levels. CONCLUSION: CGRP may alleviate the inflammatory reaction in mice keratitis after infection with A. fumigatus. The anti-inflammatory effect may be related to the inhibition of NLRP3 expression by CGRP.

High-mobility group box1 as an amplifier of immune response and target for treatment in Aspergillus fumigatus keratitis

2020/3/30 0:00:00
AIM: To determine the roles of high-mobility group box1 (HMGB1) in pro-inflammation, host immune response and its potential target for treatment in Aspergillus fumigatus (A.fumigatus) keratitis. METHODS: Expression of HMGB1 was tested in C57BL/6 normal and infected corneas. Dual immunostaining tested co-expression of HMGB1 with TLR4 or LOX-1. C57BL/6 mice were pretreated with Box A or PBS and then infected. Clinical scores, polymerase chain reaction, ELISA, and MPO assay were used to assess the disease response. Flow cytometry were used to test the effect of Box A on reactive oxygen species (ROS) expression after A.fumigatus stimulation in polymorphonuclear neutrophilic leukocytes (PMN). C57BL/6 peritoneal macrophages were pretreated with Box B before A.fumigatus stimulation, and MIP-2, IL-1β, TNF-α, HMGB1 and LOX-1 were measured. Macrophages were pretreated with Box B or Box B combined with Poly(I) (an inhibitor of LOX-1) before stimulating with A.fumigatus, and MIP-2, IL-1β, TNF-α, LOX-1, p38-MAPK, p-p38-MAPK were measured. RESULTS: HMGB1 levels were elevated in C57BL/6 mice after infection. HMGB1 co-expressed with TLR4, and LOX-1 in infiltrated cells. Box A vs PBS treated C57BL/6 mice had lower clinical scores and down-regulated corneal HMGB1, MIP-2, IL-1β expression and neutrophil influx. Box B treatment amplified expression of MIP-2, IL-1β, TNF-α, HMGB1 and LOX-1 that induced by A.fumigatus in macrophage. Compared to the treatment of Box B only, the protein expression of IL-1β, TNF-α showed inhibition of Box B combined with Poly(I), which also reduced the A.fumigatus-evoked protein level of LOX-1 and phosphorylation level of p38-MAPK. The production of A.fumigatus-stimulated ROS was significantly declined after Box A pretreatment in PMN. CONCLUSION: Blocking HMGB1 reduces the disease response in C57BL/6 mice. HMGB1 can amplify the host immune response through p38-MAPK, and is a target for treatment of A.fumigatus keratitis.

miRNA-145/miRNA-205 inhibits proliferation and invasion of uveal melanoma cells by targeting NPR1/CDC42

Yang Li, Jing-Ting Luo, Yue-Ming Liu and Wen-Bin Wei — 2020/3/30 0:00:00
AIM: To investigate the role of microRNA-145 (miRNA-145) and microRNA-205 (miRNA-205) in proliferation and invasion of uveal melanoma (UM) cells. METHODS: The expression level of miRNA-145 and miRNA-205 from samples of UM patients were determined by real-time polymerase chain reaction (RT-PCR). The growth and invasion inhibitory effects were observed by the transfection of UM cells with miRNA-145 and miRNA-205. Several epithelial-to-mesenchymal transition (EMT) -related proteins were screened by Western blotting. UM clinical samples from The Cancer Genome Atlas (TCGA) were applied to search for potential protein interaction. Pearson’s correlation analysis was applied to estimate co-expression between genes. Dual-luciferase reporter assay was used to verify the binding sites on target protein for miRNA-145 and miRNA-205. RESULTS: The expression levels of miRNA-145 and miRNA-205 in the samples from patients with UM were significantly lower than those in the normal tissue samples. Significant growth and invasion inhibitory effects were observed in human UM cells with miRNA-145 and miRNA-205 overexpression. The miRNA-145 and miRNA-205 could decrease the expression level of cell division control protein 42 (CDC42). After database searching and sequence alignment, we identified that Neuropilin 1 (NRP1) had binding sites for both miRNA-145 and miRNA-205. CONCLUSION: The miRNA-145 and miRNA-205 can reduce the proliferation, migration and invasion of UM cells by targeting the mRNA of its upstream protein NRP1 to down-regulate the expression level of CDC42.

Biocompatibility of polyetheretherketone for the treatment of orbital bone defects

Rui-Dong Gu, Fan Xiao, Lin Wang, Kai-Jian Sun and Lin-Lin Chen — 2020/3/30 0:00:00
AIM: To investigate the biocompatibility and therapeutic effects of polyetheretherketone (PEEK) on recovery of a rabbit orbital defect. METHODS: Totally 16 New Zealand rabbits were used to establish an orbital bone defect model and then randomly divided into two groups. PEEK was implanted in the experimental group. The control group was blank, and no substance was implanted. The model rabbits were sacrificed at 4 and 8wk, and examined by general observations, histology, electron microscopy, Western blotting, and real-time polymerase chain reaction. RESULTS: No infection or rejection occurred after PEEK implantation, and biocompatibility was good. The relative expression of vascular endothelial growth factor (VEGF) protein in the experimental group was significantly higher than that in the control group postoperatively (P<0.05). Bone defect repair in the experimental group was significantly better than that in the control group in the same period and some osteogenesis was observed. CONCLUSION: PEEK has good biocompatibility and efficacy for the treatment of orbital bone defects in a rabbit model.

Sensitized heat shock protein 27 induces retinal ganglion cells apoptosis in rat glaucoma model

Wei Zhao, Le Dai, Xiao-Ting Xi, Qian-Bo Chen, Mei-Xia An and Yan Li — 2020/3/3 0:00:00
AIM: To investigate the relationships between the changes of heat shock protein 27 antibody (anti-HSP27) in serum/cerebrospinal fluid (CSF), intraocular pressure (IOP), retinal ganglion cell (RGC) apoptosis in a rat glaucoma model and disclose the underlying pathogenesis of glaucoma. METHODS: A total of 115 Wistar rats were randomly divided into 4 groups. Group 1 was the ocular hypertension group by condensing 3 episcleral & limbal veins or episcleral area of right eye (HP group, n=25) and sham operation group with conjunctiva incision without coagulation (n=25). Group 2: HSP27 or dose-matched PBS was injected into the vitreous (V-HSP27 group, n=15; V-PBS group, n=15). Group 3: HSP27 and complete Freund’s adjuvant or dose-matched PBS was injected subcutaneously into the hind limb accompanied intraperitoneal injection of pertussis toxin [sensitized group (I-HSP27 group), n=15; I-PBS group, n=15)]. Group 4 was normal group without any treatment (n=5). IOPs of the rats were measured before, day 3, weeks 1, 2, 4, 6, and 8 after treatment. Paraffin-embedded sections were prepared for HE staining and RGCs apoptosis were detected by TUNEL. Anti-HSP27 level in serum and CSF were examined by ELISA. RESULTS: IOPs were elevated significantly in HP and V-HSP27, V-PBS groups (P<0.01) and positively related to anti-HSP27 levels in serum and CSFs. Anti-HSP27 levels in serum and CSF were elevated significantly in I-HSP27 group compared to other groups (P<0.05). However, the IOPs did not show any relationship with the high-level anti-HSP27 in serum and CSFs. RGC apoptosis were all elevated significantly in the HP, V-HSP27, V-PBS and I-HSP27 groups and also positively relative with anti-HSP27 level in serum and CSFs except that high-level of anti-HSP27 in the serum of I-HSP group. CONCLUSION: The increases of anti-HSP27 levels in serum and CSFs both promote IOP escalation and the increase of RGC apoptosis in retina when anti-HSP27 is at low level. The case of high-level anti-HSP27 is opposite and shows protective function in preventing IOP increase and RGC apoptosis.

Identification of microRNA-mRNA regulatory networks and pathways related to retinoblastoma across human and mouse

Rui Tian, He Zou, Lu-Fei Wang, Mei-Jiao Song, Lu Liu and Hui Zhang — 2020/3/3 0:00:00
AIM: To explore the mRNA and pathways related to retinoblastoma (RB) genesis and development. METHODS: Microarray datasets GSE29683 (human) and GSE29685 (mouse) were downloaded from NCBI GEO database. Homologous genes between the two species were identified using WGCNA, followed by protein-protein interaction (PPI) network construction and gene enrichment analysis. Disease-related miRNAs and pathways were retrieved from miR2Disease database and Comparative Toxicogenomics Database (CTD), respectively. RESULTS: A total of 352 homologous genes were identified. Two pathways including “cell cycle” and “pathway in cancer” in CTD and enrichment analysis were identified and seven miRNAs (including hsa-miR-373, hsa-miR-34a, hsa-miR-129, hsa-miR-494, hsa-miR-503, hsa-let-7 and hsa-miR-518c) were associated with RB. miRNAs modulate “cell cycle” and “pathway in cancer” pathways via regulating 13 genes (including CCND1, CDC25C, E2F2, CDKN2D and TGFB2). CONCLUSION: These results suggest that these miRNAs play crucial roles in RB genesis through “cell cycle” and “pathway in cancer” pathways by regulating their targets including CCND1, CDC25C, E2F2 and CDKN2D.

Involvement of moesin phosphorylation in ischemia/reperfusion induced inner blood-retinal barrier dysfunction

Jing Xu, Qiong Liu, Ming Ma, Lin-Jiang Chen, Jian Yu, Ke Xiong and Jing Wu — 2020/3/3 0:00:00
AIM: To investigate the role of moesin and its underlying signal transduction in retinal vascular damage induced by retinal ischemia-reperfusion (RIR) insult. METHODS: C57BL/6 mice were subjected to continued ischemia for 45min, followed by blood reperfusion. The expression and phosphorylation of moesin in retinal vessels were detected by immunohistochemistry and Western blotting. The inner blood-retinal barrier was evaluated using FITC-dextran leakage assay on whole-mount retina. Further studies were conducted to explore the effects of p38 mitogen-activated protein kinase (MAPK) pathway on the involvement of moesin in RIR-evoked retinal vascular hyperpermeability response. RESULTS: It revealed that RIR induced moesin phosphorylation in a time-dependent manner after reperfusion. The phosphorylation of moesin was alleviated by inhibitions of p38 MAPK, while this treatment also ameliorated the dysfunction of inner blood-retinal barrier. CONCLUSION: The results suggest that moesin is involved in RIR-evoked retinal vascular endothelial dysfunction and the phosphorylation of moesin is triggered via p38 MAPK activation.

Beta-adrenergic agonist protects retinal pigment epithelium against hydroxycholoroquine toxicity via cAMP-PKA signal pathway

Ruihua Zhang, Dan-Ning Hu and Richard Rosen — 2020/3/3 0:00:00
AIM: To test our hypothesis that activation of protein kinase A (PKA) signal pathway by β-adrenergic agonist plays an important role in the protecting of cultured retinal pigment epithelial (RPE) cells against the hydroxychloroquine (HCQ) toxicity. METHODS: Cultured human RPE cells were treated with 1) HCQ, 2) HCQ with salbutamol (a β2-adrenergic receptor agonist), and 3) HCQ with salbutamol and a PKA inhibitor, and compared these to 4) untreated cells (controls). After treated for 24h, cell vacuolation, cells viability, PKA and PKA kinase activity levels were determined by the measurement of the size of vacuoles using Image J software, the cell counting with a dye-exclusion testing, Western blot and PKA kinase detection, respectively. RESULTS: Cell vacuolation and cell death of cultured RPE cells were significantly increased by the treatment of HCQ. Salbutamol significantly elevated PKA and PKA activity levels and this was associated with the inhibition of the vacuolation and cell death. The PKA inhibitor significantly decreased the PKA levels and eliminated the protective effects of salbutamol on HCQ-treated RPE cells. CONCLUSION: The PKA pathway plays an important role in the protective effects of β2-adrenergic agonist on the RPE cells against HCQ toxicity. These findings reveal a novel potential strategy against HCQ retinopathy by treatment with PKA activating medications.

LRG1 promotes corneal angiogenesis and lymphangiogenesis in a corneal alkali burn mouse model

Shan Song, Jun Cheng, Bing-Jie Yu, Li Zhou, Hai-Feng Xu and Ling-Ling Yang — 2020/2/4 0:00:00
AIM: To investigate the potential effect and mechanism of leucine-rich α-2-glycoprotein-1 (LRG1) on corneal angiogenesis and lymphangiogenesis. METHODS: Corneal neovascularization and lymphatics were induced by establishing alkali burn mouse model. Immunofluorescence staining was performed to detect the location of LRG1 in cornea tissues and to verify the source of LRG1-positive cells. Corneal whole-mount staining for CD31 (a panendothelial cell marker) and lymphatic endothelial hyluronan receptor-1 (LYVE-1; lymphatic marker) was performed to detect the growth of blood and lymphatic vessels after local application of exogenous LRG1 protein or LRG1 siRNA. In addition, expressions of the proangiogenic vascular endothelial growth factor (VEGF) related proteins were detected using Western blot analysis. RESULTS: LRG1 was dramatically increased in alkali burned corneal stroma in both the limbal and central areas. LRG1-positive cells in the corneal stroma were mainly derived from Vimentin-positive cells. Local application of exogenous LRG1 protein not only aggravated angiogenesis but also lymphangiogenesis significantly (P<0.01). LRG1 group upregulated the levels of VEGF and the vascular endothelial growth factor receptor (VEGFR) family when compared with the phosphate-buffered saline (PBS) control group. We also found that LRG1-specific siRNA could suppress corneal angiogenesis and lymphangiogenesis when compared with the scramble siRNA-treated group (P<0.01). CONCLUSION: LRG1 can facilitate corneal angiogenesis and lymphangiogenesis through heightening the stromal expression of VEGF-A, B, C, D and VEGFR-1, 2, 3; LRG1-specific siRNA can suppress corneal angiogenesis and lymphangiogenesis in corneal alkali burn mice.

Association of IGF1R polymorphisms (rs1546713) with susceptibility to age-related cataract in a Han Chinese population

2020/2/4 0:00:00
AIM: To explore the susceptible association between the insulin-like growth factor-1 receptor (IGF1R) single nucleotide polymorphism (SNP) and age-related cataract (ARC), and investigate the underlying mechanisms in human lens epithelium (HLE) cells. METHODS: Totally 1190 unrelated participants, comprising 690 ARC patients and 500 healthy individuals in Han Chinese population were recruited and genotyped for target SNP. The χ2-test was used to detect genotypic distribution between the patient and control groups and the logistic regression was performed to adjust the age and gender. Meanwhile, different biological experimental methods, such as cell counting kit 8 (CCK-8) assay, flow cytometry, quantitative real time polymerase chain reaction (Q-PCR) and Western blot, were used to detect cell viability, cell cycle progression and apoptosis in HLE cells or IGF1R knockdown HLE cells. RESULTS: The rs1546713 in IGF1R gene was identified (P=0.046, OR: 1.606, 95%CI: 1.245-2.071), which shown a significant relevance with ARC risk under the dominant model. The results demonstrated that IGF1R knockdown inhibited cell proliferation by inducing cell cycle arrested at S phase and promoting apoptosis. Mechanistically, the cell cycle blocked at S phase was linked with the alterations of cyclin A, cyclin B, cyclin E and P21. The pro-apoptosis function of IGF1R may related with stimulating the activation of Caspase-3 and altering the expression levels of apoptotic proteins, including Bcl-2, Bax and Caspase-3. CONCLUSION: This study first report that IGF1R polymorphisms may affect susceptibility to ARCs in Han Chinese population and provide new clues to understand the pathogenic mechanism of ARCs. Notably, IGF1R is likely a potential target for ARC prevention and treatment.

Complement factor B knockdown by short hairpin RNA inhibits laser-induced choroidal neovascularization in rats

Xin Wang, Qing-Li Shang, Jing-Xue Ma, Shu-Xia Liu, Cai-Xia Wang and Cheng Ma — 2020/2/4 0:00:00
AIM: To evaluate whether recombinant complement factor B (CFB) short hairpin RNA (shRNA) reduces laser-induced choroidal neovascularization (CNV) in rats. METHODS: Laser-induced rat CNV model was established, and then the animals underwent fundus fluorescence angiography (FFA) and hematoxylin and eosin (HE) staining. On day 3 and 7 after photocoagulation, the expression of CFB and membrane attack complex (MAC) was detected by immunhischemistry. A recombinant CFB-shRNA plasmid was constructed. CFB and scrambled shRNA plasmids were intravenous injected into rats via the tail vein on the day of laser treatment, respectively. On day 7, the incidence of CNV was determined by FFA, and the expression of CFB and vascular endothelial growth factor (VEGF) in retinal pigment epithelium (RPE)/choroidal tissues was detected by immunhischemistry, Western blot and/or semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) in CFB and scrambled shRNA groups. The possible adverse effects of CFB-shRNA injection were assessed by transmission electron microscopy and electroretinography. RESULTS: FFA and HE results indicated that a laser-induced rat CNV model was successfully established on day 7 after photocoagulation. The expression of CFB and MAC was extremely weak in normal retina and choroid, and increased on day 3 after photocoagulation. However, it started to reduce on day 7. CFB shRNA plasmid was successfully constructed and induced CFB knockdown in the retinal and choroidal tissues. FFA showed CFB knockdown significantly inhibited incidence of CNV in rats. Moreover, CFB knockdown significantly inhibited the expression of VEGF in RPE/choroidal tissues. CFB shRNA caused no obvious side effects in eyes. CONCLUSION: CFB knockdown significantly inhibits the formation and development of CNV in vivo through reducing the expression of VEGF, which is a potential therapy target. The alternative pathway of complement activation plays an important role in CNV formation.

Quantitative analysis by reversed-phase high-performance liquid chromatography and retinal neuroprotection after topical administration of moxonidine

2020/2/4 0:00:00
AIM: To determine moxonidine in aqueous humor and iris-ciliary body by reversed-phase high performance liquid chromatography (RP-HPLC), and to evaluate the retinal neuroprotective effect after topical administration with moxonidine in a high intraocular pressure (IOP) model. METHODS: The eyes of albino rabbits were administered topically and ipsilaterally with 0.2% moxonidine. A RP-HPLC method was employed for the identification and quantification of moxonidine between 2 and 480min, which presented in the aqueous humor and iris-ciliary body. Flash electroretinography (F-ERG) amplitude and superoxide dismutase (SOD) level were measured between day 1 and day 15 after topical administration with moxonidine in a rabbit model of high IOP. Histological and ultrastructural observation underwent to analyze the changes of retinal morphology, the inner retinal layers (IRL) thickness, and retinal ganglion cell (RGC) counting. RESULTS: Moxonidine was detectable between 2 and 480min after administration, and the peak concentration developed both in the two tissues at 30min, 0.51 μg/mL in aqueous humor and 1.03 μg/g in iris-ciliary body. In comparison to control, F-ERG b-wave amplitude in moxonidine eyes were significantly differences between day 3 and day 15 (P<0.01) in the high IOP model; SOD levels were significantly higher at all time-points (P<0.01) with a maximum level of 20.29 U/mgprot at day 15; and RGCs were significantly higher (P<0.05). CONCLUSION: Moxonidine is a viable neuroprotective agent with application to high IOP model. All layers of retina, including RGC layer, retinal nerve fiber layer and INL, are more preserved after moxonidine administration. SOD plays a neuroprotective role in ocular hypertension-mediated RGC death.

Expression and role of aryl hydrocarbon receptor in Aspergillus fumigatus keratitis

2020/2/3 0:00:00
AIM: To observe the expression and role of aryl hydrocarbon receptor (AhR) in the immune response of mouse cornea infected with Aspergillus fumigatus (A. fumigatus). METHODS: Murine models of A. fumigatus keratitis were established by scraping the central epithelium of mouse cornea, daubing A. fumigatus on the cornea and covering with a contact lens. The mice were randomly divided into the control group and the A. fumigatus-infected (A.F.) group for 1, 3 and 5d respectively, which corneas were daily monitored by a slit lamp microscope and the clinical scores were also recorded timely after infection. In this study, immunofluorescence staining was used to detect the expression and localization of AhR in mouse corneas, and the mRNA and protein of AhR were detected by reverse transcription-polymerase chain reaction (RT-PCR) and Western blot. In addition, mouse peritoneal macrophages were stimulated by A. fumigatus with or without the pretreatment of AhR antagonist CH223191 and AhR agonist FICZ, and the tumor necrosis factor alpha (TNF-α), inducible nitric oxide synthase (iNOS), interleukin-10 (IL-10) and Arg-1 mRNA were detected by RT-PCR. RESULTS: According to the results of the slit light photography, it was clearly indicated that the corneal inflammation were the most severe and the clinical score became the highest as well on the 3rd day after the infection of A. fumigatus. Contrasted with the control group, the expression of AhR in the corneal epithelial cells infected with A. fumigatus was significantly increased detected by immunofluorescence staining. AhR mainly expressed in the nucleus and cytoplasm of corneal epithelial cells. Consistent with the transcriptional level of AhR mRNA, the expression level of AhR protein reached the peak on the 3rd day after infection which was detected by Western blot. Furthermore, RT-PCR showed that CH223191 up-regulated the expression of TNF-α and iNOS and down-regulated the expression of IL-10 and Arg-1 in peritoneal macrophages; inversely, FICZ reduced the expression of TNF-α and iNOS while elevated the expression of IL-10 and Arg-1. CONCLUSION: AhR is involved in the pathogenesis of A. fumigatus keratitis and induced immune protection in anti-A. fumigatus immune response by inhibiting M1 and increasing M2 phenotype macrophage-related inflammatory factors.

Netrin-1 promotes epithelium repair in corneal injury

2020/2/3 0:00:00
AIM: To explore netrin-1 functions on corneal epithelium in vitro and in vivo. METHODS: In vitro the human corneal epithelial (HCE) cells were treated with serum free DMEM-F12 basic media containing 0, 50, 100, 200, 300, 500, 800, and 1000 ng/mL of netrin-1, respectively. The cells viability was detected by cell counting kit-8 (CCK-8). The wound-healing assay was applied to assess the migration proficiency of HCE cells. Flow cytometry was used to analyze the cell-cycle distribution and apoptosis. In vivo, normal c57 (6wk) mice were demarcated with a trephine in the middle of the cornea to produce a 3-mm circular wound. Mice corneas were inflicted no epithelium with a 3-mm wound displayed, but remained the limbal epithelium intact. A blunt scalpel blade was used to remove the corneal epithelian cells, followed by topical netrin-1 application (200 ng/mL), and the group treated by PBS as control. The treated group was injected netrin-1 into the normal c57 mice inferior subconjunctival 4h before trauma. Mouse corneal inflammation and neovascularization were observed under slit lamp microscope. The apoptosis of corneal cells was determined by TUNEL staining. CONCLUSION: Netrin-1 can reduce HCE apoptosis as well as promote its proliferation and migration. Topical application of netrin-1 promotes the injuryed cornea epithelial wound repair and inhibits apoptosis of corneal epithelial cells. These findings may offer potential therapies to repair the defects of corneal epithelial based on netrin-1.

Targeting long non-coding RNA MALAT1 alleviates retinal neurodegeneration in diabetic mice

Yu-Lan Zhang, Han-Ying Hu, Zhi-Peng You, Bing-Yang Li and Ke Shi — 2020/2/3 0:00:00
AIM: To observe the effect of inhibiting long non-coding RNA (lncRNA) metastasis-associated lung adenocarcinoma transcript 1 (MALAT1) on diabetic neurodegeneration. METHODS: Thirty-six 8-week-old C57BL/6 mice were randomly divided into normal control, diabetic control, diabetic scrambled small interfering RNAs (siRNAs) and diabetic MALAT1-siRNA groups. After diabetic induction with streptozocin intraperitoneally-injection, the diabetic MALAT1-siRNA group was intravitreally injected with 1 μL 20 μmol/L MALAT1 siRNA, and the diabetic scrambled siRNA group was injected with the same amount of scrambled siRNA. Electroretinography was performed to examine photoreceptor functions 16wk after diabetes induction. MALAT1 expression was detected via real time polymerase chain reaction. Cone morphological changes were examined using immunofluorescence. Rod morphological changes were examined by determining outer nuclear layer (ONL) thickness. RESULTS: The upregulation of retinal MALAT1 expression was detected in the diabetic control mice, while MALAT1 expression in the diabetic MALAT1-siRNA mice was decreased by 91.48% compared to diabetic control mice. The diabetic MALAT1-siRNA and diabetic control mice showed lower a-wave and b-wave amplitudes than did the normal control mice in scotopic and photopic electroretinogram, while the diabetic MALAT1-siRNA mice showed higher amplitudes than diabetic control mice. Morphological examination revealed that ONL thickness in the diabetic MALAT1-siRNA and diabetic control mice was lower than normal control mice. However, ONL thickness was greater in the diabetic MALAT1-siRNA mice than diabetic control mice. Moreover, the diabetic control mice performed a sparser cone cell arrangement and shorter outer segment morphology than diabetic MALAT1-siRNA mice. CONCLUSION: Inhibiting retinal MALAT1 results in mitigative effects on the retinal photoreceptors, thus alleviating diabetic neurodegeneration.

Simultaneous expression of two pathogenic genes in four Chinese patients affected with inherited retinal dystrophy

2020/2/3 0:00:00
AIM: To describe the complex, overlapping phenotype of four Chinese patients with inherited retinal dystrophies (IRDs) who harbored two pathogenic genes simultaneously. METHODS: This retrospective study included 4 patients affected with IRDs. Medical and ophthalmic histories were obtained, and clinical examinations were performed. A specific Hereditary Eye Disease Enrichment Panel (HEDEP) based on exome capture technology was used for genetic screening. RESULTS: Four patients were identified to harbor disease-causing variants in two different genes. Patient retinitis pigmentosa (RP) 01-II:1 exhibited both classical ABCA4 -induced Stargardt disease (STGD) 1 and USH2A-associated RP, patient RP02-III:2 exhibited both classical ABCA4-induced STGD1 and CDH23-associated RP, patient RP03-II:1 exhibited both USH2A-induced autosomal recessive retinitis pigmentosa (arRP) syndrome and SNRNP200-induced autosomal dominant retinitis pigmentosa (adRP), and patient RP04- II:2 exhibited USH2A-induced arRP syndrome and EYS-induced arRP at the same time. CONCLUSION: Our study demonstrates that genotype–phenotype correlations and comprehensive genetic screening is crucial for diagnosing IRDs and helping family planning for patients suffering from the disease.

Role of Smad4 from ocular surface ectoderm in retinal vasculature development

Jing Li, Jin-Song Zhang, Jiang-Yue Zhao and Guo-Ge Han — 2020/2/3 0:00:00
AIM: To investigate how signals from lens regulate retinal vascular development and neovascularization. METHODS: Le-Cre transgenic mouse line was employed to inactivate Smad4 in the surface ectoderm selectively. Standard histological and whole-mount retina staining were employed to reveal morphological changes of retinal vasculature in Smad4 defective eye. cDNA microarray and subsequent analyses were conducted to investigate the molecular mechanism underlying the vascular phenotype. Quantitative polymerase chain reaction (qPCR) was carried out to verify the microarrays results. RESULTS: We found that inactivation of Smad4 specifically on surface ectoderm leads to a variety of retinal vasculature anomalies. Microarray analyses and qPCR revealed that Sema3c, Sema3e, Nrp1, Tie1, Sox7, Sox17, and Sox18 are significantly affected in the knockout retinas at different developmental stages, suggesting that ocular surface ectoderm-derived Smad4 can signal to the retina and regulates various angiogenic signaling in the retina. CONCLUSION: Our data suggest that the cross-talk between ocular surface ectoderm and retina is important for retinal vasculature development, and Smad4 regulates various signaling associated with sprouting angiogenesis, vascular remodeling and maturation in the retina of mice.

Changes in corneal innervation and pain responses in fungal keratitis

2019/12/27 0:00:00
AIM: To characterize changes in the cornea nerve and pain responses in fungal keratitis (FK). METHODS: A retrospective analysis of in vivo confocal microscopy images of 11 FK corneas was performed, and the results were compared with those for 11 normal corneas. Subbasal corneal nerves were analyzed for total nerve number, main nerve trunk number, branching patterns and tortuosity. C57BL/6 mice were infected with Aspergillus fumigatus. Disease severity was determined through clinical scoring and slit lamp photography. Corneas were harvested at 1, 3, 5, and 7d post infection (p.i.) and assessed for β III tubulin. Corneal mechanical sensitivity thresholds were detected by von Frey test. β-endorphin (β-EP) and μ receptor protein expression was detected through Western blotting. RESULTS: Total nerve number, main nerve trunk number, and nerve branching were significantly lower in FK patients than in controls, but tortuosity was not significantly different. In infected mice, subbasal nerve density decreased from 1d p.i., reaching a minimum at 5d p.i. Clinical scores rose at 1d p.i., peaked at 3d p.i., and decreased at 5d p.i. Mechanical sensitivity thresholds showed the same trends. β-EP and μ receptor protein expression increased after infection. CONCLUSION: Corneal nerve density is lower in FK patients and Aspergillus fumigatus-infected mice than in controls. Pain sensitivity decreases with postinfection corneal ulcer aggravation. β-EP and μ receptor proteins are both upregulated in infected mouse corneas.

The expression of lacrimal androgen-binding proteins in mice Pseudomonas aeruginosa keratitis

Le-Yu Lyu, Qian Wang, Qiang Xu, Wen-Yi Zhao, Hua Yang and Cheng-Ye Che — 2019/12/27 0:00:00
AIM: To investigate the expression of lacrimal androgen-binding proteins (ABPs) in mice Pseudomonas aeruginosa (P. aeruginosa) keratitis. METHODS: P. aeruginosa mice model from different gender was developed by intra-stromal injection. The expression of lacrimal ABPs in lacrimal gland specimens from P. aeruginosa keratitis mice was detected by the quantitative polymerase chain reaction (qRT-PCR). Corneal virulence was evaluated based on clinical scores. To study the mechanism of lacrimal ABPs’ expression, experimental subjects were pre-treated with 4E-BP1 inhibitor, and were used to evaluate the expression levels by qRT-PCR. RESULTS: Compared with control groups, the expression of ABPα, ABPη and ABPζ in lacrimal gland from P. aeruginosa keratitis mice had no meaningful changes, while ABPε and ABPδ were significantly higher at 1d after infection. The expression of ABPδ in lacrimal gland of male mice was higher than female mice, regardless of whether or not P. aeruginosa keratitis occurred. After 4E-BP1 inhibitor subconjunctival injection or lacrimal injection, the expression of ABPδ and ABPε has no significant change compared with the control group. CONCLUSION: ABPδ and ABPε secreted by mice lacrimal gland may involve in the progress of alleviating the severity of corneal damage in P. aeruginosa keratitis. The expression of ABPδ and ABPε upon P. aeruginosa infection is independent of cap-dependent mRNA translation activated by 4E-BP1.

Effects of epidermal growth factor on transforming growth factor-beta1-induced epithelial-mesenchymal transition and potential mechanism in human corneal epithelial cells

Shu-Yang Chen, Chen Xie, Hong Zhu and Ye Shen — 2019/12/27 0:00:00
AIM: To evaluate the effects of epidermal growth factor (EGF) on transforming growth factor-beta1 (TGF-β1)-induced epithelial-mesenchymal transition (EMT) in human corneal epithelial cells (HCECs). METHODS: HCECs were cultured and treated with TGF-β1 for establishing the model of EMT in vitro. Biological effect of EGF on TGF-β1-induced EMT was evaluated. Proteins and mRNAs expression changes of E-cadherin, N-cadherin and Fibronectin (EMT-relative markers) after TGF-β1 or TGF-β1 combined EGF treatment were detected by Western blot and RT-PCR, respectively. Viability and migration of HCECs were measured by CCK-8, transwell cell migration assay and cell scratch wound healing assay. Activation of Smad2, ERK, p38, JNK and Akt signaling pathways were evaluated by Western blot. Inhibitors of relevant signaling pathways were added to the HCECs to explore the key signal mechanism. RESULTS: With treatment of TGF-β1 only, three EMT-relative proteins and mRNA expression showed that EMT up-regulated in a concentration-dependent and time-dependent manner, with significantly decreasing cell viability (TGF-β1≥5 ng/mL, P<0.05) and increasing cell migration (TGF-β1≥5 ng/mL, P<0.01). The phosphorylation of Smad2 and p38 was a key process of TGF-β1-induced EMT. Meanwhile, EMT-relative proteins and mRNA expression showed that EGF inhibited TGF-β1-indued EMT, with significantly increasing cell viability (EGF≥10 ng/mL, P<0.01). It was noteworthy that EGF significantly enhanced cell migration although EMT was inhibited (EGF≥10 ng/mL, P<0.01), and the blockage of p38 (by SB202190, a p38 inhibitor) was a potential mechanism of this phenomenon. CONCLUSION: EGF inhibits TGF-β1-induced EMT via suppressive p38, and promotes cells proliferation and migration in a non-EMT process by inhibiting p38 pathway.

Expression and role of autophagy related protein p62 and LC3 in the retina in a rat model of acute ocular hypertension

2019/12/27 0:00:00
AIM: To investigate the expression and possible role of the autophagy related protein p62 and LC3 in the retina based on a rat model of acute ocular hypertension. METHODS: Fifty rats were randomized into five groups: control group A, B, C, and D. Groups A to D all received normal saline perfusion into the anterior chamber with pressure of 80 mm Hg for one hour, and retina tissue was obtained at 6, 12, 24 and 48h after perfusion respectively, to investigate the activation of autophagy following ischemia-reperfusion. The distribution and semi-quantification of autophagy related protein p62 and LC3 in the retina were detected using immunohistochemistry technique. The expression level of these two proteins was evaluated using Western blot. RESULTS: The number of retinal ganglion cells (RGCs) decreased with increasing reperfusion time, and significant reduction in the retinal thickness was observed 48h after perfusion. In normal adult rats, LC3 protein was mainly expressed in the ganglion cell layer (GCL), and p62 protein was expressed in the nerve fiber layer (NFL), GCL, inner plexiform layer (IPL), inner nuclear layer (INL) and outer plexiform layer (OPL). In comparison to the control group, the expression level of LC3- II was higher in all the experimental groups (P<0.05), with the peak expression at 12h after reperfusion. Additionally, the expression level of p62 was higher in all the experimental groups than the control (P<0.05, except for group A), with the peak level occurred 24h after reperfusion. CONCLUSION: Both p62 and LC3 show low level and uneven expression in the retina of normal adult rats. Acute ocular hypertension can lead to upregulation of LC3- II and p62 expression in the retina. Autophagy flux is damaged 12h after reperfusion, potentially resulting in further loss of RGCs.

Is there a primitive reflex residue underlying Marcus Gunn Syndrome? Rat electrophysiology

2019/12/27 0:00:00
AIM: To make an electrophysiological demonstration of a possible jaw muscle afferents-oculomotor neural pathway that was proposed by our previous works on rats, which substantiates an early “release hypothesis” on pathogenesis of human Marcus Gunn Syndrome (MGS). METHODS: Extracellular unit discharge recording was applied and both orthodromic and spontaneous unitary firing were recorded in the oculomotor nucleus (III), and the complex of pre-oculomotor interstitial nucleus of Cajal and Darkschewitsch nucleus (INC/DN), following electric stimulation of the ipsilateral masseter nerve (MN) in rats. RESULTS: Extracellular orthodromic unit discharges, with latencies of 3.7±1.3 and 4.7±2.9ms, were recorded unilaterally in the III, and the INC/DN neurons, respectively. Spontaneous unit discharges were also recorded mostly in the INC/DN and less frequently in the III. Train stimulation could prompt either facilitation or inhibition on those spontaneous unit discharges. The inhibition pattern of train stimulation on the spontaneous discharging was rather different in the III and INC/DN. A slow inhibitory pattern in which spontaneous firing rate decreased further and further following repeated train stimulation was observed in the III. While, some high spontaneous firing rate units, responding promptly to the train stimuli with a short-term inhibition and recovered quickly when stimuli are off, were recorded in the INC/DN. However, orthodromic unit discharge was not recorded in the III and INC/DN in a considerable number of experiment animals. CONCLUSION: A residual neuronal circuit might exist in mammals for the primitive jaw-eyelid reflex observed in amphibians, which might not be well-developed in all experimental mammals in current study. Nonetheless, this pathway can be still considered as a neuroanatomic substrate for development of MGS in some cases among all MGS with different kind of etiology.

Proteomic analysis of anti-angiogenic effects by conbercept in the mice with oxygen induced retinopathy

Ji Jin, Lei Chen, Gao-Qin Liu and Pei-Rong Lu — 2020/10/21 0:00:00
AIM: To analyze the retinal proteomes with and without conbercept treatments in mice with oxygen-induced retinopathy (OIR) and identify proteins involved in the molecular mechanisms mediated by conbercept. METHODS: OIR was induced in fifty-six C57BL/6J mouse pups and randomly divided into four groups. Group 1: Normal17 (n=7), mice without OIR and treated with normal air. Group 2: OIR12/EXP1 (n=14), mice received 75% oxygen from postnatal day (P) 7 to 12. Group 3: OIR17/Control (n=14), mice received 75% oxygen from P7 to P12 and then normal air to P17. Group 4: Lang17/EXP2 (n=21), mice received 75% oxygen from P7 to P12 with intravitreal injection of 1 μL conbercept at the concentration of 10 mg/mL at P12, and then normal air from P12 to P17. Liquid Chromatography-Mass Spectrometry (LC-MS)/MS data were reviewed to find proteins that were up-regulated after the conbercept treatment. Gene ontology (GO) analysis was performed of conbercept-mediated changes in proteins involved in single-organism processes, biological regulation, cellular processes, immune responses, metabolic processes, locomotion and multiple-organism processes. RESULTS: Conbercept induced a reversal of hypoxia-inducible factor 1 signaling pathway as revealed by the Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis and also induced down-regulation of proteins involved in blood coagulation and fibrin clot formation as demonstrated by the Database for Annotation, Visualization and Integrated Discovery (DAVID) and the stimulation of interferon genes studies. These appear to be risk factors of retinal fibrosis. Additional conbercept-specific fibrosis risk factors were also identified and may serve as therapeutic targets for fibrosis. CONCLUSION: Our studies reveal that many novel proteins are differentially regulated by conbercept. The new insights may warrant a valuable resource for conbercept treatment.

Oxidative stress and mitochondrial dysfunction of retinal ganglion cells injury exposures in long-term blue light

2020/10/21 0:00:00
AIM: To investigate the phototoxic effect of long-term excessive narrow-band blue light in staurosporine-induced differentiated retinal ganglion cells-5 (SSRGC-5). METHODS: SSRGC-5 cells were divided into two groups, blue light group (BL group) and control group. Cell viability was assessed by using CCK-8 assay. Metabolic profile analysis was performed by using Seahorse extracellular flux analyzer. Mitochondria ultrastructure were studied via transmission electron microscope (TEM). Mitochondria contents and oxidative stress was evaluated by flow cytometry. Western blotting was performed to monitor the changes in mitogen-activated protein kinases (MAPK) pathway and PI3K/AKT pathway. RESULTS: Blue light caused morphological changes of SSRGC-5 cells. The cell viability was significantly decreased from 3h in BL group. Intercellular ROS and mitochondrial superoxide levels were increased following blue light exposure. Metabolic profiling identified blue light induced SSRGC-5 cells to have severely compromised mitochondrial function. This was accompanied by impaired mitochondrial ultrastructure and remodeling, increased expression of the mitochondrial related proteins, and increased glycolysis as compensation. Moreover, the results showed that blue light induced higher expression of p-p38, p38, p-JNK, p-ERK, p-c-Jun, c-Jun, and p-AKT. CONCLUSION: These findings indicate that excessive narrow-band blue light induces oxidative stress and mitochondrial metabolic remodeling dysregulate in SSRGC-5 cells. Activated MAPK and AKT signaling pathways are involved in this process.

Comparative study on pharmacokinetics and toxicity of intravitreal and sub-Tenon injection of triamcinolone acetonide in ocular tissues

2020/10/21 0:00:00
AIM: To compare the differences in kinetics, distribution, and toxicity of triamcinolone acetonide (TA) between the injection methods, sub-Tenon and intravitreal injections in rabbit ocular tissues. METHODS: TA was injected into the vitreous or the sub-Tenon in rabbits. For pharmacokinetic study, rabbits were sacrificed periodically and then TA in blood and ocular tissues (retina/choroids, vitreous, and aqueous humor) were measured over 91d. For toxicological study, clinical signs, slit-lamp microscopic examination, ophthalmological test were performed. The eyeballs and surrounding tissues were collected and fixed with glutaraldehyde-formalin solution, and then paraffin embedded for histological investigation. RESULTS: Higher levels of TA were distributed in the intraocular tissues when injected into the vitreous compared to the sub-Tenon. Conversely, TA level was remarkably lower in the rabbits which received intravitreal TA injections than those treated with sub-Tenon injection throughout the study period in plasma. Optical discharge probably caused by systemic circulation of TA was observed by receiving sub-Tenon TA injection. Meanwhile, technic-associated toxicological ocular symptoms and findings were more frequently observed in intravitreal injection than in sub-Tenon injection. CONCLUSION: There are significant differences in kinetics and distribution of TA in vitreous body, aqueous humor and plasma, between the two injection methods. Although further study is needed to explain the species difference between human and rabbit, it is assumed that the difference in the frequency of intraocular pressure elevation and cataract formation by TA between the two injection methods are directly related to the TA concentrations in aqueous humor and vitreous body in each injection methods. Systemic toxicity and technic-associated toxicity are also closely related to kinetics of TA in plasma and each injection method itself, respectively.

Ganglion cells apoptosis in diabetic rats as early prediction of glaucoma: a study of Brn3b gene expression and association with change of quantity of NO, caspase-3, NF-κB, and TNF-α

2020/10/21 0:00:00
AIM: To find a new concept to show whether or not apoptosis of retinal ganglion cells (RGCs) can be determined in the histology of acute hyperglycemia in the role of expressed Brn3b gene related to nitric oxide (NO), caspase-3, nuclear factor kappa-B (NF-κB), and tumor necrosis factor-α (TNF-α) as an early predictor of primary open angle glaucoma (POAG) eyes and their associations. METHODS: Experimental in vivo study was carried out using adult male, white Sprague-Dawley rats aged ≥2mo, weighing 150-200 g. The animals were divided into two groups, one group receiving intraperitoneal injection of streptozotociz 50 mg/kg in 0.01 mol/L citric buffer and pH 4.5 and a comparison made with the control group. Retinal tissue was divided into two parts (both experimental and control groups respectively): a) right retina for immunohistochemistry (IHC; caspase-3 and TNF-α); b) left retina was divided into two parts for the purpose of real-time polymerase chain reaction (PCR) test (RNA extraction for Brn3b gene expression analysis) and ELISA test (NO and NF-κB). RESULTS: The experimental group showed a decrease in Brn3b gene expression compared to the control group (1.3-fold lower in 2nd month; 1.1-fold lower in 4th month and 2.5-fold lower in 6th month). However, there was a decrease of NO, caspase-3, and an increase of NF-κB and TNF-α quantity. CONCLUSION: The expression of mRNA Brn3b gene is inversely proportional to apoptosis in RGCs. The quantity of NO, caspase-3, NF-κB and TNF-α is influential in expression of Brn3b in RGCs caused by hyperglycemia in diabetic rats.

Houttuynia cordata Thunb rescues retinal ganglion cells through inhibiting microglia activation in a rat model of retinal ischemia-reperfusion

Le-Meng Ren and Ying-Hui Zhang — 2020/10/21 0:00:00
AIM: To determine whether Houttuynia cordata Thunb (HCT) can increase the survival of the retinal ganglion cells (RGCs) and inhibit microglia activation following retinal ischemia-reperfusion (RIR) injury. METHODS: Rat model of RIR was induced by transient elevation of the intraocular pressure (IOP). HCT was orally administered for 2d before the performance of retinal RIR model and once a day for the next 14d. After 14d of RIR injury, the rats were sacrificed for further analysis. Survival RGCs were stained with haematoxylin and eosin (H&E). Apoptosis of RGCs was detected by TUNEL staining. Retinal function was examined by flash-electroretinography (F-ERG). Retinal microglia were labeled using Iba-1, one specific marker for microglia. The mRNA expression levels of inducible nitric oxide synthase (iNOS), tumor necrosis factor alpha (TNF-α), and interleukin 1 beta (IL-1β) were assessed by quantitative real time reverse transcription polymerase chain reaction (qRT-PCR). RESULTS: Systemic HCT treatment significantly reduced RGCs death by H&E staining and exhibited an anti-apoptotic effect as assessed by TUNEL staining at day 14 after RIR injury. HCT greatly improved the retinal function as examined by F-ERG. The number of activated microglia significantly increased after RIR injury, which was significantly attenuated by HCT treatment. Besides, RIR injury induced a strong upregulation of pro-in?ammatory genes TNFα, iNOS and IL-1β mRNAs at day 14 post injury, which was suppressed by HCT. CONCLUSION: Neuroprotective effects of HCT encourage the survival of RGCs through inhibiting microglia activation due to RIR injury. Together these results support the use of HCT as promising therapy for the ischemic events of the retina diseases.

β-elemene down-regulates HIF-lα, VEGF and iNOS in human retinal pigment epithelial cells under high glucose conditions

Yun Zhou, Jun Chen, Li-Hua Li and Lei Chen — 2020/10/21 0:00:00
AIM: To investigate the effects and mechanism of β-elemene on the expressions of hypoxia-inducible factor-1α (HIF-lα), vascular endothelial growth factor (VEGF) and inducible nitric oxide synthase (iNOS) in human retinal pigment epithelial (RPE) cells under high glucose conditions. METHODS: ARPE-19 cell line was cultured under eight conditions: 1) low glucose (LG; 5.5 mmol/L); 2) high glucose (HG; 33 mmol/L); 3) high glucose with 20 μg/mL β-elemene (HG+20E); 4) high glucose with 40 μg/mL β-elemene (HG+40E); 5) high glucose with SB203590 [HG+SB203590, p38-mitogen-activated protein kinase (p38-MAPK) pathway inhibitor]; 6) high glucose with LY294002 [HG+LY294002, phosphoinositide 3-kinase/protein kinase B (PI3K/Akt) pathway inhibitor]; 7) high glucose with 40 μg/mL β-elemene and SB203590 (HG+40E+SB203590); and 8) high glucose with 40 μg/mL β-elemene and LY294002 (HG+40E+LY294002). Cells were treated in conditions 1-4 for 24 and 48h, while for 48h in conditions 5-8. Then mRNA and protein levels of HIF-1α, VEGF and iNOS in cells were measured by real-time polymerase chain reaction (qPCR), immunofluorescence and Western blotting, respectively. Furthermore, protein levels of total p38-MAPK, phosphorylated p38-MAPK (p38-MAPK-P), total Akt and phosphorylated Akt (Akt-P) in cells of conditions 2 and 4 which treated for 48h were measured by Western blotting. RESULTS: The mRNA levels and protein levels of HIF-1α, VEGF and iNOS in cells were significantly reduced in conditions 3-8 when compared with those in condition 2 (P<0.05). These reductions were more obvious in conditions treated for 48h than in conditions treated for 24h. The protein levels of p38-MAPK-P and Akt-P in cells of condition 4 were significantly lower than in condition 2 (P<0.01). CONCLUSION: β-elemene down-regulates HIF-1α, VEGF and iNOS in ARPE-19 cells under a high glucose condition. The inhibitory effect of β-elemene is more significant when its concentration and treatment time are increased, as well as it is combined with SB203590 or LY294002 treatment. P38-MAPK and PI3K/Akt signaling pathways may play a role in this inhibitory effect.

Anti-inflammatory effects of astaxanthin against fungal keratitis

2020/9/17 0:00:00
AIM: To characterize effect of astaxanthin (ASX) in Aspergillus fumigatus (A. fumigatus) induced keratitis in mouse model. METHODS: In vivo, fungal keratitis mouse model was established in C57BL/6 mice using A. fumigatus, followed by ASX or dimethyl sulfoxide (DMSO) treatment. Clinical responses were evaluated by clinical score and myeloperoxidase (MPO) assay. Inflammatory cytokines were assessed by reverse-transcription polymerase chain reaction (RT-PCR), Western blot, immunofluorescence, and enzyme-linked immuno sorbent assay (ELISA). RESULTS: In animal model, ASX improved corneal transparency and clinical response, suppressed the expression of inflammatory cytokine like IL-1β, TNF-α, and HMGB-1. Neutrophil levels have been shown to decrease in ASX-treated cornea by immunofluorescence and MPO. TLR2 and TLR4 levels were lower in ASX-treated group than DMSO-treated. CONCLUSION: ASX can suppress inflammatory response and reduce inflammatory cytokine production in mice model with A. fumigatus keratitis.

Clinical and genetic analysis of Ser341Pro MYOC variant in a Korean family with primary open angle glaucoma

Sangwoo Moon, Namhee Kim and Jiwoong Lee — 2020/9/17 0:00:00
AIM: To report the first discovery of Ser341Pro myocilin (MYOC) variant in Korea and analyze its clinical characteristics and genetic significance. METHODS: Ten family members from three generations participated in this study and received the thorough ophthalmologic examination. Focused exome sequencing on a proband was performed to confirm the target mutations (MYOC c.1021T>C) in the family members, and the direct sequencing was conducted. Variant was analyzed according to the American College of Medical Genetics and Genomics and the Association for Molecular Pathology (ACMG/AMP) guidelines. RESULTS: A nucleotide change from thymine to cytosine at c.1021T>C was found in eight family members. Three members diagnosed with primary open angle glaucoma (POAG) were characterized by severe clinical presentations, high intraocular pressure, and poor response to medical treatment (100% of the patient required filtering surgery). On variant analysis by ACMG/AMP guidelines, Ser341Pro is not found in normal population. Multiple computational predictive programs support a deleterious effect of Ser341Pro variant (PolyPhen 2, SIFT, Mutation Taster). Ser341Pro could be involved in moderate (PM) and supporting (PP) criteria (PM1, PM2, PP2, PP3). Combining the criteria, Ser341Pro has a combination of 2 moderate (PM1+PM2) and 2 supporting (PP2+PP3) criteria, which is interpreted to “likely pathogenic”. CONCLUSION: The Ser341Pro variant is correlated with severe phenotype of POAG. There are similar clinical aspects to previous studies: autosomal dominant inheritance, incomplete penetrance (62.50% and 66.67%), and proportion of patients requiring trabeculectomy (100% in both study). According to ACMG/AMP guidelines and the previous basic researches, the Ser341Pro variant had a “strong evidence of pathogenicity (PS3)” and then it could be interpreted to “pathogenic (PS3, PM1, PM2, PP2, PP3)”. Additionally, Ser341Pro variant can be reported as “c.1021T>C (p.Ser341Pro), likely pathogenic, POAG, autosomal dominant” according to guideline.

Activation of the ATP-P2X pathway by TRPV4 in acute ocular hypertension

Li Sun, Ke Yao, Hong Zhang and Wei Chen — 2020/9/17 0:00:00
AIM: To measure the expression of transient receptor potential cation channel subfamily V member 4 (TRPV4) in the rat cornea and determine whether it is related to adenosine triphosphate (ATP) generation in a rat model of acute ocular hypertension (AOH). METHODS: Immunofluorescence staining of TRPV4, P2X2 receptor, P2X3 receptor, and β3-tubulin in rat corneal longitudinal sections and paved was performed to clearly display histological structures. Rat models of AOH and agonist/antagonist-treated groups were established and corneal ATP was measured using an ATP assay. The independent t-test and simple linear correlation model were adopted for statistical analyses. RESULTS: Immunofluorescence staining of rat cornea sections revealed that epithelial and endothelial membranes showed strong immunoreactivity for TRPV4 and P2X2 receptor and coexpression with β3-tubulin in the rat corneal epithelial layer. Corneal ATP was significantly higher in the AOH rat model than in the control (P<0.05) and apparently lower after pretreatment by applying eyedrops of TRPV4 antagonist RN1734 with 30-40 mm Hg intraocular pressure (IOP; P<0.05). A simple linear regression model showed a positive correlation between rat corneal ATP and IOP values (R2=0.996, P=0.0134) from the normal IOP (113 mm Hg) to 40 mm Hg. At 10-40min after anterior chamber injection of GSK1016790A (0.01 mL, 50 nmol/L in 0.9% NaCl), corneal ATP was significantly higher than in the control group (P<0.05), which peaked at 10min. The ATP concentration of the normal epithelium was higher than that of the endothelium in the AOH rat model and after anterior chamber injection of GSK1016790A (P<0.05). CONCLUSION: The ATP concentration in the AOH rat cornea is increased by TRPV4 activation.

Meibomian gland dysfunction model induced with complete Freund’s adjuvant in C57BL/6 mice

Yang Lu, Yue Yin and Lan Gong — 2020/9/17 0:00:00
AIM: To establish a new inflammatory animal model of meibomian gland dysfunction (MGD) in C57BL/6 mice. METHODS: C57BL/6 mice were randomly divided into complete Freund’s adjuvant (CFA) group (14 animals, 14 eyes), naphthazolin hydrochloride (NH) group (14 animals, 14 eyes) and control group (14 animals, 14 eyes). In CFA group, CFA was used in eyelid conjunctiva injection; in NH group, NH eye drops were used twice a day; control group was injected with equal dose of saline at the same time point and same site with animals in CFA group. The meibomian gland orifices score (MGOS) was evaluated on a scale of 0 to 3 in the middle five meibomian gland orifices of the upper and lower eyelid using slit lamp. After the successful induction of each animal model, intense pulsed light (IPL) was introduced on each mouse in CFA and NH group. Oil red O (ORO), hematoxylin and eosin (H&E) staining were performed before and after successful induction of CFA, NH and control group. RESULTS: At 12wk after CFA injection, inflammatory cell infiltration and fiber necrosis was observed, with acinar density and duct dilatation significantly lower compared with control group. In NH group, the meibomian gland acini were relatively smaller and deformed compared with control group, the number of meibomian gland acini was also slightly lower. No inflammatory cell or fiber necrosis was observed in NH group. After three times of IPL treatment (5/10 mice in each group, and the other 5 mice served as non-IPL control), MGOS was significantly lower in IPL-treated mice in NH group (P<0.01). After three times of IPL treatment, the MGOS of NH group was significantly lower than that in the CFA group (P<0.01). CONCLUSION: We develop a novel animal model that studies the role of inflammation in the development of MGD and IPL treatment. This model indicates that persistent inflammatory state may be the cause of MGD and weaken the therapeutic effect of IPL.

Sulforaphane modulates TGFβ2-induced conjunctival fibroblasts activation and fibrosis by inhibiting PI3K/Akt signaling

Han-Ruo Liu, Zi-Yao Xia and Ning-Li Wang — 2020/8/25 0:00:00
AIM: To examine the effects of sulforaphane on fibrotic changes of transforming growth factor (TGFβ2) induced human conjunctival fibroblast (HConFs). METHODS: HConFs were cultured and divided into control, TGFβ2 (1 ng/mL), sulforaphane and TGFβ2+sulforaphane groups. Cell viability and apoptosis were detected using the MTT and ApoTox-Glo Triplex assay. Cell migration was detected using scratch and Transwell assay. Real-time quantitative PCR method was used to evaluate mRNA expression of TGFβ2, matrix metalloproteinase-2 (MMP2), myosin light chain kinase (MYLK), integrin αV, integrin α5, fibronectin 1 and α-smooth muscle actin (α-SMA). The protein expression of α-SMA, p-PI3K, PI3K, p-Akt, and Akt were detected by Western blot. RESULTS: The proliferation of HConFs was significantly (P<0.05) suppressed by sulforaphane compared to control cells with the increase of the concentration and treatment time. Cell proliferation after 48h incubation was significantly reduced with 100 μmol/L sulforaphane treatment by 17.53% (P<0.05). The Transwell assay showed sulforaphane decreased cell migration by 18.73% compared with TGFβ2-induced HConF (P<0.05). TGFβ2-induced the increasing expression of fibronectin, type I collagen and α-SMA, and the phosphorylation of PI3K and Akt were all significantly suppressed by sulforaphane pretreatment. CONCLUSION: Sulforaphane inhibits proliferation, migration, and synthesis of the extracellular matrix in HConFs, and inhibiting the PI3K/Akt signaling pathway. Sulforaphane could be a potential therapeutic drug for prevention of scar formation in filtering bleb after trabeculectomy.

A novel mutation of LIM2 causes autosomal dominant membranous cataract in a Chinese family

Rui Pei, Peng-Fei Liang, Wei Ye, Ji Li, Ji-Yuan Ma and Jian Zhou — 2020/8/25 0:00:00
AIM: To identify mutations in the genes of a four-generation Chinese family with congenital membranous cataracts and investigate the morphologic changes and possible functional damage underlying the role of the mutant gene. METHODS: Whole exome analysis of thirteen members of a four-generation pedigree affected with congenital membranous cataracts was performed; co-segregation analysis of identified variants was validated by Sanger sequencing. All members underwent detailed physical and complete eye examinations. The physical changes caused by the mutation were analyzed in silico through homology modeling. The lens fiber block from a patient was observed under a scanning electron microscope (SEM). Cell membrane proteins and cytoplasmic proteins from the human lenses donated by one patient with cataract in this family and from the dislocated lens resulted from the penetrating ocular trauma of a patient unrelated with this family were extracted, and the expression and localization of MP20 and Cx46 were detected by Western blot (WB) assay in these proteins. RESULTS: A novel LIM2 heterozygous mutation (c.388C>T, p.R130C) was identified with congenital membranous cataracts inherited by an autosomal dominant (AD) pattern. Nystagmus and amblyopia were observed in all patients of this family, and exotropia and long axial length were observed in most patients. A/B ultrasound scan and ultrasound biomicroscopy revealed obvious thin crystalline lenses from 1.7 to 2.7 mm in central thickness in all cataract eyes. The bioinformatic analysis showed that the mutation was deleterious to the physiological function of LIM2-encoded MP20. Furthermore, by SEM, ultrastructure of the cataract nucleus showed that lens fiber cells (LFCs) remained morphologic characteristics of immature fiber cells, including flap cell surface with straight edges and lacking normal ball-and-socket joint boundaries, which implied that the differentiation of LFCs might be inhibited. Accumulation of MP20 and Cx46 in the cytoplasm was observed in the cytoplasm of the LFCs in human cataract lens. CONCLUSION: We identify a novel heterozygous LIM2 (c.388C>T, p.R130C) mutation inherited by an AD pattern. This LIM2 mutation causes the abnormal sub-localization of MP20 and Cx46 in LFCs resulting in membranous cataracts.

Biosafety of a 3D-printed intraocular lens made of a poly(acrylamide-co-sodium acrylate) hydrogel in vitro and in vivo

2020/8/25 0:00:00
AIM: To assess the biosafety of a poly(acrylamide-co-sodium acrylate) hydrogel (PAH) as a 3D-printed intraocular lens (IOL) material. METHODS: The biosafety of PAH was first evaluated in vitro using human lens epithelial cells (LECs) and the ARPE19 cell line, and a cell counting kit-8 (CCK-8) assay was performed to investigate alterations in cell proliferation. A thin film of PAH and a conventional IOL were intraocularly implanted into the eyes of New Zealand white rabbits respectively, and a sham surgery served as control group. The anterior segment photographs, intraocular pressure (IOP), blood parameters and electroretinograms (ERG) were recorded. Inflammatory cytokines in the aqueous humor, such as TNFα and IL-8, were examined by ELISA. Cell apoptosis of the retina was investigated by TUNEL assay, and macroPAHge activation was detected by immunostaining. RESULTS: PAH did not slow cell proliferation when cocultured with human LECs or ARPE19 cells. The implantation of a thin film of a 3D-printed IOL composed of PAH did not affect the IOP, blood parameters, ERG or optical structure in any of the three experimental groups (n=3 for each). Both TNFα and IL-8 in the aqueous humor of PAH group were transiently elevated 1wk post-operation and recovered to normal levels at 1 and 3mo post-operation. Iba1+ macroPAHges in the anterior chamber angle in PAH group were increased markedly compared to those of the control group; however, there was no significant difference compared to those in the IOL group. CONCLUSION: PAH is a safe material for 3D printing of personal IOLs that hold great potential for future clinical applications.

Effect on rabbits’ intraocular structure by cross-linked hyaluronic formations as vitreous substitute

Yan Gong, Kan Chen, Yue Wu, Xiao-Hong Guo and Tao Zhang — 2020/8/25 0:00:00
AIM: To develop a new material for retina filling and to investigate its effect on intraocular structure and histocompatibility in rabbit eyes. METHODS: The polymer-derived hyaluronic acid (HA) was formed by UV light cross-linked with N-vinyl-pyrrolidone. Vitrectomy was performed in the rabbits, and then cross-linked HA hydrogels at different concentrations were injected. Intraocular pressure measurements, cornea check-up, and B-ultrasound examination were performed during the follow-up period. After six weeks’ follow-up, the rabbits were sacrificed, and both eyes were removed for hematoxylin-eosin (HE) staining, and the polymer materials were observed under electron microscopy. RESULTS: The particle size of the cross-linked HA hydrogels was mainly around at 100 nm. After vitrectomy and injection into vitreous cavity optical coherence tomography showed that the polymeric material HA had no significant effect on the overall thickness of the retina. The intraocular pressure returned to the normal level gradually at week 4. B-ultrasound results revealed that there is no significant change in the eye tissue given to HA material. The pathological and transmission electron microscopy results showed no obvious pathological change in the primary cells and rod cells under the retina tissue. CONCLUSION: HA-based cross-linked biopolymers has good biocompatibility in rabbit eyes, showing a promising potential as vitreous substitutes.

Scutellarein alleviates the dysfunction of inner blood-retinal-barrier initiated by hyperglycemia-stimulated microglia cells

2020/8/25 0:00:00
AIM: To investigate the alleviation of scutellarein (SN) against inner blood-retinal-barrier (iBRB) dysfunction in microglia cells stimulated by hyperglycemia and to elucidate the engaged mechanism. METHODS: Microglia BV2 cells were stimulated by using 25 mmol/L D-glucose. The same concentration of mannitol (25 mmol/L) was applied as an isotonic contrast. Real-time PCR, Western-blot assay and immunofluorescence staining assay was performed. The dysfunction of iBRB in vitro was detected by using transendothelial electrical resistance (TEER) assay. Additionally, the leakage of fluorescein isothiocyanate (FITC)-conjugated dextran (70 kDa) was detected. RESULTS: SN abrogated microglia BV2 cells activation and reduced the phosphorylated activation of extracellular signal-regulated protein kinase (ERK)1/2. SN also decreased the transcriptional activation of nuclear factor κB (NFκB) and the elevated expression of tumor necrosis factor α (TNFα), interleukin (IL)-6 and IL-1β in BV2 cells treated with D-glucose (25 mmol/L). SN attenuated iBRB dysfunction in human retinal endothelial cells (HRECs) or choroid-retinal endothelial RF/6A cells when those cells were treated with TNFα, IL-1β or IL-6, or co-cultured with microglia cells stimulated by D-glucose. Moreover, SN restored the decreased protein expression of tight junctions (TJs) in TNFα-treated HRECs and RF/6A cells. CONCLUSION: SN not only alleviate iBRB dysfunction via directly inhibiting retinal endothelial injury caused by TNFα, IL-1β or IL-6, but also reduce the release of TNFα, IL-1β and IL-6 from microglia cells by abrogating hyperglycemia-mediated the activation of microglia cells.

Anti-proliferation and apoptosis-inducing effects of sodium aescinate on retinoblastoma Y79 cells

2020/8/25 0:00:00
AIM: To investigate the anti-proliferation and apoptosis-inducing effects of sodium aescinate (SA) on retinoblastoma Y79 cells and its mechanism. METHODS: Y79 cells were cultured at different drug concentrations for different periods of time (24, 48, and 72h). The inhibitory effect of SA on proliferation of Y79 cells was detected by the cell counting kit-8 (CCK-8) assay, and the morphology of Y79 cells in each group was observed under an inverted microscope. An IC50 of 48h was selected for subsequent experiments. After pretreatment with SA for 24 and 48h, cellular DNA distribution and apoptosis were detected by flow cytometry. Real-time qunatitative polymerase chain reaction (RT-qPCR) and Western blot were used to assess changes in related genes (CDK1, CyclinB1, Bax, Bcl-2, caspase-9, caspase-8, and caspase-3). RESULTS: SA inhibited proliferation and induced apoptosis of Y79 cells in a time-dependent and concentration-dependent manner. Following its intervention in the cell cycle pathway, SA can inhibit the expression of CDK1 and CyclinB1 at the mRNA and protein levels, and block cells in the G2/M phase. In caspase-related apoptotic pathways, up-regulation of Bax and down-regulation of Bcl-2 caused caspase-9 to self-cleave and further activate caspase-3. What’s more, the caspase-8-mediated extrinsic apoptosis pathway was activated, and the activated caspase-8 was released into the cytoplasm to activate caspase-3, which as a member of the downstream apoptotic effect group, initiates a caspase-cascade reaction that induces cell apoptosis. CONCLUSION: SA inhibits the proliferation of Y79 cells by arresting the cell cycle at the G2/M phase, and induces apoptosis via the caspase-related apoptosis pathway, indicating that SA may have promising potential as a chemotherapeutic drug.

Deletion of prominin-1 in mice results in disrupted photoreceptor outer segment protein homeostasis

2021/8/23 0:00:00
AIM: To illustrate the underlying mechanism how prominin-1 (also known as Prom1) mutation contribute to progressive photoreceptor degeneration. METHODS: A CRISPR-mediated Prom1 knockout (Prom1-KO) mice model in the C57BL/6 was generated and the photoreceptor degeneration phenotypes by means of structural and functional tests were demonstrated. Immunohistochemistry and immunoblot analysis were performed to reveal the localization and quantity of related outer segment (OS) proteins. RESULTS: The Prom1-KO mice developed the photoreceptor degeneration phenotype including the decreased outer nuclear layer (ONL) thickness and compromised electroretinogram amplitude. Immunohistochemistry analysis revealed impaired trafficking of photoreceptor OS proteins. Immunoblot data demonstrated decreased photoreceptor OS proteins. CONCLUSION: Prom1 deprivation causes progressive photoreceptor degeneration. Prom1 is essential for maintaining normal trafficking and normal quantity of photoreceptor OS proteins. The new light is shed on the pathogenic mechanism underlying photoreceptor degeneration caused by Prom1 mutation.

Latanoprost eye drops induce conjunctival lymphatic vessel development

Kai Ma, Qing-Song Li, Cheng-Juan Yin and Zhen-Yong Zhang — 2021/8/23 0:00:00
AIM: To investigate the effect of latanoprost eye drops on the conjunctival lymphatics. METHODS: Twenty-four healthy New Zealand White rabbits weighing 1.5 to 2.0 kg were randomly divided into three groups: latanoprost group (n=8) administered with latanoprost eye drops once a day for 2mo, carteolol group (n=8) administered with carteolol eye drops once a day for 2mo, and control group (n=8) without any treatment. The conjunctival tissues in the three groups were extracted to investigate the expression levels of 5’-nucleotidase (5’-Nase) by Western blot, reverse transcription-polymerase chain reaction (RT-PCR), and immunofluorescence staining, respectively. RESULTS: The protein expression level of 5’-Nase was significantly higher in latanoprost group than carteolol group (F=231.175, P<0.001) and control group (P<0.001), while there was no significant difference between the carteolol group and the control group (P>0.05). The mRNA expression level of 5’-Nase in the latanoprost group was also significantly higher than carteolol group (F=71.169 P<0.005) and control group (P<0.005). The conjunctival lymphatics were positive immunofluorescence stained with the 5’-Nase antibodies in the latanoprost group and not stained in the control group. CONCLUSION: Latanoprost eye drops can induce conjunctival lymphangiogenesis which may be concerned in clinical implications.

miRNA-26b suppresses the TGF-β2-induced progression of HLE-B3 cells via the PI3K/Akt pathway

En Shi, Xiang-Nan Ye and Liu-Yi Xie — 2021/8/23 0:00:00
AIM: To study the effect of miR-26b on lens epithelial cells induced by transforming growth factor beta (TGF-β) 2 and the underlying signaling pathways. METHODS: Human lens epithelial cell line B-3 (HLE-B3) was incubated with TGF-β2 (5 ng/mL) and then transfected with miR-26b mimics. The expression of miR-26b was determined using quantitative reverse transcriptase polymerase chain reaction (qRT-PCR), while 5’-bromodeoxyuridine (BrdU) and wound-healing assays were used to measure the growth and migration of HLE-B3 cells, respectively. The expression of epithelial-mesenchymal transition (EMT) markers and the activity of the phosphatidylinositol 3-kinase (PI3K)/Akt pathway were measured by Western blotting assay and immunofluorescence staining. Electron microscopy was also used to observe cellular morphology. RESULTS: The expression levels of miR-26b were significantly reduced in human posterior capsular opacification-attached lens tissue and TGF-β2-stimulated HLE-B3 cells. In the presence of TGF-β2, the growth, migration, and EMT of HLE-B3 cells were distinctly enhanced; these effects were attenuated by the administration of miR-26b mimics. Furthermore, the overexpression of miR-26b significantly reduced upregulation of the PI3K/Akt pathway when stimulated by TGF-β2 in HLE-B3 cells. Moreover, the addition of an activator (740 Y-P) led to the upregulation of the PI3K/Akt pathway and abolished the protective effect of miR-26b on the HLE-B3 cells that was mediated by TGF-β2. CONCLUSION: The miR-26b suppresses TGF-β2-induced growth, migration, and EMT in HLE-B3 cells by regulating the PI3K/Akt signaling pathway.

Development-related mitochondrial properties of retinal pigment epithelium cells derived from hEROs

Hao-Jue Xu, Qi-You Li, Ting Zou and Zheng-Qin Yin — 2021/6/28 0:00:00
AIM: To explore the temporal mitochondrial characteristics of retinal pigment epithelium (RPE) cells obtained from human embryonic stem cells (hESC)-derived retinal organoids (hEROs-RPE), to verify the optimal period for using hEROs-RPE as donor cells from the aspect of mitochondria and to optimize RPE cell-based therapeutic strategies for age-related macular degeneration (AMD). METHODS: RPE cells were obtained from hEROs and from spontaneous differentiation (SD-RPE). The mitochondrial characteristics were analyzed every 20d from day 60 to 160. Mitochondrial quantity was measured by MitoTracker Green staining. Transmission electron microscopy (TEM) was adopted to assess the morphological features of the mitochondria, including their distribution, length, and cristae. Mitochondrial membrane potentials (MMPs) were determined by JC-1 staining and evaluated by flow cytometry, reactive oxygen species (ROS) levels were evaluated by flow cytometry, and adenosine triphosphate (ATP) levels were measured by a luminometer. Differences between two groups were analyzed by the independent-samples t-test, and comparisons among multiple groups were made using one-way ANOVA or Kruskal-Wallis H test when equal variance was not assumed. RESULTS: hEROs-RPE and SD-RPE cells from day 60 to 160 were successfully differentiated from hESCs and expressed RPE markers (Pax6, MITF, Bestrophin-1, RPE65, Cralbp). RPE features, including a cobblestone-like morphology with tight junctions (ZO-1), pigments and microvilli, were also observed in both hEROs-RPE and SD-RPE cells. The mitochondrial quantities of hEROs-RPE and SD-RPE cells both peaked at day 80. However, the cristae of hEROs-RPE mitochondria were less mature and abundant than those of SD-RPE mitochondria at day 80, with hEROs-RPE mitochondria becoming mature at day 100. Both hEROs-RPE and SD-RPE cells showed low ROS levels from day 100 to 140 and maintained a normal MMP during this period. However, hEROs-RPE mitochondria maintained a longer time to produce high levels of ATP (from day 120 to 140) than SD-RPE cells (only day 120). CONCLUSION: hEROs-RPE mitochondria develop more slowly and maintain a longer time to supply high-level energy than SD-RPE mitochondria. From the mitochondrial perspective, hEROs-RPE cells from day 100 to 140 are an optimal cell source for treating AMD.

Identification and validation of tumor microenvironment-related lncRNA prognostic signature for uveal melanoma

Chen-Lu Liao, Nan Hu, Xing-Yu Sun, Qi Zhou, Min Tian, Yang Cao and Hong-Bin Lyu — 2021/6/28 0:00:00
AIM: To investigate the role of tumor microenvironment (TME)-related long non-coding RNA (lncRNA) in uveal melanoma (UM), probable prognostic signature and potential small molecule drugs using bioinformatics analysis. METHODS: UM expression profile data were downloaded from the Cancer Genome Atlas (TCGA) and bioinformatics methods were used to find prognostic lncRNAs related to UM immune cell infiltration. The gene expression profile data of 80 TCGA specimens were analyzed using the single sample Gene Set Enrichment Analysis (ssGSEA) method, and the immune cell infiltration of a single specimen was evaluated. Finally, the specimens were divided into high and low infiltration groups. The differential expression between the two groups was analyzed using the R package ‘edgeR’. Univariate, multivariate and Least Absolute Shrinkage and Selection Operator (LASSO) Cox regression analyses were performed to explore the prognostic value of TME-related lncRNAs. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes (KEGG) functional analyses were also performed. The Connectivity Map (CMap) data set was used to screen molecular drugs that may treat UM. RESULTS: A total of 2393 differentially expressed genes were identified and met the criteria for the low and high immune cell infiltration groups. Univariate Cox analysis of lncRNA genes with differential expression identified 186 genes associated with prognosis. Eight prognostic markers of TME-included lncRNA genes were established as potentially independent prognostic elements. Among 269 differentially expressed lncRNAs, 69 were up-regulated and 200 were down-regulated. Univariate Cox regression analysis of the risk indicators and clinical characteristics of the 8 lncRNA gene constructs showed that age, TNM stage, tumor base diameter, and low and high risk indices had significant prognostic value. We screened the potential small-molecule drugs for UM, including W-13, AH-6809 and Imatinib. CONCLUSION: The prognostic markers identified in this study are reliable biomarkers of UM. This study expands our current understanding of the role of TME-related lncRNAs in UM genesis, which may lay the foundations for future treatment of this disease.

Improvement of human embryonic stem cell-derived retinal pigment epithelium cell adhesion, maturation, and function through coating with truncated recombinant human vitronectin

2021/6/28 0:00:00
AIM: To explore an xeno-free and defined coating substrate suitable for the culture of H9 human embryonic stem cell-derived retinal pigment epithelial (hES-RPE) cells in vitro, and compare the behaviors and functions of hES-RPE cells on two culture substrates, laminin521 (LN-521) and truncated recombinant human vitronectin (VTN-N). METHODS: hES-RPE cells were used in the experiment. The abilities of LN-521 and VTN-N at different concentrations to adhere to hES-RPE cells were compared with a high-content imaging system. Quantitative real-time polymerase chain reaction was used to evaluate RPE-specific gene expression levels midway (day 10) and at the end (day 20) of the time course. Cell polarity was observed by immunofluorescent staining for apical and basal markers of the RPE. The phagocytic ability of hES-RPE cells was identified by flow cytometry and immunofluorescence. RESULTS: The cell adhesion assay showed that the ability of LN-521 to adhere to hES-RPE cells was dose-dependent. With increasing coating concentration, an increasing number of cells attached to the surface of LN-521-coated wells. In contrast, VTN-N presented a strong adhesive ability even at a low concentration. The optimal concentration of LN-521 and VTN-N required to coat and adhesion to hES-RPE cells were 2 and 0.25 μg/cm2, respectively. Furthermore, both LN-521 and VTN-N could facilitate adoption of the desired cobblestone cellular morphology with tight junction and showed polarity by the hES-RPE cells. However, hES-RPE cells cultivated in VTN-N had a greater phagocytic ability, and it took less time for these hES-RPE cells to mature. CONCLUSION: VTN-N is a more suitable coating substrate for cultivating hES-RPE cells.

Ragweed pollen induces allergic conjunctivitis immune tolerance in mice via regulation of the NF-κB signal pathway

Meng-Tian Bai, Yun Li and Zhu-Lin Hu — 2021/5/25 0:00:00
AIM: To investigate the feasibility and mechanism of immune tolerance in allergic conjunctivitis. METHODS: The allergic conjunctivitis immune tolerance mice model was established by ragweed pollen (RW) and the related cytokines were detected. The mice were divided into 9 groups and the maslinic acid (MA) or PBS were given for different group after modeling. The expression levels of chemokine ligand 5 (CCL5) and P-65 in the conjunctival tissue were analyzed by immunohistochemistry, quantitative reverse transcription polymerase chain reaction (qRT-PCR) and Western blot. The percentage of interleukin-17 (IL-17) and CD4+CD25+ in the splenocyte supernatant was analyzed by flow cytometry. Furthermore, the serum and splenocyte supernatant concentration of total-IgE, interleukin-10 (IL-10), and IL-17 was analyzed by enzyme linked immune response (ELISA). RESULTS: After the model was established, symptoms of conjunctivitis were alleviated, the level of P-65, CCL5, IL-17, and total-IgE was raised, while the expression of IL-10, CD4+CD25+ was decreased. This result fully demonstrated that a typical IL-17/regulatory-T-cells (Treg cells) imbalance and NF-κB activation. When the NF-κB signal pathway was suppressed, it showed that there was a further relief of conjunctivitis in mice. At the same time, the expression of total-IgE, IL-17, and CCL5 was decreased and the expression of anti-inflammatory factor (IL-10, CD4+CD25+) was increased. CONCLUSION: In the state of immune tolerance, symptoms of conjunctivitis in mice are alleviated, the Th-17 cells of allergic conjunctivitis mice are inhibited, and Treg cells activity is enhanced.

Effect of thioltransferase on oxidative stress induced by high glucose and advanced glycation end products in human lens epithelial cells

Qing Liu, Xu Wang and Hong Yan — 2021/5/25 0:00:00
AIM: To study the effect of thioltransferase (TTase) on oxidative stress in human lens epithelial cells (HLECs) induced by high glucose and advanced glycation end products (AGEs). METHODS: HLECs were treated with 35.5 mmol/L glucose or 1.5 mg/mL AGEs modified bovine serum albumin (AGEs-BSA) as the experimental groups, respectively. Cells were collected at the time point of 1, 2, 3, and 4d. The TTase activity were measured accordingly. TTase mRNA levels were detected by quantitative reverse transcription polymerase chain response (qRT-RCR) and its protein level was detected by Western blot. The siRNA was used to knock down the expression of TTase. The activity of catalase (CAT) and superoxide dismutase (SOD), the content of reactive oxygen species (ROS) and the ratio of oxidized glutathione/total glutathione (GSSG/T-GSH) were assessed in different groups, respectively. RESULTS: The level of TTase mRNA gradually increased and reached the top at 2d, then it decreased to the normal level at 4d, and the TTase activity increased from 2 to 3d in both high glucose and AGEs-BSA groups. The TTase expression elevated from 2d in high glucose group, and it began to rise from 3d in AGEs-BSA group. The activity of CAT and SOD showed a decrease and the content of ROS and the ratio of GSSG/T-GSH showed an increase in high glucose and AGEs-BSA group. These biochemical alterations were more prominent in the groups with TTase siRNA. CONCLUSION: High glucose and AGEs can increase ROS content in HLECs; therefore, it induces oxidative stress. This may result in the decreased GSH and increased GSSG content, impaired activity of SOD and CAT. The up-regulated TTase likely provides oxidation damage repair induced by high glucose and AGEs in the early stage.

Inhibition of TGF-β2-induced migration and epithelial-mesenchymal transition in ARPE-19 by sulforaphane

2021/5/25 0:00:00
AIM: To investigate the effects of sulforaphane (SFN) on transforming growth factor (TGF)-β2 stimulated migration and epithelial-mesenchymal transition (EMT) in ARPE-19 cells. METHODS: ARPE-19 cells were cultured in the presence or absence of SFN or TGF-β2. SFN toxicity was assessed by performing a lactate dehydrogenase assay (LDH) and 3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium (MTS) assays, and cell migration was evaluated by Transwell migration assay. Actin stress fiber formation in ARPE-19 cells was determined using immunofluorescence analysis. Immunoblotting analysis was used to determine fibronectin and α-smooth muscle actin expressions along with the degree of Smad and Akt phosphorylation. RESULTS: SFN inhibited ARPE-19 migration. Additionally, SFN attenuated TGF-β2-induced appearance of actin stress fibers as well as fibronectin and α-smooth muscle actin expressions in these cells. SFN also hindered the TGF-β2-stimulated phosphorylation of Smad2, Smad3, and Akt. SFN showed no cytotoxicity towards ARPE-19 cells. CONCLUSION: SFN inhibits TGF-β2-stimulated migration and EMT in ARPE-19 cells, probably by preventing the establishment of actin stress fibers and Akt and Smad2/3 signaling.

Inhibitory effects of safranal on laser-induced choroidal neovascularization and human choroidal microvascular endothelial cells and related pathways analyzed with transcriptome sequencing

2021/5/25 0:00:00
AIM: To determine the effects of safranal on choroidal neovascularization (CNV) and oxidative stress damage of human choroidal microvascular endothelial cells (HCVECs) and its possible mechanisms. METHODS: Forty-five rats were used as a laser-induced CNV model for testing the efficacy and safety of safranal (0.5 mg/kg·d, intraperitoneally) on CNV. CNV leakage on fluorescein angiography (FA) and CNV thickness on histology was compared. HCVECs were used for a H2O2-induced oxidative stress model to test the effect of safranal in vitro. MTT essay was carried to test the inhibition rate of safranal on cell viability at different concentrations. Tube formation was used to test protective effect of safranal on angiogenesis at different concentrations. mRNA transcriptome sequencing was performed to find the possible signal pathway. The expressions of different molecules and their phosphorylation level were validated by Western blotting. RESULTS: On FA, the average CNV leakage area was 0.73±0.49 and 0.31±0.11 mm2 (P?=?0.012) in the control and safranal-treated group respectively. The average CNV thickness was 127.4±18.75 and 100.6±17.34 μm (P=0.001) in control and safranal-treated group. Under the condition of oxidative stress, cell proliferation was inhibited by safranal and inhibition rates were 7.4%-35.4% at the different concentrations. For tube formation study, the number of new branches was 364 in control group and 35, 42, and 17 in 20, 40, and 80 μg/mL safranal groups respectively (P<0.01). From the KEGG pathway bubble graph, the PI3K-AKT signaling pathway showed a high gene ratio. The protein expression was elevated of insulin receptor substrate (IRS) and the phosphorylation level of PI3K, phosphoinositide-dependent protein kinase 1/2 (PDK1/2), AKT and Bcl-2 associated death promoter (BAD) was also elevated under oxidative stress condition but inhibited by safranal. CONCLUSION: Safranal can inhibit CNV both in vivo and in vitro, and the IRS-PI3K-PDK1/2-AKT-BAD signaling pathway is involved in the pathogenesis of CNV.

Retinal neovascularization induced by mutant Vldlr gene inhibited in an inherited retinitis pigmentosa mouse model: an in-vivo study

2021/5/25 0:00:00
AIM: To explore whether the retinal neovascularization (NV) in a genetic mutant mice model could be ameliorated in an inherited retinitis pigmentosa (RP) mouse, which would help to elucidate the possible mechanism and prevention of retinal NV diseases in clinic. METHODS: The Vldlr-/- mice, the genetic mutant mouse model of retinal NV caused by the homozygous mutation of Vldlr gene, with the rd1 mice, the inherited RP mouse caused by homozygous mutation of Pde6b gene were bred. Intercrossing of the above two mice led to the birth of the F1 hybrids, further inbreeding of which gave birth to the F2 offspring. The ocular genotypes and phenotypes of the mice from all generations were examined, with the F2 offspring grouped according to the genotypes. RESULTS: The rd1 mice exhibited the RP phenotype of outer retinal degeneration and loss of retinal function. The Vldlr-/- mice exhibited the phenotype of retinal NV obviously shown by the fundus fluorescein angiography. The F1 hydrides, with the heterozygote genotype, exhibited no phenotypes of RP or retinal NV. The F2 offspring with homozygous genotypes were grouped into four subgroups. They were the F2-I mice with the wild-type Pde6b and Vldlr genes (Pde6b+/+-Vldlr+/+), which had normal ocular phenotypes; the F2-II mice with homozygous mutant Vldlr gene (Pde6b+/+-Vldlr-/-), which exhibited the retinal NV phenotype; the F2-III mice with homozygous mutant Pde6b gene (Pde6b-/--Vldlr+/+), which exhibited the RP phenotype. Specifically, the F2-IV mice with homozygous mutant Vldlr and Pde6b gene (Pde6b-/--Vldlr-/-) showed only the RP phenotype, without the signs of retinal NV. CONCLUSION: The retinal NV can be inhibited by the RP phenotype, which implies the role of a hyperoxic state in treating retinal NV diseases.

Deterioration of Avellino corneal dystrophy in a Chinese family after LASIK

Xue Jiang and Hong Zhang — 2021/4/23 0:00:00
AIM: To reveal the importance of TGFBI gene screening for candidates with a family history of corneal disease or granular opacities in corneal stroma before refractive surgery. METHODS: A 37-year-old male (proband) underwent bilateral laser-assisted in situ keratomileusis (LASIK) in 2002, with right vision decreased significantly in 2006. The proband and other 32 members of the family underwent a detailed ophthalmic examination, including vision acuity, intraocular pressure, slit-lamp photograph, fundus examination, optical coherence tomography (OCT) of cornea, and in vivo confocal microscope (IVCM) and peripheral blood was used for genomic DNA extraction. Seventeen TGFBI gene exons were analyzed via polymerase chain reaction amplification and direct sequencing. RESULTS: Slit-lamp, IVCM, and OCT images showed that a large amount of dense and confluent granular opaque were seen at the interfaces of the flap and remnant stromal bed in right and light degree in left eye. Sanger sequencing showed that there was a 371G>A mutation (CGC>CAC) in exon 4, which indicated that he harbored a heterozygote R124H mutation, identifying the diagnosis of Avellino corneal dystrophy (ACD). Among the other 32 family members, 6 of them harbored the identical mutation to that in the proband. CONCLUSION: ACD will worsen and recur after LASIK. Preoperative gene-screening for TGFBI mutations is important in diagnosing ACD.

A mutated CRYGD associated with congenital coralliform cataracts in two Chinese pedigrees

2021/4/23 0:00:00
AIM: To investigate the causal gene mutation and clinical characteristics for two Chinese families with autosomal dominant congenital coralliform cataract. METHODS: Two Chinese pedigrees with congenital cataract were investigated. Routine ophthalmic examinations were performed on all patients and non-affected family members. Peripheral blood samples were collected, and the genomic DNAs were extracted. The coding regions of proband’s DNAs were analyzed with cataract gene panel. The identified mutation was amplified by polymerase chain reaction, and automated sequencing was performed in other members of two families to verify whether the mutated gene was co-segregated with the disease. RESULTS: Congenital coralliform cataract was inherited in an autosomal dominant mode in both pedigrees. For each family, more than half of the family members were affected. All patients presented with severe visual impairment after birth as a result of bilateral symmetric coralliform lens opacification. An exact the same defect in the same gene, a heterozygous mutation of c.70C>A (p. P24T) in exon 2 of γD-crystallin gene, was detected in both probands from each family. Sanger sequencing analysis demonstrated that the mutated CRYGD was co-segregated in these two families. CONCLUSION: A c.70C>A (p. P24T) variant in CRYGD gene was reconfirmed to be the causal gene in two Chinese pedigrees. It is known that mutated CRYGD caused most of the congenital coralliform cataracts, suggesting that the CRYGD gene is associated with coralliform congenital cataract.

Autophagy dysregulation mediates the damage of high glucose to retinal pigment epithelium cells

Qian Zhang, Hong-Song Li, Rong Li, Jun-Hui Du and Cong Jiao — 2021/4/23 0:00:00
AIM: To observe the role and mechanism of autophagy in retinal pigment epithelial cell (RPE) damaged by high glucose, so as to offer a new idea for the treatment of diabetic retinopathy (DR). METHODS: ARPE-19, a human RPE cell line cultured in vitro was divided into the normal control (NC), autophagy inhibitor 3-methyladenine (3-MA), high-glucose (HG), and HG+3-MA groups. Cell viability was detected by CCK-8 assay and the apoptosis rate was measured by flow cytometry. The protein expressions of apoptosis markers, including Bax, Bcl-2, and Caspase-3, as well as autophagy marker including microtubule-related protein 1 light chain 3 (LC3), p62, and mechanistic target of rapamycin (mTOR) were detected by Western blotting. Autophagic flux was detected by transfection with Ad-mCherry-GFP-LC3B. RESULTS: Under high glucose conditions, the viability of ARPE-19 was decreased, and the apoptosis rate increased, the protein expressions of Bax, Caspase-3, and LC3-II/LC3-I were all increased and the expressions of Bcl-2, p62 and p-mTOR decreased, and autophagic flux was increased compared with that of the controls. Treatment with 3-MA reversed all these changes caused by high glucose. CONCLUSION: The current study demonstrates the mechanisms of cell damage of ARPE-19 through high glucose/mTOR/autophagy/apoptosis pathway, and new strategies for DR may be developed based on autophagy regulation to manage cell death of RPE cells.

Association of eleven single nucleotide polymorphisms with refractive disorders from Eskisehir, Turkey

2021/4/23 0:00:00
AIM: To investigate relationship between refractive errors and eleven single nucleotide polymorphisms (SNPs) in HGF, GC, MFN1, GNB4, and VDR genes in Turkish population. METHODS: A group of 212 participants with myopia (n=91), hyperopia (n=45), and emmetropia (n=76) were investigated in this study. SNPs in HGF, GC, MFN1, GNB4 and VDR genes were studied by SnapShot technique. RESULTS: The patients in this study consists of 47 female/44 male (age: 23.47±4.30) patients with myopia, 20 female/25 male (age: 31.20±8.02) with hyperopia and 33 female/43 male (age: 25.22±6.60) with emmetropia. The genotype distribution of the rs7618348 polymorphism, which was the only statistically significant one between myopia and emmetropia group. The genotype distribution of the rs3819545, rs3735520, rs7041, and rs2239182 polymorphisms, which were statistically significant between hyperopia and emmetropia groups. CONCLUSION: The importance of genetic predisposition to refractive errors with respect to etiology of the disease is revealed. It is known that polymorphism studies may differ because of genetic diversity among populations so larger cohort studies are required in different populations to enlighten the etiology of the refractive errors.

Role of microRNA-25 in high glucose cultured Müller glia

Yu Liu, Han Shen, Song-Tao Yuan and Qing-Huai Liu — 2021/3/29 0:00:00
AIM: To investigate the role of microRNA-25 (miR-25) in proliferation and apoptosis of retinal Müller glia (MG) under high glucose condition. METHODS: The purity of the cultured cells was verified by immunocytochemistry and flow cytometry using antibodies that specifically recognized MG. The expression level of miR-25 under normal and high glucose conditions were validated by quantitative reverse transcription polymerase chain reaction (RT-qPCR). miR-25 mimics and negative control were transfected into MG and multiple functional experiments including cell counting kit-8 assay, EDU assay, and flow cytometry were conducted to explore the effects of miR-25 on the proliferation and apoptosis of high glucose cultured MG (HGMG). RESULTS: Immunocytochemistry and flow cytometry confirmed the high purity of primary cultured MG. RT-PCR results showed that the expression level of miR-25 was significantly repressed in HGMG, while over-expression of miR-25 by miR-25 mimic markedly inhibited the high glucose induced cell apoptosis and promoted the proliferation of MG. CONCLUSION: The expression level of miR-25 is significantly downregulated in HGMG and its overexpression could attenuate the high glucose damages on MG by promoting proliferation and reducing apoptosis.

Protective effects of upregulated HO-1 gene against the apoptosis of human retinal pigment epithelial cells in vitro

2021/3/29 0:00:00
AIM: To investigate the protective effect of heme oxygenase-1 (HO-1) against H2O2-induced apoptosis in human ARPE-19 cells. METHODS: The lentiviral vector expressing HO-1 was prepared and transfected into apoptotic ARPE-19 cells induced by H2O2. Functional experiments including cell counting kit-8 (CCK-8) assay, flow cytometry (FCM) and mitochondrial membrane potential assay were conducted. RESULTS: The ultrastructure of ARPE-19 cells was observed using transmission electron microscope (TEM). It was found that exogenous HO-1 significantly ameliorated H2O2-induced loss of cell viability, apoptosis and intracellular levels of reactive oxygen species (ROS) in ARPE-19 cells. The overexpression of HO-1 facilitated the transfer of nuclear factor erythroid-2-related factor 2 (Nrf2) from cytoplasm to nucleus, which in turn upregualted expressions HO-1 and B-cell lymphoma-2 (Bcl-2). Furthermore, HO-1 upregulation further inhibited H2O2-induced release of cysteinyl aspartate specific proteinase-3 (caspase-3). CONCLUSION: Exogenous HO-1 protect ARPE-19 cells against H2O2-induced oxidative stress by regulating the expressions of Nrf2, HO-1, Bcl-2, and caspase-3.

Protective effects of piperine on the retina of mice with streptozotocin-induced diabetes by suppressing HIF-1/VEGFA pathway and promoting PEDF expression

Pu Zhang, Yan-Dan Zhou, Yao Tan and Ling Gao — 2021/3/29 0:00:00
AIM: To evaluate the protective mechanisms of piperine in the retina of mice with streptozotocin-induced diabetes. METHODS: In experiments in vitro, stimulation by chemical hypoxia was established in ARPE-19 cells. Then, the expression of hypoxia-inducible factor-1α (HIF-1α), vascular endothelial growth factor A (VEGFA), and pigment epithelium-derived factor (PEDF) was assessed at the mRNA and protein levels. In experiments in vivo, diabetes mellitus was established by intraperitoneally injecting 150 mg/kg streptozotocin once. After 3wk of the onset of diabetes, 15 mg/kg piperine was intraperitoneally injected once daily for 1 or 3wk. Then, the retinal morphology and mRNA and protein expression were assessed. RESULTS: In hypoxia, 1-100 μmol/L piperine significantly decreased the expression of VEGFA mRNA and increased the expression of PEDF mRNA without affecting HIF-1α mRNA. Meanwhile, 100 μmol/L piperine substantially decreased the protein level of VEGFA and increased the protein level of PEDF. The HIF-1α protein level was also hampered by piperine. In the diabetic retina of mice, the morphological damage was alleviated by piperine. Likewise, the retinal vascular leakage was substantially decreased by piperine. Further, the protein levels of HIF-1α and VEGFA were significantly reduced by piperine. Moreover, the level of the antiangiogenic factor of PEDF dramatically increased by piperine. CONCLUSION: Piperine may exert protective effects on the retina of mice with diabetes via regulating the pro-antiangiogenic homeostasis composed of HIF-1/VEGFA and PEDF.

Nicotinamide suppresses bevacizumab-induced epithelial-mesenchymal transition of ARPE-19 cells by attenuating oxidative stress

2021/2/25 0:00:00
AIM: To investigate the effects of nicotinamide (NAM) on bevacizumab (BEV)-induced epithelial-mesenchymal transition (EMT) of human retinal pigment epithelial cells (ARPE-19) and the underling mechanisms. METHODS: ARPE-19 cells were treated with BEV for 24, 48, and 72h, and the variation degrees of EMT-related markers (fibronectin, α-SMA, vimentin, and ZO-1) were assessed by Western blotting to select the optimal treatment time point which exhibited the most obvious changes of EMT-related markers for the subsequent experiments. Furthermore, NAM was added to the medium, the mRNA and protein levels of the EMT-related markers were then measured. The accumulation of reactive oxygen species (ROS) and H2O2 and the total antioxidant capacity (TAC) of the cells were also measured to evaluate the level of oxidative stress. RESULTS: After being treated with BEV for 72h, the protein expression levels of EMT-related markers in ARPE-19 cells showed significant changes. Meanwhile the levels of ROS and H2O2 were obviously increased, and the TAC of ARPE-19 cells was decreased. Totally 72h was chosen to be the optimal treatment time point in subsequent experiments. Furthermore, NAM inhibited BEV-induced EMT by downregulating fibronectin, α-SMA, and vimentin and upregulating ZO-1, decreased the accumulation of ROS and H2O2, and enhanced TAC in BEV-treated ARPE-19 cells. CONCLUSION: This study demonstrates that NAM suppressed BEV-induced EMT in ARPE-19 cells by attenuating oxidative stress. Hence, NAM may be a potential therapeutic agent for alleviating neovascular fibrosis of the ocular fundus after anti-vascular endothelial growth factor therapy.

YM155 inhibits retinal pigment epithelium cell survival through EGFR/MAPK signaling pathway

2021/2/25 0:00:00
AIM: To investigate YM155's effect on retinal pigment epithelium (RPE) cells' viability and the potential regulatory mechanisms. METHODS: Human immortalized RPE cell lines (ARPE-19 cell line) were processed with YM155 and epidermal growth factor (EGF). ARPE-19 cell viability was detected by methyl thiazolyl tetrazolium assay, and apoptosis was tested by flow cytometry assay. ARPE-19 cell proliferation was assessed with bromodeoxyuridine tagged incorporation assay, and migration ability was evaluated via a wound-healing assay. Epidermal growth factor receptor (EGFR)/MAPK pathway proteins were tested via immunoblotting. EGFR localization was examined by immunofluorescence assay. RESULTS: YM155 suppressed ARPE-19 cells' viability in a time and concentration-dependent manner. A high dose of YM155 caused a small amount of ARPE-19 cell death. YM155 significantly diminished the ARPE-19 cells' proliferative and migrative capacity. YM155 down-regulated total EGFR and phosphorylated external signal-regulated protein kinase (ERK), and it up-regulated the phosphorylation of P38MAPK and c-Jun N-terminal kinase (JNK). YM155 induced endocytosis of EGFR in ARPE-19 cell. YM155 also attenuated EGF-induced ARPE-19 cells' proliferative and migrative capacity. Moreover, YM155 significantly decreased the expression of phosphorylated EGFR and ERK after treated by EGF. CONCLUSION: YM155 inhibits RPE cell survival, the cell proliferative and migrative capacity, and it effectuates a small amount of cell death through the EGFR/MAPK signaling pathway. YM155 might, therefore, be an agent to prevent and treat abnormal RPE cell survival in proliferative vitreoretinopathy.

Effect of Andrographis paniculata polysaccharide on human retinoblastoma Y79 cell proliferation and apoptosis

2021/2/25 0:00:00
AIM: To explore the effect of the Andrographis paniculata (A. paniculata) polysaccharide on the proliferation and apoptosis of human retinoblastoma (RB) Y79 cells and its mechanism. METHODS: The refined A. paniculata polysaccharide was obtained using techniques such as water extraction, ethanol precipitation, and decompression concentration. The inhibition effect of the A. paniculata polysaccharide on the proliferation of Y79 cells was detected by cell proliferation assay. Flow cytometry was used for the detection of cell apoptosis rate and cycle change. Real-time qunatitative polymerase chain reaction (RT qPCR)and Western blotting were used to detect the expression of cell apoptosis signal pathway-related factors (caspase-3, caspase-8, and caspase-9) and cell cycle signal pathway-related factors (CDK1 and cyclinB1) at the transcriptional and translational levels. RESULTS: Infrared and ultraviolet spectrum scanning showed that the extracted drug was a polysaccharide with high purity. After being treated with different concentrations of A. paniculata polysaccharide for different periods of time, the Y79 cells showed different degrees of proliferation inhibition. Flow cytometric observations showed that the cell apoptosis rate and the proportion of cells blocked in the G2/M phase were significantly increased after A. paniculata polysaccharide treatment. Further analysis revealed that the mRNA and protein expression of caspase-3, caspase-8, and caspase-9 in the A. paniculata polysaccharide treatment groups increased significantly compared with that in the control groups, while the expression of CDK1 and cyclinB1 decreased significantly. CONCLUSION: The A. paniculata polysaccharide could inhibit the proliferation and induce apoptosis of Y79 cells. Its possible mechanism is via the upregulation of caspase-3, caspase-8, and caspase-9 expression in the cell apoptotic signaling pathway and the downregulation of CDK1 and cyclinB1 expression in the cell cycle signaling pathway.

Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome

Wei-Ning Rong, Mei-Jiao Ma, Wei Yang, Shi-Qin Yuan and Xun-Lun Sheng — 2021/2/25 0:00:00
AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

Protective effects of riboflavin-UVA-mediated posterior sclera collagen cross-linking in a guinea pig model of form-deprived myopia

Ding Han, Mei-Nan He, Ying Zhu, Yan Zhang and Rui-Hua Wei — 2021/2/24 0:00:00
AIM: To evaluate the effect of posterior sclera collagen cross-linking induced by riboflavin-ultraviolet A (UVA) on form-deprived myopia in guinea pigs. RESULTS: After 4wk, the interocular difference of refractive error were -0.11±0.67, -2.93±0.56, 1.10±0.58, and -1.63±0.41 D in the NOR, FDM, NOR+CL, and FDM+CL groups respectively. Mixed-effect linear model revealed significant effect of FDM (P<0.01) and CL (P<0.001). Also, after 4wk, the interocular difference of axial length were 0.01±0.04, 0.29±0.07, -0.13±0.06, and 0.11±0.05 mm in the NOR, FDM, NOR+CL, and FDM+CL group. Mixed-effect linear model revealed significant effect of FDM (P<0.001) and CL (P<0.01). As for corneal curvature, significant interocular difference have not found between any of the two groups. At the end of this experiment, the ultimate stress and elastic modulus were found significantly increased in both CL groups. But no difference was found in the groups without cross-linked. There was no abnormality observed in the retina and RPE cells of the treated eyes. CONCLUSION: The posterior sclera collagen cross-linking induced by riboflavin-UVA can slow down the progress of myopia and increase the sclera biomechanical strength in the guinea pig model of form-deprived myopia.

Effect of zymosan on the expression and function of the gap-junction protein connexin 43 in human corneal fibroblasts

2021/2/24 0:00:00
AIM: To study the effect of zymosan, a ligand found on the surface of fungi, on gap junctional intercellular communication (GJIC) in cultured human corneal fibroblasts (HCFs). METHODS: Zymosan was added to the medium of cultured HCFs with or without the administration of mitogen-activated protein kinase (MAPK) inhibitors or the inhibitor kappa B kinase 2 (IKK2) inhibitor IV. The protein and mRNA levels of connexin 43 (Cx43) in HCFs were measured by Western blot, immunofluorescence, and quantitative reverse transcription-polymerase chain reaction (qRT-PCR) analyses. The GJIC activity was tested using a dye-coupling assay. RESULTS: The reduction of Cx43 protein and mRNA levels as well as a significant decrease in GJIC activity were observed in cultured HCFs when zymosan was added into the culture medium. Compared with controls (no zymosan), the protein level of Cx43 was reduced by 45% and 54% in the presence of zymosan at 200 and 600 μg/mL, respectively (P<0.05); and it was reduced by 45%, 48%, and 75% in the presence of zymosan (600 μg/mL) for 24, 36, and 48h, respectively (P<0.05). The mRNA expression of Cx43 was reduced by 98% in the presence of zymosan (P<0.05). The effects of zymosan on Cx43 expression and GJIC activity were attenuated by the administration of PD98059 [an extracellular signal-regulated kinase (ERK) signaling inhibitor] (P<0.05), c-Jun NH2-terminal kinase (JNK) inhibitor II (P<0.05), and IKK2 inhibitor IV (P<0.05). CONCLUSION: Zymosan inhibits the activity of GJIC in cultured HCFs. This effect is likely regulated via the nuclear factor-κB (NF-κB), MAPK/ERK, and JNK signaling pathways. The inhibitory effects of zymosan on Cx43 expression and GJIC activity in HCFs may induce damage of corneal stroma during corneal fungal infection.

LRG1 promotes epithelial-mesenchymal transition of retinal pigment epithelium cells by activating NOX4

Li Zhou, De-Peng Shi, Wen-Juan Chu, Ling-Ling Yang and Hai-Feng Xu — 2021/2/24 0:00:00
AIM: To investigate the effect of leucine-rich-alpha-2-glycoprotein 1 (LRG1) on epithelial-mesenchymal transition (EMT) in retinal pigment epithelium (RPE) cells, and to explore the role of NADPH oxidase 4 (NOX4). METHODS: RPE cells (ARPE-19 cell line) were treated with transforming growth factor-β1 (TGF-β1) to induce EMT. Changes of the mRNA and protein expression levels of LRG1 were tested in the TGF-β1 treated cells. The recombinant human LRG1 protein (rLRG1) and siRNA of LRG1 were used to establish accumulation of exogenous LRG1 model and the down-regulation of LRG1 model in ARPE-19 cells respectively, and to detect EMT-related markers including fibronectin, α-smooth muscle actin (α-SMA) and zonula occludens-1 (ZO-1). The mRNA and protein expression level of NOX4 were measured according to the above treatments. VAS2870 was used as a NOX4 inhibitor in rLRG1-treated cells. EMT-related markers were detected to verify the effect of NOX4 in the process of EMT. RESULTS: TGF-β1 promoted the expression of LRG1 at both the mRNA and protein levels during the process of EMT which showed the up-regulation of fibronectin and α-SMA, as well as the down-regulation of ZO-1. Furthermore, the rLRG1 promoted EMT of ARPE-19 cells, which manifested high levels of fibronectin and α-SMA and low level of ZO-1, whereas knockdown of LRG1 prevented EMT by decreasing the expressions of fibronectin and α-SMA and increasing the expression of ZO-1 in ARPE-19 cells. Besides, the rLRG1 activated and LRG1 siRNA suppressed NOX4 expression. EMT was inhibited when VAS2870 was used in the rLRG1-treated cells. CONCLUSION: These results for the first time demonstrate that LRG1 promotes EMT of RPE cells by activating NOX4, which may provide a novel direction to explore the mechanisms of subretinal fibrosis.

Therapeutic effect of secretome from TNF-α stimulated mesenchymal stem cells in an experimental model of corneal limbal stem cell deficiency

2020/12/24 0:00:00
AIM: To explore the secretome efficacy in tumor necrosis factor (TNF)-α stimulated mouse mesenchymal stem cells (MSCs) in a murine model of corneal limbal alkali injury. METHODS: Corneal limbal stem cell deficiency (LSCD) was created in the eyes of male C57 mice. Concentrated conditioned medium from TNF-α stimulated MSCs (MSC-CMT) was applied topically for 4wk, with basal medium and conditioned medium from MSCs as controls. Corneal opacification, corneal inflammatory response, and corneal neovascularization (NV) were evaluated. Corneal epithelial cell apoptosis, corneal conjunctivation, and inflammatory cell infiltration were assessed with TUNEL staining, CK3 and Muc-5AC immunostaining, and CD11b immunofluorescence staining, respectively. The effect of TSG-6 was further evaluated by knockdown with short hairpin RNA (shRNA). RESULTS: Compared to the controls, topical administration of MSC-CMT significantly ameliorated the clinical symptoms of alkali-induced LSCD, with restrained corneal NV, reduced corneal epithelial cell apoptosis, and inhibition of corneal conjunctivation. In addition, MSC-CMT treatment significantly reduced CD11b+ inflammatory cell infiltration, and inhibited the expression of pro-inflammatory cytokines (IL-1β, TNF-α and IL-6). Furthermore, the promotion of corneal epithelial reconstruction by MSC-CMT was largely abolished by TSG-6 knockdown. CONCLUSION: Our study provides evidence that MSC-CMT enhances the alleviation of corneal alkali injuries, partially through TSG-6-mediated anti-inflammatory protective mechanisms. MSC-CMT may serve as a potential strategy for treating corneal disorders.

Effect of luteolin on apoptosis and vascular endothelial growth factor in human choroidal melanoma cells

Meng-Lin Shi, Yu-Fen Chen and Hong-Fei Liao — 2020/12/24 0:00:00
AIM: To investigate the effects of luteolin on apoptosis, the cell cycle, and the expression and secretion of vascular endothelial growth factor (VEGF) in human choroidal melanoma cells (C918 and OCM-1). METHODS: C918 and OCM-1 cells cultured in vitro were treated with various concentrations of luteolin (0, 5, 10, 15 μmol/L). Cell growth was observed with an inverted microscope, and cell cycle arrest was detected by propidium iodide (PI) staining using flow cytometry. Apoptosis was detected by Hoechst33342 staining, and apoptosis rate was determined by Annexin V-FITC/PI experiments using flow cytometry. The expression of apoptosis-related proteins Bcl-2, Bax and VEGF was analyzed using Western blots. The levels of VEGF secreted by the cells into the supernatant was analyzed using ELISA. RESULTS: After treating with 5 to 15 μmol/L luteolin for 48h, the fusion degree of C918 and OCM-1 cells decreased, and more floating apoptotic cells appeared. Luteolin treatment increased the G0-G1 phase ratio of the C918 and OCM-1 cells, blocked cell cycle progression, and increased the apoptosis rate of the C918 and OCM-1 cells. Western blot showed that luteolin decreased the expression of Bcl-2 and VEGF in the C918 and OCM-1 cells and increased the expression of Bax protein. The ELISA results showed that 10 to 15 μmol/L luteolin decreased the cell secretion of VEGF. CONCLUSION: Luteolin may induce apoptosis by regulating the levels of apoptosis-related proteins in C918 and OCM-1 cells. Luteolin can induce cell cycle arrest, decrease the expression of VEGF.

Protective effects of human umbilical cord mesenchymal stem cells on retinal ganglion cells in mice with acute ocular hypertension

2020/12/24 0:00:00
AIM: To observe the protective effect of human umbilical cord mesenchymal stem cells (hucMSCs) on retinal ganglion cells (RGCs) injury in mice with acute ocular hypertension (AOH). METHODS: Fifty-six adult male C57BL/6 mice were randomly divided into four groups: normal group, AOH group, hucMSCs group, normal saline (NS) group. Left eye of mice was induced by 90 mm Hg intraocular pressure for 1h to establish AOH model. hucMSCs 1×105/μL, 1 μL or NS 1 μL was injected into the vitreous body the next day. CM-Dil fluorescent dye was used to label the 3rd generation of hucMSCs, for tracing the cells in the vitreous cavity of mice. Seven days after the model established, hematoxylin-eosin (HE) staining was used to observe the thickness of the inner retina layer in four groups. Numbers and loss rate of RGCs were evaluated by counting Brn-3a positive cells stained by immunofluorescencein. RESULTS: On the 7th day after AOH established, labeled hucMSCs were found in the vitreous cavity. HE staining showed that the thickness of retinal inner layer in AOH group was significantly lower than that in normal group and hucMSCs group (P<0.05), same as that in NS group (P>0.05). Compared with AOH group, the RGCs in normal group was significantly higher; RGCs number increased in hucMSCs group and the loss rate was lower (P<0.05). Injection of NS had no protective effect on RGCs. CONCLUSION: In AOH mouse model, vitreous injection of hucMSCs have shown a protection for RGCs.

Is Iba-1 protein expression a sensitive marker for microglia activation in experimental diabetic retinopathy?

2020/12/24 0:00:00
AIM: To investigate the changes of Iba-1 and other potential markers for microglia activation in experimental diabetic retinopathy (DR). METHODS: Male Sprague-Dawley rats were rendered diabetes via intraperitoneal injection of streptozotocin. The retinas were harvested at 1 to 24wk after diabetes onset. Hypoxia-treated mouse microglial cell line (BV2 cells) was employed as the in vitro model to mimic diabetic condition. The expressions of Iba-1, CD11b, ICAM-1 as well as the inflammatory factors were examined with real-time polymerase chain reaction, Western blot and immunofluorescence both in vivo and in vitro. RESULTS: Compared with age-matched normal control, the number of microglia (Iba-1 positive immunostaining) in diabetic rat retinas was increased from 1 to 24wk of diabetes, which was most obvious at 12wk of diabetes. Iba-1 protein expression detected by Western blot was increased slightly in diabetic rat retinas compared with that in age-matched normal control; however, there was statistically significant between two groups only at 2wk after diabetes onset. The mRNA expression of Iba-1 was decreased significantly at 2 and 4wk of diabetic rat retinas, and remained unchanged at 8 and 12wk of diabetes. In BV2 cells, there was no significant change for the Iba-1 protein expression between normoxia and hypoxia groups; however, its mRNA level was decreased significantly under hypoxia. To further characterize microglial activation, F4/80, CD11b and inflammatory factors were detected both in vivo and in vitro. Compared with normal control, the expressions of F4/80 and CD11b as well as the inflammatory factors, such as ICAM-1, iNOS, COX2, IL-1β and IL-6, were increased significantly both in vivo and in vitro. CONCLUSION: Iba-1 protein expression might not be a sensitive marker to evaluate the activation of microglia in experimental DR. However, Iba-1 immunostaining, in combination with other markers like CD11b and ICAM-1, could be well reflect the activation of microglia. Thus, it is of great importance to explore other potential marker to evaluate the activation of microglia.

Retrobulbar administration of purified anti-nerve growth factor in developing rats induces structural and biochemical changes in the retina and cornea

2020/12/24 0:00:00
AIM: To develop an experimental model of endogenous nerve growth factor (NGF) deprivation by retrobulbar administration of purified neutralizing anti-NGF antibodies in young Sprague-Dawley rats and provide further information on NGF expression in the retina and cornea. METHODS: Sixty old pathogen-free Sprague Dawley rats (p14, post-natal days) were treated with repeated retrobulbar injections of neutralizing anti-NGF (2 μL, 100 μg/mL, every 3d). After 2wk (p28), retinal and corneal tissues were investigated for morphological, biochemical, and molecular expression of trkANGFR by using Western blotting or immunofluorescence. Rhodopsin as well as protein profile expression were also investigated. RESULTS: Chronic retrobulbar neutralizing anti-NGF antibodies changed the distribution of trkANGFR immunoreactivity at retinal level, while no changes were detected for global trkANGFR protein expression. By contrary, the treatment resulted in the increase of corneal trkANGFR expression. Retinal tissues showed a decreased rhodopsin expression as well as reduced number of both rhodopsin expressing and total retinal cells, as observed after single cell extraction. A decreased expression of ICAM-1, IL-17 and IL-13 as well as an increased expression of IL-21 typified retinal extracts. No significant changes were observed for corneal tissues. CONCLUSION: The reduced availability of endogenous NGF, as produced by chronic retrobulbar anti-NGF administration, produce a quick response from retinal tissues, with respect to corneal ones, suggesting the presence of early compensatory mechanisms to protect retinal networking.

Preliminary studies of constructing a tissue-engineered lamellar corneal graft by culturing mesenchymal stem cells onto decellularized corneal matrix

Yu-Jie Cen, De-Bo You, Wei Wang and Yun Feng — 2020/11/19 0:00:00
AIM: To construct a competent corneal lamellar substitute in order to alleviate the shortage of human corneal donor. METHODS: Rabbit mesenchymal stem cells (MSCs) were isolated from bone marrow and identified by flow cytometric, osteogenic and adipogenic induction. Xenogenic decellularized corneal matrix (XDCM) was generated from dog corneas. MSCs were seeded and cultured on XDCM to construct the tissue-engineered cornea. Post-transplantation biocompatibility of engineered corneal graft were tested by animal experiment. Rabbits were divided into two groups then underwent lamellar keratoplasty (LK) with different corneal grafts: 1) XDCM group (n=5): XDCM; 2) XDCM-MSCs groups (n=4): tissue-engineered cornea made up with XDCM and MSCs. The ocular surface recovery procedure was observed while corneal transparency, neovascularization and epithelium defection were measured and compared. In vivo on focal exam was performed 3mo postoperatively. RESULTS: Rabbit MSCs were isolated and identified. Flow cytometry demonstrated isolated cells were CD90 positive and CD34, CD45 negative. Osteogenic and adipogenic induction verified their multipotent abilities. MSC-XDCM grafts were constructed and observed. In vivo transplantation showed the neovascularization in XDCM-MSC group was much less than that in XDCM group postoperatively. Post-transplant 3-month confocal test showed less nerve regeneration and bigger cell-absent area in XDCM-MSC group. CONCLUSION: This study present a novel corneal tissue-engineered graft that could reduce post-operatively neovascularization and remain transparency, meanwhile shows that co-transplantation of MSCs may help increase corneal transplantation successful rate and enlarge the source range of corneal substitute to overcome cornea donor shortage.

Therapeutic potential of Rho-associated kinase inhibitor Y27632 in corneal endothelial dysfunction: an in vitro and in vivo study

Yao-Wen Song, Jun-Yu Chen, Xu Li, Li Wang and Zhi-Qiang Pan — 2020/11/19 0:00:00
AIM: To investigate the effects of a selective inhibitor of Rho-associated kinase (ROCK), Y-27632, on inbred Wuzhishan porcine corneal endothelial cells (PCECs) in vitro and in vivo studies. METHODS: Primary PCECs were trypsinized from Wuzhishan miniature porcine corneal tissues. The optimal concentration of Y-27632 on PCECs was determined through MTT and 5-ethynyl-2’-deoxyuridine (EdU)-labeling assays. Seven New Zealand rabbits were used as a corneal endothelial dysfunction model, and a PCECs suspension supplemented with Y-27632 was injected into the anterior chamber of the rabbits. The progression of rabbit corneal opacity and edema were observed by slit lamp examination. The rabbits were sacrificed, and rabbit globes were enucleated for trypan blue-alizarin red staining, hematoxylin-eosin staining, and immunofluorescence analysis. RESULTS: Administration of 100 μmol/L Y-27632 facilitated PCECs’ proliferation obviously. The rabbit corneas injected with PCECs suspension and 100 μmol/L Y-27632 were restored to transparency significantly after 14d. CONCLUSION: The 100 μmol/L Y-27632 treatment improves PCECs’ proliferation significantly. And our results suggest that Y-27632 and PCECs can be used to treat corneal endothelial dysfunction.

Changes of matrix metalloproteinases in the stroma after corneal cross-linking in rabbits

Hong-Zhen Jia, Xu Pang and Xiu-Jun Peng — 2020/11/19 0:00:00
AIM: To observe changes in the content of matrix metalloproteinases (MMPs) in the corneal stroma after corneal cross-linking (CXL) in rabbits, and further explore the corneal pathophysiological process after CXL. METHODS: Forty-two rabbits (42 eyes) were randomly divided into seven groups. One group served as the control group, while the other six groups were treated with CXL. The concentrations of MMPs in corneal stroma were evaluated through parallel reaction monitoring at baseline and 3, 7, 15, 30, 90, and 180d after treatment. RESULTS: The levels of MMP-2 in the corneal stroma of rabbits were 0.76±0.07, 2.78±1.39, 4.12±0.69, 2.00±0.29, 2.00±0.30, 1.22±0.18, and 1.35±0.18 (10-9 mol/g) at baseline and 3, 7, 15, 30, 90, and 180d after treatment, respectively. The contents of tissue inhibitor of metalloproteinase-1 (TIMP-1) were 1.83±0.26, 7.94±0.58, 6.95±2.64, 3.81±0.48, 3.07±0.92, 1.72±0.19, and 1.69±0.74 (10-9 mol/g), respectively. The ratios of MMP-2/TIMP-1 were 0.42±0.33, 0.36±0.20, 0.62±0.10, 0.54±0.15, 0.68±0.13, 0.71±0.10, and 0.68±0.09, respectively. After CXL, the expression of MMP-2 and TIMP-1 in the rabbit corneal stroma was initially increased and subsequently decreased. The levels of MMP-2 remained higher than those recorded at baseline 180d after treatment, but it was not statistically significant. The levels of TIMP-1 returned to baseline levels at 90d after treatment. The ratio of MMP-2/TIMP-1 started to rise from 7d after CXL. It was significantly higher than that calculated at baseline 30-180d after CXL. The results for MMP-1, -3, -7, -9, -13, and TIMP-2 were negative. CONCLUSION: CXL can lead to changes in the content of MMP-2 and TIMP-1 in the rabbit corneal stroma. The ratio of MMP-2/TIMP-1 remains higher versus baseline, indicating that MMP-2 is involved in the corneal pathophysiological process after CXL.

A multi-omics study on cutaneous and uveal melanoma

Qi Zhang, Ze-Nan Lin, Jie Chen and Wen-Xu Zheng — 2020/11/19 0:00:00
AIM: To present the multi-omics landscape of cutaneous melanoma (CM) and uveal melanoma (UM) from The Cancer Genome Atlas (TCGA). METHODS: The differentially expressed genes (DEGs) between CM and UM were found and integrated into a gene ontology enrichment analysis. Besides, the differentially expressed miRNAs were also identified. We also compared the methylation level of CM with UM and identified the differentially methylated regions to integrate with the DEGs to display the relationship between the gene expression and DNA methylation. The differentially expressed transcription factors (TFs) were identified. RESULTS: Though CM had more mutational burden than UM, they shared several similarities such as the same rankings in diverse variant types. Except GNAQ and GNA11, the other top 18 mutated genes of the combined group were mostly detected in CM instead of UM. On the transcriptomic level, 4610 DEGs were found and integrated into a gene ontology enrichment analysis. We also identified 485 differentially expressed miRNAs. The methylation analysis showed that UM had a significantly higher methylation level than CM. The integration of differentially methylated regions and DEGs demonstrated that most DEGs were downregulated in UM and the hypo- and hypermethylation presented no obvious difference within these DEGs. Finally, 116 hypermethylated TFs and 114 hypomethylated TFs were identified as differentially expressed TFs in CM when compared with UM. CONCLUSION: This multi-omics study on comparing CM with UM confirms that they differ in all analyzed levels. Of notice, the results also offer new insights with implications for elucidating certain unclear problems such as the distinct role of epithelial mesenchymal transition in two melanomas, the different metastatic routes of CM and UM and the liver tropism of metastatic UM.

Effects of quercetin on diabetic retinopathy and its association with NLRP3 inflammasome and autophagy

Rong Li, Lin Chen, Guo-Min Yao, Hong-Lin Yan and Li Wang — 2020/11/19 0:00:00
AIM: To investigate the effects of quercetin on diabetic retinopathy (DR) and its association with nucleotide-binding oligomerization domain-like receptors 3 (NLRP3) inflammasome and autophagy using retinal endothelial cell as an experimental model. METHODS: Human retinal microvascular endothelial cells (HRMECs) were cultured in vitro and assigned into the control group, high-glucose (HG) group, and HG+different concentrations of quercetin groups. Cellular viability, migration, and tube formation in these groups was detected by MTT, transwell and matrigel assay, respectively. Expressions of NLRP3, apoptosis-associated speck-like protein (ASC), cysteiny aspartate-specific protease-1 (Caspase-1) as well as microtubule-related protein 1 light chain 3 (LC3) and Beclin-1 were detected by Western blotting. Expressions of IL-1β and IL-18 were detected by ELISA and cellular autophagy was detected by Cyto-ID® autophagy detection kit. RESULTS: Under an HG condition, the viability, migration, tube formation of HRMECs, and the protein expressions of NLRP3, ASC, Caspase-1, IL-1β, IL-18, LC3, and Beclin-1 as well as autophagy were all increased. Quercetin inhibited angiogenesis of HRMECs as well as the expressions of NLRP3, ASC, Caspase-1, IL-1β, IL-18, LC3, Beclin-1, and autophagy of HRMECs under a HG condition. The inhibitory effects of quercetin on angiogenesis, NLRP3 inflammasome and autophagy increased with the increase of its concentration. CONCLUSION: The therapeutic potential of quercetin in retinal neovascularization of DR, and inhibition of NLRP3 inflammasome and autophagy signaling pathway may be involved.

RNA interference targeting NOX4 protects visual function in an experimental model of retinal detachment by alleviating blood-retinal barrier damage

Kai Dong, Nan Yang, Jie Ding, Yuan-Ye Yan, Li Lu and Yi-Sai Wang — 2020/11/19 0:00:00
AIM: To observe the effects of the inhibition of NADPH oxidase 4 (NOX4) expression on the retinal vascular barriers and visual function after retinal detachment (RD). METHODS: RD model was established 3wk after adeno-associaned virus vector injection. The retinal tissue was harvested 3d after RD, and the death of retinal vascular endothelial cells and photoreceptors was observed using electron microscopy. The NOX4 expression was detected by Western blot. Confocal microscopy was used to observe a retinal patch that had been perfused with Evans blue. A modified water maze test was used to detect the time required to find the platform on the water surface. The visual function of the rats was evaluated and reactive oxygen species (ROS) expression was detected by a fluorescence microplate reader. RESULTS: The retinal patch showed that NOX4 interference significantly reduced the destruction of the tight junctions between the retinal endothelium of RD rats and reduced leakage. Western blotting showed decreased expression of the NOX4 protein and decreased expression of ROS in retinal tissue; the Morris water maze test results showed that NOX4 interference significantly decreased the escape latency of the rats. CONCLUSION: NOX4 interference reduces the production of ROS in retinal vascular endothelial cells after experimental RD, thereby protecting the blood-retinal barrier and protecting visual function.

Anti-inflammatory and anti-apoptotic effects of N-acetylcysteine in diabetic rat corneal epithelium

2021/11/25 0:00:00
AIM: To characterize the anti-inflammatory and anti-apoptotic effects of N-acetylcysteine (NAC) in streptozotocin (STZ)-induced diabetic rat corneal epithelium and human corneal epithelial cells (HCECs) exposed to a high-glucose environment. METHODS: HCECs were incubated in 0, 5, 50 mmol/L glucose medium, or 50 mmol/L glucose medium with NAC for 24h. Diabetes was induced in rats by intraperitoneal injection of 65 mg/kg STZ and some of these rats were topically administered NAC to corneas with 3 mice per group. We characterized receptor for advanced glycation end-products (RAGE) expression using immunofluorescence, and interleukin (IL)-1β and cleaved caspase-3 (CCAP-3) expression using immunohistochemistry. Circulating tumor necrosis factor (TNF)-α concentration was measured by ELISA and cleaved poly-ADP ribose polymerase (PARP) concentration was quantified by Western blotting. Apoptotic cells were detected using TUNEL assay and annexin V and propidium iodide staining. RESULTS: Diabetic rats had higher expression of RAGE (2.46±0.13 fold), IL-1β, and CCAP-3 in apoptotic cells of their corneas than control rats. The expression of RAGE (1.83±0.11 fold), IL-1β, and CCAP-3, and the number of apoptotic cells, were reduced by topical NAC treatment. HCECs incubated in 50 mmol/L glucose medium showed high concentrations of TNF-α (310±2.00 pg/mL) and cleaved PARP (7.43±0.56 fold), and more extensive apoptosis than cells in 50 mmol/L glucose medium. However, the addition of NAC reduced the concentrations of TNF-α (153.67±2.31 pg/mL) and cleaved PARP (5.55±0.31 fold) and the number of apoptotic cells. CONCLUSION: NAC inhibits inflammation and apoptosis in the corneas of diabetic rats and HCECs maintained in a high-glucose environment.

Upregulation of ASPP2 expression alleviates the development of proliferative vitreoretinopathy in a rat model

Yan-Kun Yue, Xiao-Li Chen, Shan Liu and Wu Liu — 2021/11/25 0:00:00
AIM: To investigate whether upregulation of apoptosis-stimulating p53 protein 2 (ASPP2) expression could alleviate the development of proliferative vitreoretinopathy (PVR) in a rat model. METHODS: ASPP2-lentivirus or scrambled-lentivirus were transfected into ARPE-19 cells, followed with measurements of cell cytotoxicity by cell counting kit-8 assay. ASPP2 upregulation was confirmed by Western blotting and immunocytochemistry. Then ARPE-19 cells pretreated with ASPP2-lentivirus were intravitreally injected to Brown Norway rats to induce PVR models. PVR development and retinal function were evaluated by retinal photography and electroretinography, respectively. Finally, epithelial-mesenchymal transition as well as autophagy were investigated in rats’ retinas via Western blotting. RESULTS: Protein expression of ASPP2 was significantly upregulated by ASPP2-lentivirus transfection in ARPE-19 cells. The development and progression of PVR were impeded significantly in rats with intravitreal injection of ARPE-19 cells pretreated with ASPP2-lentivirus. Accordingly, retinal functions were less affected and PVR grades were much lower in rats with ASPP2-lentivirus compared to scrambled-lentivirus treatment. Moreover, epithelial-mesenchymal transition and autophagy markers were decreased in the retinas of rats treated with ASPP2-lentivirus. CONCLUSION: ASPP2-lentivirus transfected to ARPE-19 cells mitigates the progression of PVR in rat models, which might be partly through reduced autophagy and attenuated epithelial-mesenchymal transition. ASPP2 might stand as a new approach for PVR treatment in the future.

Mesenchymal stem cell-derived exosomes inhibit the VEGF-A expression in human retinal vascular endothelial cells induced by high glucose

2021/11/25 0:00:00
AIM: To determine the effect of exosomes derived from human umbilical cord blood mesenchymal stem cells (hUCMSCs) on the expression of vascular endothelial growth factor A (VEGF-A) in human retinal vascular endothelial cells (HRECs). METHODS: Exosomes were isolated from hUCMSCs using cryogenic ultracentrifugation and characterized by transmission electron microscopy, Western blotting and nanoparticle tracking analysis. HRECs were randomly divided into a normal control group (group A), a high glucose model group (group B), a high glucose group with 25 μg/mL (group C), 50 μg/mL (group D), and 100 μg/mL exosomes (group E). Twenty-four hours after coculture, the cell proliferation rate was detected using flow cytometry, and the VEGF-A level was detected using immunofluorescence. After coculture 8, 16, and 24h, the expression levels of VEGF-A in each group were detected using PCR and Western blots. RESULTS: The characteristic morphology (membrane structured vesicles) and size (diameter between 50 and 200 nm) were observed under transmission electron microscopy. The average diameter of 122.7 nm was discovered by nanoparticle tracking analysis (NTA). The exosomal markers CD9, CD63, and HSP70 were strongly detected. The proliferation rate of the cells in group B increased after 24h of coculture. Immunofluorescence analyses revealed that the upregulation of VEGF-A expression in HRECs stimulated by high glucose could be downregulated by cocultured hUCMSC-derived exosomes (F=39.03, P<0.01). The upregulation of VEGF-A protein (group C: F=7.96; group D: F=17.29; group E: F=11.89; 8h: F=9.45; 16h: F=12.86; 24h: F=42.28, P<0.05) and mRNA (group C: F=4.137; group D: F=13.64; group E: F=22.19; 8h: F=7.253; 16h: F=16.98; 24h: F=22.62, P<0.05) in HRECs stimulated by high glucose was downregulated by cocultured hUCMSC-derived exosomes (P<0.05). CONCLUSION: hUCMSC-derived exosomes downregulate VEGF-A expression in HRECs stimulated by high glucose in time and concentration dependent manner.

Protective effects of umbilical cord mesenchymal stem cell exosomes in a diabetic rat model through live retinal imaging

2021/11/25 0:00:00
AIM: To assess the protective effect of human umbilical cord mesenchymal stem cell exosomes (hucMSC-Exs) in a diabetic rat model by using a variety of retinal bioassays. METHODS: hucMSCs were subjected to differential ultracentrifugation for the collection of exosomes, and transmission electron microscopy (TEM), nanoparticle tracking analysis (NTA) using a NanoSight analysis system and Western blotting (WB) were used to analyze the expression of surface marker proteins such as CD63, CD9 and Calnexin. Streptozotocin (STZ) was injected into the intraperitoneal cavity to establish a diabetic model. Rats were divided into a normal group, diabetic group and hucMSC-Ex group. Fundus fluorescein angiography (FFA), optical coherence tomography (OCT) and other live imaging methods were used to observe the fundus of the rats. Finally, the eyeballs of rats from each group were collected for hematoxylin-eosin (HE) staining to further analyze the retinal structure. RESULTS: Through TEM, NTA and WB, we successfully isolated hucMSC-Exs. Subsequent FFA and OCT confirmed that hucMSC-Exs effectively prevented early retinal vascular damage and thickening of the retina. Finally, HE staining of rat retinal sections revealed that exosomes effectively alleviated retinal structure disruption caused by diabetes. CONCLUSION: hucMSC-Exs have a protective effect on the retina in diabetic rat through FFA, OCT and HE staining.

Combination of oridonin and TRAIL induces apoptosis in uveal melanoma cells by upregulating DR5

Xin Hua, Peng Wu, Guo-Sheng Gao and Xiao-Lei Ye — 2021/11/25 0:00:00
AIM: To investigate the inhibitory effect of the combined use of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and oridonin on choroidal melanoma cell lines, and to explore its underlying mechanism. METHODS: MUM-2B and C918 cells were treated with different concentrations of TRAIL and oridonin, and MTT assay used to evaluate the inhibition rate of the two compounds on cells. Then, the cell cycle distribution and apoptosis were detected by flow cytometry, and changes in apoptosis-related proteins such as death receptor 5 (DR5), a-caspase-3, and x-linked inhibitor of apoptosis protein (XIAP) were detected by Western blot. MUM-2B cells were transfected with si-DR5, which interfered with the expression of the DR5 gene. MTT and Western blot assay were used to detect cell activity and apoptosis-related proteins. RESULTS: When TRAIL and oridonin were simultaneously administered to the MUM-2B cells, the apoptosis rate was significantly higher than that by the two drugs individually. However, the effect of combined use of TRAIL and oridonin on C918 cells was not significantly different from that used alone. Cell cycle analysis showed that TRAIL and oridonin could induce G2/M arrest in MUM-2B cells. The Western blot results showed that the protein expression levels of the DR5, a-caspase-3, and BAX increased, while the expression levels of the anti-apoptosis-related proteins XIAP and BCL-2 were suppressed when TRAIL and oridonin simultaneously administered to MUM-2B cells. Interfering the expression of DR5 gene in MUM-2B cells could reverse the inhibitory effect of oridonin and TRAIL on the proliferation and apoptosis induction of MUM-2B cells. CONCLUSION: The inhibitory effects of oridonin and TRAIL on MUM-2B cells are significantly enhanced when they were administered as a combined treatment, which may ascribe to up-regulation of DR5.

Novel mutations in PDE6A and CDHR1 cause retinitis pigmentosa in Pakistani families

2021/11/25 0:00:00
AIM: To investigate the genetic basis of autosomal recessive retinitis pigmentosa (arRP) in two consanguineous/ endogamous Pakistani families. METHODS: Whole exome sequencing (WES) was performed on genomic DNA samples of patients with arRP to identify disease causing mutations. Sanger sequencing was performed to confirm familial segregation of identified mutations, and potential pathogenicity was determined by predictions of the mutations’ functions. RESULTS: A novel homozygous frameshift mutation [NM_000440.2:c.1054delG, p. (Gln352Argfs*4); Chr5:g.149286886del (GRCh37)] in the PDE6A gene in an endogamous family and a novel homozygous splice site mutation [NM_033100.3:c.1168-1G>A, Chr10:g.85968484G>A (GRCh37)] in the CDHR1 gene in a consanguineous family were identified. The PDE6A variant p. (Gln352Argfs*4) was predicted to be deleterious or pathogenic, whilst the CDHR1 variant c.1168-1G>A was predicted to result in potential alteration of splicing. CONCLUSION: This study expands the spectrum of genetic variants for arRP in Pakistani families.

Efficacy of rhNGF-loaded amniotic membrane transplantation for rabbit corneal epithelial and nerve regeneration

2021/10/27 0:00:00
AIM: To evaluate the efficacy of recombinant human nerve growth factor-loaded amniotic membrane (rhNGF-AM) on corneal epithelial and nerve regeneration in rabbit model. METHODS: Freshly prepared human amniotic membrane (AM) were immersed into PBS buffer containing 100 or 500 μg/mL rhNGF for 15, 30, and 60min at 4℃. The in vitro release kinetics of rhNGF was measured with ELISA. For in vivo evaluation, the AM were immersed with 500 μg/mL rhNGF for 30min. Fifty-seven rabbits were selected to establish corneal epithelial defect model. In addition to the 19 rabbits in control group, 38 rabbits received AM transplantation with or without rhNGF after the removal of central epithelium. Corneal epithelial defect area, sub-epithelial nerve fiber density, corneal sensitivity, rhNGF contents in resident AM and corneas were measured after the surgery. RESULTS: rhNGF was sustained release from the AM within 14d in vitro, with the positive correlation with initial immersion concentration. The immersion of AM in 500 μg/mL rhNGF for 30min achieved the most stable release within 14d. After transplantation in rabbit cornea, a high concentration of rhNGF in resident rhNGF-AM and cornea was maintained within 8d. Corneal epithelial healing, nerve fiber regeneration and the recovery of corneal sensitivity were significantly accelerated after the rhNGF-AM transplantation when compared to simple AM transplantation (all P<0.05). CONCLUSION: Simple immersion of AM achieves the sustained release of rhNGF, and promotes corneal epithelial wound healing and nerve regeneration, as well as the recovery of corneal sensitivity in rabbit.

Increased cGAS/STING signaling components in patients with Mooren’s ulcer

2021/10/27 9:36:08
AIM: To explore the expression of cGAS/STING signaling components in Mooren’s ulcer (MU). METHODS: Samples were obtained from ten MU patients, and eight residual corneal-scleral rings of healthy donor corneas for controls. Human corneal epithelial cells (HCECs) were used to evaluate the effect of cGAS/STING signaling pathway. Immunohistochemistry (IHC) and Western blot were used to examine the expression of cGAS, STING, and phosphorylated interferon regulatory factor 3 (p-IRF3) in MU tissues. The expression of interferon-β (IFN-β) and interferon-stimulated genes (ISGs) was quantified by real-time polymerase chain reaction (PCR) and enzyme-linked immunosorbent assay (ELISA). RESULTS: The protein levels of cGAS and STING in MU samples were significantly elevated when compared with the healthy controls by Western blot and IHC. After stimulation with cGAMP, real-time PCR and ELISA showed a dramatic increase of IFN-β and ISGs (containing CXCL10, IFIT1, and IL-6) in HCECs. Moreover, HCECs treated with cGAMP was characterized by increased phosphorylation and more nuclear translocation of IRF3. Meanwhile, increased p-IRF3 was observed in MU samples via IHC and Western blot. CONCLUSION: The pronounced expression of cGAS/STING signaling components in the patients with MU and probably contribute to the onset and development of MU.

Inhibition of corneal neovascularization by topical application of nintedanib in rabbit models

Juan Chen, Xue Ding, Wei Du, Xin Tang and Wen-Zhen Yu — 2021/10/27 0:00:00
AIM: To evaluate the potential efficacy and mechanisms of nintedanib in corneal neovascularization (NV) in rabbit models. METHODS: Corneal NV was induced using 1 mol/L NaOH. Rabbits (n=21) were randomized to 3 groups: Group 1 were treated with 0.9% NaCl, Group 2 with Avastin (5 mg/mL), and Group 3 with nintedanib (1 mg/mL). All treatments started 1d after alkaline burns and were topically performed 3 times a day for 2wk. Photographs were taken on a slit lamp microscope on day 7 and 14. The NV area, the length of the vascularization and angiogenesis index (AI) were used to evaluate the corneal NV. On day 14, the immunohistochemical (IHC) studies of the cornea were examined. Western blot was performed to test the expression levels of vascular endothelial growth factor (VEGF), Akt, p-Akt, P38, p-P38, MMP-2 and MMP-9. RESULTS: The corneal NV area, vessel length and AI in Group 3 were significantly lower than Group 2, with both being lower than Group 1. IHC staining showed that VEGF was significantly overexpressed in the epithelium and stroma of cornea following alkaline burns. In contrast, the level of VEGF was significantly suppressed in both Group 2 and Group 3. Western blot results further confirmed that, compared with Group 1, Group 3 had significantly reduced expressions of VEGF, Akt, p-Akt, p-P38, MMP-2, and MMP-9 in corneal tissues. Trends of lower levels of MMP-2, AKT, and p-AKT in Group 3 than Group 2 were identified. CONCLUSION: Nintedanib and Avastin can effectively inhibit corneal NV, with P38 MAPK and AKT signaling pathways being possibly involved. Nintedanib seems more effective than Avastin and has the potential to be a novel therapy for preventing corneal NV.

TGF-β2-induced NEAT1 regulates lens epithelial cell proliferation, migration and EMT by the miR-26a-5p/FANCE axis

Xiao-Hui Yu, Shao-Yi Liu and Cheng-Fang Li — 2021/10/27 0:00:00
AIM: To explore the regulatory mechanism of nuclear paraspeckle assembly transcript 1 (NEAT1) in the pathogenesis of posterior capsule opacification (PCO). METHODS: Quantitative reverse transcription polymerase chain reaction (RT-qPCR) was executed to analyze NEAT1 and microRNA (miR)-26a-5p expression in transforming growth factor-beta 2 (TGF-β2)-disposed lens epithelial cells (LECs). The proliferation, cell cycle progression, apoptosis, and migration of TGF-β2-disposed LECs were evaluated. The relationship between NEAT1 or fanconi anemia (FA) complementation group E (FANCE) and miR-26a-5p was verified by dual-luciferase reporter assay. RESULTS: TGF-β2 induced NEAT1 expression in LECs. NEAT1 inhibition accelerated apoptosis, cell cycle arrest, decreased proliferation, epithelial-mesenchymal transition (EMT), and migration of TGF-β2-disposed LECs. NEAT1 sponged miR-26a-5p to further regulate FANCE expression. Rescue experiments presented that miR-26a-5p downregulation overturned NEAT1 silencing-mediated impacts on TGF-β2-disposed LEC biological behaviors. Additionally, FANCE overexpression reversed miR-26a-5p mimic-mediated impacts on TGF-β2-disposed LEC biological behaviors. CONCLUSION: TGF-β2-induced NEAT1 facilitates LEC proliferation, migration, and EMT by upregulating FANCE via sequestering miR-26a-5p.

Protective effect of human umbilical cord mesenchymal stem cell-derived exosomes on rat retinal neurons in hyperglycemia through the brain-derived neurotrophic factor/TrkB pathway

Xiang Gao, Guang-Hui He, Xiao-Tian Zhang and Song Chen — 2021/10/27 0:00:00
AIM: To explore whether human umbilical cord mesenchymal stem cell (hUCMSC)-derived exosomes (hUCMSC-Exos) protect rat retinal neurons in high-glucose (HG) conditions by activating the brain-derived neurotrophic factor (BDNF)-TrkB pathway. METHODS: hUCMSC-Exos were collected with differential ultracentrifugation methods and observed by transmission electron microscopy. Enzyme-linked immunosorbent assays (ELISAs) was used to quantify BDNF in hUCMSC-Exos, and Western blot was used to identify surface markers of hUCMSC-Exos. Rat retinal neurons were divided into 4 groups. Furthermore, cell viability, cell apoptosis, and TrkB protein expression were measured in retinal neurons. RESULTS: hUCMSCs and isolated hUCMSC-Exos were successfully cultured. All hUCMSC-Exos showed a diameter of 30 to 150 nm and had a phospholipid bimolecular membrane structure, as observed by transmission electron microscopy. ELISA showed the BDNF concentration of hUCMSCs-Exos was 2483.16±281.75. hUCMSCs-Exos effectively reduced the apoptosis of retinal neuron rate and improved neuron survival rate, meanwhile, the results of immunofluorescence verified the fluorescence intensity of TrKB in neurons increased. And all above effects were reduced by treated hUCMSCs-Exos with BDNF inhibitors. hUCMSC-Exos effectively reduced the apoptosis rate of retinal neurons by activating the BDNF-TrkB pathway in a HG environment. CONCLUSION: In the HG environment, hUCMSC-Exos could carry BDNF into rat retinal neurons, inhibiting neuronal apoptosis by activating the BDNF-TrkB pathway.

Anti-viral activity of Staphylococcus aureus lysates against herpes simplex virus type-I infection: an in vitro and in vivo study

2021/9/23 0:00:00
AIM: To investigate the effect of Staphylococcus aureus (S. aures) lysates (SALs) on herpes simplex virus type-I (HSV1) infection in human corneal epithelial (HCE) cells and in a mouse model of HSV1 keratitis. METHODS: HCE, Vero, HeLa, and BV2 cells were infected with HSV1 [HSV1 f strain, HSV1f; HSV-1-H129 with green fluorescent protein (GFP) knock-in, HSV1g]. Pre- or post-infection, SAL at various concentrations was added to the culture medium for 24h. GFP fluorescence in HSV1g or plaque formation by HSV1f were examined. The effects of heat-treated SAL, precooled acetone-precipitated SAL, and SAL subjected to ultrafiltration (100 kDa) were evaluated. The effects of other bacterial components and lysates on HSV1 infection were also tested, including lipoteichoic acid (LTA), peptidoglycan (PGN), staphylococcal protein A (SPA), and α-hemolysin from S. aureus (α-toxin) as well as lysates from a wild-type S. aureus strain, S. epidermidis, and Escherichia coli (W-SAL, SEL, and ECL, respectively). In addition, SAL eye drops were applied topically to BALB/c mice with HSV1 keratitis, followed by in vivo observations. RESULTS: The cytopathic effect, plaque formation (HSV1f), and GFP expression (HSV1g) in infected cells were inhibited by SAL in a dose-dependent manner. The active component of SAL (≥100 kDa) was heat-sensitive and retained activity after acetone precipitation. In HSV1g-infected cells, treatment with LTA-sa, α-toxin, PGN-sa, or SPA did not inhibit GFP expression. SAL, W-SAL, and SEL (but not ECL) decreased GFP expression. In mice with HSV1 keratitis, SAL reduced corneal lesions by 71%. CONCLUSION: The results of this study demonstrate that SAL can be used to inhibit HSV1 infection, particularly keratitis. Further studies are needed to determine the active components and mechanism underlying the effects of SAL.

Interactions of thymic stromal lymphopoietin with interleukin-4 in adaptive immunity during Aspergillus fumigatus keratitis

Chen Chen, Chen-Yang Dai, Fang Han, Jia-Yin Wu, Lin Sun and Xin-Yi Wu — 2021/9/23 0:00:00
AIM: To investigate the potential interactions of thymic stromal lymphopoietin (TSLP) with interleukin-4 (IL-4) in adaptive immunity during fungal keratitis (FK). METHODS: An FK mouse model was induced with Aspergillus fumigatus (AF) hyphal infection. Mice were divided into several groups: untreated, phosphate buffer saline (PBS), infected with AF, and pretreated with a scrambled siRNA, a TSLP-specific siRNA (TSLP siRNA), murine recombinant TSLP (rTSLP), immunoglobulin G (IgG), murine recombinant IFN (rIFN-γ), murine recombinant IL-4 (rIL-4), rIL-13, murine recombinant IL-17A (rIL-17A), and murine recombinant IL-17F (rIL-17F) groups. Quantitative real-time reverse transcription-polymerase chain reaction (qRT-PCR) and enzyme-linked immunosorbent assay (ELISA) or Western blot were performed to determine mRNA and protein levels in the inflamed cornea. Cytokine locations were observed by immunofluoresence staining after AF hyphal infection. RESULTS: Compared to those in the untreated group, TSLP and T helper type 1 (Th1) cytokine levels in the AF group were upregulated at 24h post infection (hpi), and those of T helper type 2 (Th2) and T helper type 17 (Th17) cytokines were increased at 5d post infection (dpi). Th2 cytokine levels were decreased in the TSLP siRNA-pretreated group and increased in the rTSLP-pretreated group compared with the AF group. The TSLP level was increased in the rIL-4-pretreated group, but there were no significant changes among the other groups. Immunofluorescence staining showed cytokine locations after AF hyphal infection. CONCLUSION: TSLP induces a Th2 immune response and promots Th2 T cell differentiation in vivo. IL-4 promotes TSLP secretion. Therefore, TSLP with IL-4 regulates adaptive immunity in FK.

Exosomal miR-29b found in aqueous humour mediates calcium signaling in diabetic patients with cataract

2021/9/23 0:00:00
AIM: To investigate the role of exosomal miR-29b and Ca2+ in regulating the function of human lens epithelial cells (HLECs). METHODS: Exosomes were isolated from human aqueous humour (AH) by ultracentrifugation, and visualized by nanoparticle tracking and transmission electron microscopy. Exosomal miRNA sequencing was performed to identify differentially expressed miRNAs between diabetes with cataracts (DMC) group and age-related cataracts (ARC) group. TargetScan was used to predict potential target of certain miRNA. The expression of CACNA1C mRNA was determined by quantitative real-time polymerase chain reaction and CACNA1C protein was determined by Western blotting. Concentration of Ca2+ in human AH and the culture supernatant of cells were detected by the calcium assay kit. Cell counting kit-8 was used to determine cell viability. RESULTS: Exosomes were isolated from human AH, which had a typical cup-shaped phenotype and a particle size distribution in accordance with micro extracellular vesicles. Exosomal miRNA sequencing revealed that miR-29b was significantly downregulated in DMC group compared with ARC. Ca2+ concentration of human AH in DMC was higher than that in ARC. The culture supernatant of cells transfected with miR-29b inhibitors had a higher concentration of Ca2+ than that transfected with miR-29b mimics. miR-29b reduced the viability of HLECs by upregulating CACNA1C expression. CONCLUSION: Exosomes isolated from human AH contains abundant miRNAs. A significantly expressed miRNA, miR-29b, can affect the concentration of Ca2+ and regulate HLEC processes by upregulating CACNA1C.

Therapeutic effect of a traditional Chinese medicine formulation on experimental choroidal neovascularization in mouse

2021/9/23 0:00:00
AIM: To investigate therapeutic effects of traditional Chinese medicine formulations, Hexuemingmu (HXMM) on laser-induced choroidal neovascularization (CNV) and follow-up effect in mice. METHODS: C57BL/6 mice of 8-week-old were used and CNV was induced with 577 nm laser photocoagulation. Animals were randomly divided into groups and different doses of HXMM were administered daily. One, four, and eight weeks after the intervention, the electroretinogram (ERG), fundus fluorescence angiography, choroidal flat mount and immunofluorescence staining were preformed to evaluate the function and CNV formation. The expression levels of angiogenic proteins were determined by Western blotting and immunofluorescence staining. An analysis of variance and Kruskal-Wallis test were used to test the differences among the groups. RESULTS: The results showed that HXMM effectively increased amplitude of ERG of mice (P<0.05), alleviated fundus CNV leakage (P<0.05), and reduced the area of neovascularization and the expression of angiogenic proteins (P<0.05) after laser-induced CNV. CONCLUSION: HXMM can protect the retinal function of mice after laser-induced CNV, and inhibit the CNV development.

Evans blue staining to detect deep blood vessels in peripheral retina for observing retinal pathology in early-stage diabetic rats

2021/9/23 0:00:00
AIM: To observe and compare the statistical significance of superficial and deep vascular leakage in the pathological changes of the diabetic rats retina after the Evans blue (EB) perfusion, and utilize the modified whole-retina spreading method to make the slides while protecting the periphery of the retina. METHODS: The Sprague-Dawley (SD) rats were randomly divided into 6 groups. Each group named as the normal groups for 4, 8, and 12wk and the diabetic groups for 4, 8, and 12wk. The EB was injected into the cardiovascular system of the rats at the different time points. The retina of each group was obtained for observation. RESULTS: The superficial vascular leakage was found in all 6 groups. The size of leakage area of superficial retinal blood vessels was (0.54±0.23)%, (0.65±0.11)%, and (0.58±0.10)% in normal group. No notable leakage was found in the deep blood vessels [(0.03±0.04)%, (0.03±0.05)%, and (0.03±0.05)%]. The deep retinal vascular leakage was found in the peripheral retina of diabetic rats. The size of leakage area of superficial retinal blood vessels in diabetic group were (0.53±0.22)%, (0.69±0.16)%, and (0.52±0.11)%. The leakage areas of deep blood vessels were (0.54±0.50)%, (1.42±0.16)%, and (1.80±0.07)% at 4, 8, and 12wk, respectively. There was a statistically difference of the leakage area between the 8th week and the 4th week of diabetes group (P=0.003). The statistically significant difference between the diabetes and the control groups was noted at 4wk and 8wk (P<0.001). CONCLUSION: The main retinal pathological changes of early-stage diabetic rats are the vascular leakage of the periphery of deep retina. Diabetic rats modeled after 8wk have semi-quantitative statistical difference compared with the normal rats, thus early intervention treatment research can start at this time point.

Protective effect of LIF-huMSCs on the retina of diabetic model rats

2021/9/23 0:00:00
AIM: To investigate the protective effect of human umbilical cord mesenchymal stem cells (hUCMSCs) modified by the LIF gene on the retinal function of diabetic model rats and preliminarily explore the possible mechanism. METHODS: A stably transfected cell line of hUCMSCs overexpressing leukemia inhibitory factor (LIF) was constructed. Overexpression was verified by fluorescent quantitative polymerase chain reaction (qPCR). Forty-eight adult Sprague-Dawley rats were randomly divided into a normal control group (group A), streptozotocin-induced diabetic control group (group B), diabetic rats at 3mo injected with empty vector-transfected hUCMSCs (group C) or injected with LIF-hUCMSCs (group D). Four weeks after the intravitreal injection, analyses in all groups included retinal function using flash electroretinogram (F-ERG), retinal blood vessel examination of retinal flat mounts perfused with fluorescein isothiocyanate-dextran (FITC-dextran), and retinal structure examination of sections using hematoxylin and eosin staining. Expression levels of adiponectin (APN), high-sensitivity C-reactive protein (hs-CRP), and neurotrophin-4 (NT-4) in each group was detected using immunohistochemistry, PCR, Western blotting, and ELISA, respectively. RESULTS: A stable transgenic cell line of LIF-hUCMSCs was constructed. F-ERG and FITC-dextran examinations revealed no abnormalities of retinal structure and function in group A, severe damage of the retinal blood vessels and function in group B, and improved retinal structure and function in group C and especially group D. qPCR, ELISA, and Western blot analyses revealed progressively higher APN and NT-4 expression levels in groups B, C, and D than in group A. hs-CRP expression was significantly higher in group B than in groups A, C, and D, and was significantly higher in group C than in group D (P<0.05). CONCLUSION: LIF-hUCMSCs protect the retina of diabetic rats by upregulating APN and NT-4 expression and downregulating hs-CRP expression in the retina.

Corneal histomorphology and electron microscopic observation of R124L mutated corneal dystrophy in a relapsed pedigree

2022/9/1 14:00:51
AIM: To investigate the histological characteristics and ultrastructure of recurrent Chinese R124L mutated corneal dystrophy after keratoplasty. METHODS: The subjects were enrolled from a Chinese family of corneal dystrophy with R124L heterozygous gene mutation and with a history of consanguineous marriage. Normal corneal samples were used as controls. RESULTS: In this family, 2 patients (3 eyes) underwent penetrating keratoplasty (PKP) and 2 patients (4 eyes) underwent lamellar keratoplasty (LKP). They had recurrence at 33.5±3.0 (range 30-36)mo after keratoplasty. Among them, 1 patient (1 eye) underwent PKP again and 1 patient (2 eyes) underwent LKP again. In the R124L mutated recurrent corneal dystrophy, the corneal turbidity was mainly distributed from the upper corneal cortex to the anterior stroma; the corneal epithelium surface was rougher and more uneven; and, the corneal erosions were larger. Hematoxylin-eosin staining showed that the thickness of the corneal epithelium was uneven; the arrangement of the epithelial cells was disordered; and, some corneal epithelial cells were swollen. The results of Congo red staining, Masson’s trichrome staining and Periodic acid-Schiff staining were positive, while that of Alcian blue staining was negative. Under a transmission electron microscope, deposition of high electron density substances between epithelial and basal cells, and, apoptosis of basal cells were observed. Many high electron density depositions were observed in the sub-epithelial and anterior corneal matrix. CONCLUSION: In the Chinese family of recurrent corneal dystrophy with R124L gene mutation, the corneal epithelia of the recurrent cases are rougher, and the corneal depositions are extracellular amyloid fibrin.

A novel mutation of RPGR in a Chinese family with X-linked retinitis pigmentosa

2022/9/1 14:00:52
AIM: To identify potential mutations and elucidate the clinical findings of male patients and female carriers of X-linked retinitis pigmentosa (XLRP) in a Chinese family. METHODS: A four generation pedigree was collected that consisted of 20 individuals. Genomic DNA was extracted from peripheral blood, and then the target fragments were amplified by PCR and sequenced directly. In addition, all affected patients and female carriers underwent comprehensively ophthalmic evaluation. RESULTS: A novel mutation c.2865G>A p.W955X in RPGR gene was identified of this family, including four affected individuals and eight carriers. All male patients, aging from 7 to 31y, tended to have more various, even potentially deleterious clinical features of RP. At the same time, individuals with heterozygous mutations (carriers) manifested a wide spectrum of clinical features. Herein, only two male patients and three female carriers manifested pathological myopia (PM). Among the female carriers, half of subjects who harbor poor visual acuity suffered esotropia or exotropia. Additionally, 16.7% and 66.7% of carriers had abnormal electroretinogram (ERG) and fundus, respectively. CONCLUSION: In this study, a novel mutation of the RPGR gene is identified, which broadens the spectrum of RPGR mutations, and elaborates the relationship between genotype and phenotype.

Celastrol inhibits laser-induced choroidal neovascularization by decreasing VEGF induced proliferation and migration

Zhen Li, Ke-Wen Zhou, Fang Chen, Fu Shang and Ming-Xing Wu — 2022/7/28 11:22:37
AIM: To evaluate celastrol’s effect on choroidal neovascularization (CNV). METHODS: In this study, neovascular formation in vitro (tube formation and aortic ring culture) and in vivo (laser induced neovascular in mice) was treated with celastrol to evaluate this natural compound’s impact on CNV. Western blot was applied to explore the possible mechanism for it. For in vitro assay, triplicate for each group was repeated at least three times. For in vivo assay, each group contains 5 mice. RESULTS: Celastrol supressed tube formation and aortic ring sprout neovascularization. In vitro assay exhibited that celastrol inhibiting vascular endothelial growth factor (VEGF)-induced proliferation and migration of human umbilical vein endothelial cells and human choroidal endothelial cells, and by blocking VEGF signaling. Furthermore, intraperitoneal administration of celastrol significantly reduced the area of laser-induced CNV in an in vivo mouse model. By day 14, the area of CNV had decreased by 49.15% and 80.26% in the 0.1 mg/kg celastrol-treated group (n=5) and in the 0.5 mg/kg celastrol treated group (n=5), respectively, compared to the vehicle-treated group (n=5). CONCLUSION: Celastrol inhibits CNV by inhibiting VEGF-induced proliferation and migration of vascular endothelial cells, indicating that celastrol is a potent, natural therapeutic compound for the prevention of CNV.

Vascular endothelial growth factor-165b protects the blood-retinal barrier from damage after acute high intraocular pressure in rats

2022/7/28 11:22:38
AIM: To elucidate the role of vascular endothelial growth factor-165b (VEGF-165b) in blood-retinal barrier (BRB) injury in the rat acute glaucoma model. METHODS: In this study, the rat acute high intraocular pressure (HIOP) model was established before and after intravitreous injection of anti-VEGF-165b antibody. The expression of VEGF-165b and zonula occludens-1 (ZO-1) in rat retina was detected by double immunofluorescence staining and Western blotting, and the breakdown of BRB was detected by Evans blue (EB) dye. RESULTS: The intact retina of rats expressed VEGF-165b and ZO-1 protein, which were mainly located in the retinal ganglion cell layer and the inner nuclear layer and were both co-expressed with vascular endothelial cell markers CD31. After acute HIOP, the expression of VEGF-165b was up-regulated; the expression of ZO-1 was down-regulated at 12h and then recovered at 3d; EB leakage increased, peaking at 12h. After intravitreous injection of anti-VEGF-165b antibody, the expression of VEGF-165b protein was no significantly changed; and the down-regulation of the expression of ZO-1 was more obvious; EB leakage became more serious, peaking at 3d. EB analysis also showed that EB leakage in the peripheral retina was greater than that in the central retina. CONCLUSION: The endogenous VEGF-165b protein may protect the BRB from acute HIOP by regulating the expression of ZO-1. The differential destruction of BRB after acute HIOP may be related to the selective loss of retinal ganglion cells.

Expression profile analysis to identify potential gene changes induced by dexamethasone in the trabecular meshwork

Miao Wei, Lu-Ming Chen, Ze-Yu Huang, Guo-Wei Zhang, Huai-Jin Guan and Min Ji — 2022/7/28 11:22:38
AIM: To investigate potential gene changes in trabecular meshwork (TM) induced by dexamethasone (DEX) in steroid-induced glaucoma (SIG). METHODS: The expression data of 24 cases from a public functional genomics data were sorted to identify the mechanisms of action of DEX on the TM. The relationships of the differentially expressed genes (DEGs) were enriched using Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis. In addition, the hub genes were screened by the Search Tool for the Retrieval of Interacting Genes Database (STRING) and Cytoscape tools. Finally, human TM cells (HTMCs) were treated with DEX to preliminarily explore the function of hub genes. RESULTS: Totally 47 DEGs, including 21 downregulated and 26 upregulated genes were identified. The primary enriched results of the DEGs consisted of inflammatory response, extracellular matrix (ECM), negative regulation of cell proliferation, TNF signalling pathway and the regulation of tryptophan channels by inflammatory mediators. Subsequently, pro-melanin-enriched hormone (PMCH) and Bradykinin B1 receptor (BDKRB1) were screened as hub genes. It is verified in GSE37474 data set. Western blot and quantitative real-time polymerase chain reaction (qPCR) results showed that protein and RNA expression levels of BDKRB1 were significantly decreased after DEX treatment, while PMCH was not significantly changed. CONCLUSION: BDKRB1 may be a key gene involved in SIG onset, providing a suitable therapeutic target for improving the prognosis of SIG patients.

Atypical Adams-Oliver syndrome with typical ocular signs of familial exudative vitreoretinopathy

En-Zhong Jin, Lyu-Zhen Huang, Ming-Wei Zhao and Hong Yin — 2022/7/28 11:22:38
AIM: To report an atypical Adams-Oliver syndrome (AOS) family with typical ocular signs of familial exudative vitreoretinopathy (FEVR). METHODS: A patient with visible avascular area and obvious non-perfusion zone in the peripheral retina with systemic signs of AOS was reported. Familial and personal characteristics were collected for the patient and his sister. Gene sequencing and ophthalmic examinations including fluorescein angiography were all performed for the whole family. RESULTS: Two novel mutations of DOCK6 (c.1396C>T and c.4796G>A) were identified in the proband and his family, and two compound heterozygous mutations were revealed in the proband and his sister. The patient and his sister showed physical deformities and mental abnormalities while FEVR mimicking retinal disorder can also be defined. No remarkable ocular or systemic abnormality can be observed for their parents. Peripheral retinal non-perfusion area, obvious abnormal vascularization or even retinal fold were observed in the proband and his sister, while only small avascular zone was identified for their parents. CONCLUSION: This is the first genetic authenticated AOS case mimicked as FEVR with genetic sequencing of a family. For the patients with ocular phenotype of FEVR, further examination should be performed if the systemic or mental abnormalities exist.

Effect of light-emitting diodes with different color rendering indexes on the ocular tissues of rat

2022/6/30 14:51:22
AIM: To compare the damage of light-emitting diodes (LEDs) with different color rendering indexes (CRIs) to the ocular surface and retina of rats. METHODS: Totally 20 Sprague-Dawley (SD) rats were randomly divided into four groups: the first group was normal control group without any intervention, other three groups were exposed by LEDs with low (LED-L), medium (LED-M), and high (LED-H) CRI respectively for 12h a day, continuously for 4wk. The changes in tear secretion (Schirmer I test, SIt), tear film break-up time (BUT), and corneal fluorescein sodium staining (CFS) scores were compared at different times (1d before experiment, 2 and 4wk after the experiment). The histopathological changes of rat lacrimal gland and retina were observed at 4wk, and the expressions of tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) in lacrimal gland were detected by immunofluorescence method. RESULTS: With the increase of light exposed time, the CFS value of each light exposed group continued to increase, and the BUT and SIt scores continued to decrease, which were different from the control group, and the differences between the light exposed groups were statistically significant. Hematoxylin-eosin (HE) results showed that the lacrimal glands of each exposed group were seen varying degrees of acinar atrophy, vacuole distribution, increasing of eosinophil granules, etc.; the retina showed obvious reduction of photoreceptor cell layer and changes in retinal thickness; LED-L group has the most significant change in all tests. Immunofluorescence suggested that the positive expressions of TNF-α and IL-6 in the lacrimal glands of each exposed group were higher than those of the control group. CONCLUSION: LED exposure for 4wk can cause the pathological changes of lacrimal gland and retina of rats, and increase the expression of TNF-α and IL-6 in lacrimal gland, the degree of damage is negatively correlated with the CRI.

NADPH oxidase 2 plays a protective role in experimental Aspergillus fumigatus keratitis in mice through killing fungi and limiting the degree of inflammation

2022/6/30 14:51:23
AIM: To explore whether nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 2 (NOX2) is expressed in fungal keratitis in mice and investigate its role in this disease. METHODS: NOX2 expression was detected in C57BL/6 mice. After testing the inhibitory effect of diphenyleneiodonium chloride (DPI) on NOX2, its impact on clinical performance, myeloperoxidase levels, the number of colonies forming units, the level of H3, the generation of reactive oxygen species (ROS) and the release of cytokines [NF-κB, interleukin-17A (IL-17A), interleukin-6 (IL-6), tumor necrosis factor-α (TNF-α), Nrf2, IL-10, and TGF-β] were compared. A one-way ANOVA and an unpaired, two-tailed Student’s t-test was used to determine the statistical significance. RESULTS: NOX2 expression was significantly increased after Aspergillus fumigatus injection in corneas and that this increase could be reduced by treatment with DPI. DPI treatment produced more severe inflammation and resulted in higher clinical scores, more neutrophils infiltration, a weakened ability to clear fungi, the release of fewer ROS and the formation of neutrophil extracellular traps. Treatment with DPI increased the expression of the proinflammatory cytokines NF-κB, IL-17A, IL-6, and TNF-α and decreased the expression of the anti-inflammatory cytokines Nrf2, IL-10 and TGF-β compared to their expression levels without DPI treatment. CONCLUSION: NOX2 plays an important role against Aspergillus fumigatus in the mouse cornea through killing fungi and limiting the degree of inflammation.

Dynamic changes of inducible nitric oxide synthase expression in rat’s retina and its role on blood-retinal barrier injury after acute high intraocular pressure

2022/6/30 14:51:23
AIM: To clarify the role of inducible nitric oxide synthase (iNOS) in blood-retinal barrier (BRB) injury after acute high intraocular pressure (IOP) in rats. METHODS: Forty-two Sprague-Dawley (SD) rats were randomized into 7 groups [control (Cont), 3, 6, 12, 24, 48, and 72h, n=6]. Except Cont group, other groups’ retina tissue was obtained at corresponding time points after a model of acute high IOP have been established in rats. The expression of iNOS and tight junction protein zonula occludens (ZO)-1 was detected by Western blotting. Evans blue (EB; 3% ) was injected into the great saphenous vein to detect the leakage of EB by spectrophotometer. Nine rats were divided into Cont, 6h, 12h groups, the expression of iNOS was localized by immunofluorescence. In order to verify the role of iNOS in the damage to BRB, thirty-six rats were randomly divided into 4 groups [Cont, Cont+inhibitor (Inh), 6h and 6h+Inh, n=9]. After treatment with the iNOS-specific inhibitor 1400W, the expression of iNOS and ZO-1 and the leakage of BRB were detected again. RESULTS: The immunofluorescence results showed that the expression of iNOS was observed in the Cont group and 6h group, but not in the 12h group. iNOS was mainly expressed in the retinal nerve fiber layer, ganglion cell layer and inner nuclear layer and that it did not colocalize with the retinal ganglion cell marker NeuN but was co-expressed with the vascular endothelial cell marker CD31. Western blotting showed that in the early period (3h, 6h) after acute high IOP, the expression of iNOS was upregulated, then the down-regulation of iNOS were tested in the follow-up timing spots. ZO-1 expression showed a continuous down-regulation after 6h. The quantitative results for EB showed that the amount of EB leakage began to increase at 3h after acute high IOP. At 6h, the leakage of EB was lower, but at 12h, the leakage of EB was highest, after which it gradually recovered but remained higher than that in the Cont group. The expression of iNOS was down-regulated after 1400W treatment. ZO-1 expression was not significantly changed in the Cont+Inh group and the 6h group, and significantly down-regulated in the 6h+Inh group, and the leakage of EB was significantly increased after 1400W treatment. CONCLUSION: These results suggest that the upregulation of iNOS expression in the early stage after acute high IOP may have a protective effect on BRB injury.

Clinical features, surgical outcomes and genetic analysis of ectodermal dysplasia with ocular diseases

Xi Chen, Wei-Xuan Zeng, Bao-Ying Duan, Yan-Yan Lin, Jia Liu and Zong-Duan Zhang — 2022/6/30 14:51:23
AIM: To report on the clinical features, surgical outcomes and gene mutation analysis of three ectodermal dysplasia probands with ocular diseases. METHODS: A case-note review of three unrelated probands diagnosing with ectodermal dysplasia with ocular diseases was undertaken. Patient clinical features and the outcomes of surgery were analysed. The suspected pathogenic genes were analysed by whole exome sequencing from patients with ectodermal dysplasia and Sanger sequencing from family members. RESULTS: The ocular clinical features of ectodermal dysplasia with ocular diseases mainly include eyelid ectropion, lagophthalmos and absence of lacrimal punctum. All the probands underwent surgeries of full-thickness free skin flap grafting to correct ectropion. They achieved good recovery, and there were no obvious complications during the follow-up. The gene sequencing results did not show any meaningful genetic mutations. CONCLUSION: Lid ectropion is one of the key clinical traits of ectodermal dysplasia with ocular diseases. Ectropion correction with full-thickness free skin flap grafting is an effective procedure to correct ectropion for ectodermal dysplasia patients with ichthyosis-like tissue. The suspected pathogenic genes of ectodermal dysplasia with ectropion should be further verified or confirmed by large samples of the family.

Procollagen C-proteinase enhancer 1 promotes physiologic retinal angiogenesis via regulating the process of collagen

Jia Luo, Pei-Quan Zhao, Hao-Jie Chen, Miao-Miao Liu, Jia-Qi He and Ping Fei — 2022/5/31 14:47:07
AIM: To investigate the role of procollagen C-proteinase enhancer 1 (PCPE1) in retinal angiogenesis and relevant mechanisms. METHODS: The Pcolce1-knockout (KO) mice were used to explore the effect of PCPE1 on retinal angiogenesis in vivo. Pcolce1 siRNA were designed, cell count kit 8 (CCK8) assays and tube formation assays were performed to investigate the cell proliferation and tube formation abilities of retinal microvascular endothelial cells (hRMECs) in vitro. Mouse embryo fibroblasts (MEF) cells were isolated and cultured to analyze the effect of PCPE1 on enhancing procollagen cleavage. RESULTS: In vivo studies showed that the retinal vascular density of Pcolce1-/- mice was significantly lower than that of the control group. Furthermore, silencing of Pcolce1 inhibited cell proliferation and tube formation abilities of hRMECs in vitro. Additionally, much more pro-collagen was found in Pcolce1-/- MEF cells, compared to wild type MEF cells. CONCLUSION: PCPE1 may promote physiological retinal angiogenesis by regulating the processing of collagen, which may provide a potential therapeutic target of retinal vascular disease.

Ultrasound-targeted cationic microbubble-mediated gene transfection and inhibition of retinal neovascularization

Ming-Xing Wu, Yu Zhou, Xi-Yuan Zhou and Yan Xu — 2022/5/31 14:47:08
AIM: To investigate whether ultrasound-targeted cationic microbubbles (CMBs) destruction could deliver endostatin-green fluorescent protein (GFP) plasmids efficiently to the human retinal endothelial cells (HRECs) and inhibit retinal neovascularization in mice. METHODS: CMBs were prepared and the presentation of GFP reporter was confirmed by flow cytometry and laser confocal microscopy. Experiments assessing HRECs migration and vascular formation were performed to evaluate gene therapy's efficiency in vitro. A mouse model of oxygen-induced retinopathy was employed and the expression of Bcl-xl, Bcl-2, vascular endothelial growth factor (VEGF) and endostatin in the retina of mice were determined by Western blotting and quantitative polymerase chain reaction (qPCR). The expression of endostatin-GFP in the retina was examined by laser confocal microscopy at 5, 14, and 28d after treatment. RESULTS: The gene expression of endostatin was the highest in the group of the CMBs. Besides, the inhibition and antiangiogenesis effect of the migration and development of HRECs were improved following treatment with CMBs compared with the other groups in vitro. In vivo, retinal neovascularization was significantly inhibited and the fluorescence intensity of endostatin-GFP in the mouse retina was importantly higher in the group of CMBs than that in other groups. CONCLUSION: The research illustrates ultrasound-targeted CMBs destruction possessed distinct effect on the inhibition of the vascular formation and the development of retinal neovascularization both in vitro and in vivo.

Multimodal imaging of experimental choroidal neovascularization

2022/5/31 14:47:08
AIM: To compare choroidal neovascularization (CNV) lesion measurements obtained by in vivo imaging modalities, with whole mount histological preparations stained with isolectin GS-IB4, using a murine laser-induced CNV model. METHODS: B6N.Cg-Tg(Csf1r-EGFP)1Hume/J heterozygous adult mice were subjected to laser-induced CNV and were monitored by fluorescein angiography (FA), multicolor (MC) fundus imaging and optical coherence tomography angiography (OCTA) at day 14 after CNV induction. Choroidal-retinal pigment epithelium (RPE) whole mounts were prepared at the end of the experiment and were stained with isolectin GS-IB4. CNV areas were measured in all different imaging modalities at day 14 after CNV from three independent raters and were compared to choroidal-RPE whole mounts. Intraclass correlation coefficient (ICC) type 2 (2-way random model) and its 95% confidence intervals (CI) were calculated to measure the correlation between different raters' measurements. Spearman's rank correlation coefficient (Spearman's r) was calculated for the comparison between FA, MC and OCTA data and histology data. RESULTS: FA (early and late) and MC correlates well with the CNV measurements ex vivo with FA having slightly better correlation than MC (FA early Spearman's r=0.7642, FA late Spearman's r=0.7097, and MC Spearman's r=0.7418), while the interobserver reliability was good for both techniques (FA early ICC=0.976, FA late ICC=0.964, and MC ICC=0.846). In contrast, OCTA showed a poor correlation with ex vivo measurements (Spearman's r=0.05716) and high variability between different raters (ICC=0.603). CONCLUSION: This study suggests that FA and MC imaging could be used for the evaluation of CNV areas in vivo while caution must be taken and comparison studies should be performed when OCTA is employed as a CNV monitoring tool in small rodents.

miRNA-451 regulates rhesus choroid-retinal endothelial cell function and proteome profile

Hong-Lian Wu, Yan Shao, Zhen-Na Chen, Hui Zhang, Xiao-Min Zhang and Xiao-Rong Li — 2022/5/31 14:47:09
AIM: To evaluate the effect of miRNA-451 on rhesus macaque choroid-retinal endothelial (RF/6A) cell function and proteome profile. METHODS: The RF/6A cells were transfected with miRNA-451 mimic and inhibitor. The role of miRNA-451 on proliferation ability was evaluated by CCK-8 assay. Furthermore, iTRAQ quantitative proteomic analysis was applied to comprehensively illuminate the change of cellular proteins and biological function between different groups. RESULTS: In miRNA-451 overexpression group, cell proliferation of RF/6A decreased both at 24h and 48h; while in miRNA-451 inhibition group, on the contrary, RF/6A cell proliferation was increased at 48h. Based on iTRAQ quantitative proteomic analysis, 23 differentially expressed proteins (DEPs) were detected in the comparison of miRNA-451 mimic and mimic control-transfected RF/6A cells, and 30 DEPs were identified in the comparison of RF/6A cells transfected with miRNA-451 inhibitor and inhibitor control. DEPs such as GORASP2, KRT1, SLC7A2, RIC8A, DDX42, CAP1, PCBP2 might be closely related to the inhibitory effect of miRNA-451 on RF/6A cell proliferation, while PCYT1A, MGAT1, TUBB, MCU, SIL1, BID, MSH6 might account for the positive effect of miRNA-451 inhibitor on RF/6A cell growth. PTPN1, as the only protein exhibiting an opposite trend between miRNA-451 mimic and inhibitor-transfected cells, was most likely accountable for the inhibition of miRNA-451 mimic on RF/6A cell growth, and the promotion of miRNA-451 inhibitor on RF/6A cell proliferation. CONCLUSION: miRNA-451 overexpression can suppress the growth of RF/6A cells while knockdown of miRNA-451 can promote RF/6A cell viability. Among all DEPs, increased PTPN1 is most likely to account for the negative regulation of miRNA-451 on RF/6A proliferation. miRNA-451 can be a protective factor for neovascular disease of fundus via regulating choroid retinal endothelial cell function.

Effects of curcumin nanoparticles on proliferation and VEGF expression of human retinal pigment epithelial cells

Hai-Sheng Zheng, Yu-Qing Lan, Xing-Wu Zhong, Huai-Sheng Zhou and Jia-Yao Xu — 2022/5/31 0:00:00
AIM: To investigate the effects of curcumin (Cur) nanoparticles loaded with chitosan derivatives grafted by deoxycholic acid (Chit-DC) on human retinal pigment epithelial (hRPE) cell proliferation and vascular endothelial growth factor (VEGF) mRNA expression. METHODS: Cur nanoparticles were synthesized with Chit-DC as the carrier and Cur as the supported drug. Cell counting kit-8 (CCK-8) method was used to detect the effects of different concentrations of Cur/Chit-DC, Chit-DC, and Cur on the proliferation of hRPE cells for different times. The changes of Cur/Chit-DC and Cur on hRPE cell cycle were determined by flow cytometry. Semi-quantitative reverse transcription-polymerase chain reaction (RT-PCR) was used to detect the mRNA expression levels of VEGF in hRPE cells treated with Cur, Chit-DC and Cur/Chit-DC at 10 μg/mL for 24h. RESULTS: Different concentrations of Chit-DC nanoparticle treated hRPE cells had no significant difference in terms of optical density (OD) values compared with the control group at 24h and 48h. Moreover, there was no change in the cell morphology under a light microscope. After 24h treatment with Cur/Chit-DC and Cur, the percentage of G0-G1 phase cells increased and the percentage of S phase cells decreased in all concentration groups. Cur/Chit-DC and Cur in all concentration groups inhibited the proliferation of hRPE cells in a time and dose dependent manner, and reduced the expression level of VEGF mRNA. CONCLUSION: The Cur/Chit-DC nanoparticles can release Cur continuously and have sustained release function. Both Cur/Chit-DC nanoparticles and Cur could inhibit hRPE cells cultured in vitro, and could reduce the expression level of VEGF mRNA in hRPE cells.

Evaluation of nintedanib as a new postoperative antiscarring agent in experimental extraocular muscle surgery

2022/5/31 14:47:10
AIM: To investigate the efficacy of nintedanib on reducing postoperative inflammation, fibrosis and adhesion formation following extraocular muscle surgery in rabbits in comparison with triamcinolone acetonide (TA). METHODS: Reinsertion of superior rectus muscle in right eyes of 30 New Zealand white rabbits were performed. They were randomized to receive one of the following treatments: 0.9% normal saline, one of 1-, 5-, and 10 μmol doses of nintedanib subconjunctivally immediately after surgery and on postoperative day 1, 2, 3, 5, and 7, and TA immediately after surgery. As a control group, unoperated left eyes (n=6) were used. On the 28th day, six eyes from each group were enucleated and histopathologically and immunohistochemically analyzed to assess the postoperative inflammatory changes, fibrosis and adhesion. Transforming growth factor beta, matrix metalloproteinase-2 and alpha smooth muscle actin expressions were evaluated. RESULTS: Conjunctival and scleral inflammation in TA and nintedanib groups were significantly reduced compared to saline (sham) group. Conjunctival vascularity and rectus muscle fibrosis were significantly reduced in 10 µmol nintedanib group. Nintedanib groups were the most effective groups in reduction of perimuscular fibrosis. Neither three nintedanib groups nor TA group differed statistically from sham group with regard to adhesion. The expressions of transforming growth factor beta, alpha smooth muscle actin and matrix metalloproteinase-2 were reduced in nintedanib groups compared to saline group. CONCLUSION: Nintedanib appears to attenuate postoperative inflammation and fibrosis after extraocular muscle surgery. Nintedanib may be a safer and stronger alternative agent in extraocular muscle surgery when compared to steroids. Further investigation is needed to prove antiadhesive effect of nintedanib.

Hyperosmolarity disrupts tight junction via TNF-α/MMP pathway in primary human corneal epithelial cells

Yun Zhang, Ming Yang, Shi-Xin Zhao, Li Nie, Li-Jun Shen and Wei Han — 2022/4/27 14:07:14
AIM: To investigate the mechanism of the tight junction (TJ) disruption and the association between tumor necrosis factor (TNF)-α and matrix metalloproteinase (MMPs) under hyperosmotic condition in primary human corneal epithelial cells (HCECs). METHODS: The cultured HCECs were exposed to media which adding sodium chloride (NaCl) for hyperosmolar stress or adding rh-TNF-α (10 ng/mL). NF-κB inhibitor (5 μmol/L) or GM-6001 (potent and broad spectrum MMP inhibitor, 20 μmol/L) was added 1h before that treatment. The integrity of TJ proteins was determined by immunofluorescent (IF) staining. The mRNA levels of TNF-α and MMPs were evaluated by quantitative reverse transcription polymerase chain reaction (RT-qPCR) and the protein expression by enzyme-linked immunosorbent assay (ELISA). RESULTS: TJ proteins ZO-1 and Occludin were disrupted in primary HCECs exposed to hyperosmotic medium. The mRNA expression and protein production of TNF-α increased significantly in hyperosmotic media at 500 mOsM. TNF-α mediated the expression and production of MMP-1, MMP-13, MMP-9, and MMP-3 stimulated by hyperosmotic stress. The production of MMPs in hyperosmolar media were increased through the increase of TNF-α. GM-6001 prevent the destruction of ZO-1 and Occludin in hyperosmolar stress and rh-TNF-α treated medium. TNF-α induced activation of MMPs was involved in the TJ disruption by hyperosmolarity. CONCLUSION: TJ proteins ZO-1 and Occludin are disrupted by hyperosmolar stress and TNF-α, but protected by MMP inhibitor (GM-6001). It suggests that TNF-α/MMP pathway mediates the TJ disruption in primary HCECs exposed to hyperosmotic stress.

Exosome-mediated aptamer S58 reduces fibrosis in a rat glaucoma filtration surgery model

2022/4/27 14:07:14
AIM: To confirm whether exosome-mediated delivery of aptamer S58 (Exo-S58) has a better antifibrotic effect than naked S58 in human conjunctival fibroblasts (HConFs) and a rat glaucoma filtration surgery (GFS) model. METHODS: To enhance the effective reaction time of aptamer S58 in vivo, we loaded aptamer S58 into exosomes derived from HEK293T cells by PEI transfection to determine the effect of Exo-S58 in HConFs and a rat GFS model. RESULTS: Exo-S58 can significantly reduce cell proliferation, migration and fibrosis in TGF-β2-induced HConFs. In an in vivo experiment, Exo-S58 treatment prolonged filtering bleb retention and reduced fibrosis compared with naked S58 treatment in GFS rats. CONCLUSION: The exosomes are safe and valid carriers to deliver aptamers. Furthermore, Exo-S58 exhibited superior antifibrotic effect than naked S58 both in HConFs cells and rat GFS models.

Yes-associated protein promotes endothelial-to-mesenchymal transition of endothelial cells in choroidal neovascularization fibrosis

Rong Zou, Yi-Fan Feng, Ya-Hui Xu, Min-Qian Shen, Xi Zhang and Yuan-Zhi Yuan — 2022/4/27 14:07:14
AIM: To reveal whether and how Yes-associated protein (YAP) promotes the occurrence of subretinal fibrosis in age-related macular degeneration (AMD). METHODS: Cobalt chloride (CoCl2) was used in primary human umbilical vein endothelial cells (HUVECs) to induce hypoxia in vitro. Eight-week-old male C57BL/6J mice weighing 19-25 g were used for a choroidal neovascularization (CNV) model induced by laser photocoagulation in vivo. Expression levels of YAP, phosphorylated YAP, mesenchymal markers [α smooth muscle actin (α-SMA), vimentin, and Snail], and endothelial cell markers (CD31 and zonula occludens 1) were measured by Western blotting, quantitative real-time PCR, and immunofluorescence microscopy. Small molecules YC-1 (Lificiguat, a specific inhibitor of hypoxia-inducible factor 1α), CA3 (CIL56, an inhibitor of YAP), and XMU-MP-1 (an inhibitor of Hippo kinase MST1/2, which activates YAP) were used to explore the underlying mechanism. RESULTS: CoCl2 increased expression of mesenchymal markers, decreased expression of endothelial cell markers, and enhanced the ability of primary HUVECs to proliferate and migrate. YC-1 suppressed hypoxia-induced endothelial-to-mesenchymal transition (EndMT). Moreover, hypoxia promoted total expression, inhibited phosphorylation, and enhanced the transcriptional activity of YAP. XMU-MP-1 enhanced hypoxia-induced EndMT, whereas CA3 elicited the opposite effect. Expression of YAP, α-SMA, and vimentin were upregulated in the laser-induced CNV model. However, silencing of YAP by vitreous injection of small interfering RNA targeting YAP could reverse these changes. CONCLUSION: The findings reveal a critical role of the hypoxia-inducible factor-1α (HIF-1α)/YAP signaling axis in EndMT and provide a new therapeutic target for treatment of subretinal fibrosis in AMD.

Chordin-like 2 influences the differentiation fate of retinal pigment epithelium cells by dynamically regulating BMP pathway

Duo Li, Song-Tao Yuan, Xin-Yi Xie, Han Shen, Qing-Huai Liu and Yong Yao — 2022/4/27 14:07:15
AIM: To explore the functions of Chordin-like 2, which is encoded by CHRDL2, in the process of retinal pigmented epithelium (RPE) differentiation and damage repair. METHODS: The fetal RPE cells (fRPE) was obtained from aborted fetus which obeyed medical ethics. Real-time quantitative polymerase chain reaction was used to measure expression quantity of CHRDL2 and other functional genes expression. Knocking down and overexpression was used to analyze the functions about Chordin-like 2. Enzyme-linked immunosorbent assay (ELISA) was used to detect the secretion of bone morphogenetic proteins 4 (BMP4). Flow cytometry was used to analyze cell cycle. Cell morphology was observed by phase contrast microscope (PCM). RESULTS: In normal RPE cells, CHRDL2 was firstly upregulated and followed a downregulation but eventually, it was expressed higher than the cells which undergone epithelial-mesenchymal transition (EMT). After knocking down CHRDL2, the secretion of BMP4 was decreased, RPE-related genes (OTX2, MITF, RPE65) were downregulated while EMT-related genes (SNAI1, VIM) were upregulated. However, the expression of these related genes after overexpression of CHRDL2 had contrary results. Chordin-like 2 also regulated the cell cycle by regulating BMP pathway. When CHRDL2 was knocked down, more fRPE cells stayed in S phase of cell cycle, while adding BMP4 reduced the proportion of the cells in S phase. However, overexpression of CHRDL2 increased more BMP4 secretion, this effect decreased the number of cells in S phase, but exogenous BMP inhibitor also could change this effect. At last, in the process of RPE cells differentiation, adding BMP4 at early stage could intervene normal RPE differentiation. Compared with BMP4, inhibiting BMP pathway had no significant negative effect at early stage, but suppressed differentiation at late stage. CONCLUSION: BMP pathway can be activated in a correct temporal order, otherwise, the cells have incorrect differentiation orientation. And Chordin-like 2 plays a role in dynamic regulation of BMP pathway and it also regulates the differentiation of RPE cells. Therefore, this research enlightens a new direction to inhibit EMT and promote cell redifferentiation after injury.

CCPG1 involved in corneal Aspergillus fumigatus infection

2022/3/29 14:34:12
AIM: To investigate whether non-canonical autophagy transport receptor cell cycle progression 1 (CCPG1) is involved in the corneal antifungal immune response. METHODS: Human corneal epithelial cells (HCECs) and human myeloid leukemia mononuclear cells (THP-1) macrophages stimulated by Aspergillus fumigatus (A. fumigatus) were used as cell models. The expression of CCPG1 mRNA was detected by qRT-PCR. Western blot was used to determine the protein expression of CCPG1 and interleukin-1β (IL-1β). The dectin-1 neutralizing antibody was used to detect the association between dectin-1 and CCPG1. Immunofluorescence was used to observe the colocalization of CCPG1 and C-type lectin-like receptor-1 (CLEC-1) in THP-1 macrophages. RESULTS: The expression of CCPG1 started to increase at 4h after infection and increased in a time-dependent manner in HCECs and THP-1 macrophages. With dectin-1 neutralizing antibody pretreatment, the expression of IL-1β was down-regulated. CCPG1 up-regulation in response to A. fumigatus infection was independent of dectin-1. Immunofluorescence showed the colocalization of CCPG1 and CLEC-1 in THP-1 macrophages. CONCLUSION: As a specific autophagy protein of non-canonical autophagy pathway, CCPG1 is involved in corneal infection with A. fumigatus.

Anti-scarring effect of sodium hyaluronate at filtration pathway after filtering surgery in rabbits

Yu-Jue Wang, Le-Meng Feng, Cheng Zhang, Wu-Long Zhang and Wei-Tao Song — 2022/3/29 14:34:13
AIM: To investigate the anti-scarring effect of sodium hyaluronate (HA) at filtration pathway after filtering surgery in a rabbit model. METHODS: Fifteen healthy adult New Zealand white rabbits were selected for trabeculectomy in both eyes. The right eyes were used as HA group with 0.1 mL HA injected into the anterior chamber at the end of the operation; the left eyes were used with 0.1 mL sodium lactate Ringer’s solution (RS) injected into the anterior chamber as RS group. Intraocular pressure (IOP), filtering blebs morphology, inflammatory reaction and complications were observed at the 7, 60, and 90d after surgery. RESULTS: One day after surgery, the IOP of HA and RS groups were 12.75±1.92 and 10.50±1.59 mm Hg (P=0.005). At the 7th day postoperative, the filtering blebs of each group were functional type and TGF-β expression was significantly difference in both groups (0.10±0.01 vs 0.14±0.02, P=0.024). After 60d of the operation, all filtering blebs were scarring and alpha-smooth muscle actin (α-SMA) expression was significantly difference in both groups (0.40±0.04 vs 0.35±0.02, P=0.032). α-SMA positive cells were mainly distributed in the junction of conjunctiva and sclera and around the blood vessels. The collagen volume fraction (CVF) of HA and RS group was (75.49±7.01)% and (79.93±5.35)% (P=0.044). On the 90th day after the operation, CVF was (82.57±5.19)% and (88.08±1.75)% in HA and RS groups (P=0.036). There was no α-SMA positive cell in HA group, while a few positive cells were observed in RS group (P=0.000). CONCLUSION: HA has effect of anti-scar and anti-inflammation on filtration pathway after filtering surgery within 3mo by inhibiting fibroblast proliferation and collagen deposition.

Leptin activates the JAK/STAT pathway to promote angiogenesis in RF/6A cells in vitro

2022/3/29 14:34:13
AIM: To investigate the effect of leptin on the angiogenesis of RF/6A cells (monkey retinal choroidal endothelial cells) in vitro and test the cellular signaling in the mechanism. METHODS: RF/6A cells were cultured in vitro and randomly divided into four groups: normal control, with leptin at 50, 100, 200 ng/mL for cell counting kit-8 (CCK8). RF/6A cell proliferation and migration were examined by Transwell assays, while RF/6A cell tube formation by Matrigel assay. JAK2, p-JAK2, STAT3, and p-STAT3 protein expression was measured by Western blotting. Cells were then divided into the following treatment groups: control, 100 ng/mL leptin and AG-490 (100 ng/mL leptin+10 μmol/L AG-490) for examinations of RF/6A cellular behaviour again. Analysis of differences was carried out using one-way ANOVA and least significant difference (LSD). RESULTS: RF/6A cell proliferation, migration and cell tube formation were promoted significantly by leptin in a dose-dependent manner (P<0.05). Western blotting showed that leptin up-regulated p-JAK2 and p-STAT3 expression levels. Treatment with the JAK/STAT pathway inhibitor, AG-490, decreased leptin-induced p-JAK2 and p-STAT3 expression, and inhibited cell proliferation, migration and cell tube formation induced by leptin (P<0.05). CONCLUSION: Leptin can promote RF/6A cell angiogenesis in vitro via activation of the JAK2/STAT3 signaling pathway.

Protective limb remote ischemic post-conditioning against high-intraocular-pressure-induced retinal injury in mice

Qi-Jiang Zhu, Lei Zhang, Shuang-Yu Lyu, Zhan-Jun Cui, En-She Jiang and Jun Wang — 2022/3/29 14:34:13
AIM: To determine whether limb remote ischemic post-conditioning (LRIC) protects against high-intraocular-pressure (IOP)-induced retinal injury, and to identify underlying molecular mechanisms. METHODS: In mice, IOP was increased to 110 mm Hg for 50min and LRIC applied to the unilateral leg for three occlusion cycles (5min/release). Three animal groups (control, high IOP, and high IOP+LRIC) were arranged in this study. Plasma was collected from LRIC treated mice. Retinal histology, oxidative stress were determined by histological section staining and chemical kit. C/EBP homologous protein (CHOP), and Iba-1 parameters were evaluated by immunofluorescent staining and Western blot. RESULTS: The data showed that LRIC treatment alleviated the retinal histological disorganization and ganglion cell loss induced by high IOP. The CHOP, Iba-1 expression and oxidative stress marker also were inhibited by LRIC treatment. To further explore underlying mechanisms, plasma from LRIC treated animals was intravenously transfused into high-IOP animals. The results showed plasma injection decreased caspase 9 expression and DHE staining signals compared with that in high IOP retinas. CONCLUSION: These data suggest that LRIC treatments exert retinal protective effects against high-IOP injury. Endogenous humoral factors release into the circulation by LRIC may contribute to homeostatic protection by reducing monocyte infiltration and/or microglia activation.

Inhibitory effects of luteolin on TLR3-mediated inflammation caused by TAK/NF-κB signaling in human corneal fibroblasts

2022/3/1 14:57:53
AIM: To study the role of luteolin (LUT) in the expression of toll-like receptors 3 (TLR3) ligand polyI:C stimulated inflammatory factors in human corneal fibroblasts (HCFs). METHODS: HCFs cells were cultivated with or without LUT or polyI:C. The expression levels of interleukin (IL)-6, IL-8, monocyte chemotactic protein-1 (MCP-1), vascular cell adhesion molecule (VCAM)-1, as well as intercellular adhesion molecule (ICAM)-1 were measured using enzyme-linked immunosorbent assay (ELISA), immunoblotting or reverse transcription-quantitative polymerase chain reaction (PCR) analyses. Immunoblotting was used to assess toll-interleukin-1 receptor-domain-containing adapter-inducing interferon-β (TRIF), TLR3, transforming growth factor-b-activated kinase 1 (TAK1), tumor necrosis factor receptor-associated factor 6 (TRAF6), the transcription factor AP-1, as well as transcription factor nuclear factor (NF-κB)–inhibitory protein IκB-α degradation and phosphorylation. Immunofluorescence assays were used to localize the cellular location of the p65 subunit of NF-κB. RESULTS: Corneal fibroblasts exposed to polyI:C demonstrated decreased VCAM-1, ICAM-1, MCP-1, IL-6, and IL-8 expression levels upon exposure to LUT in a time-dependent and concentration-dependent manner. LUT was observed to suppress polyI:C-triggered expression of TLR3, the translocation of NF-κB p65 into cell nuclei, as well as the phosphorylation of TAK, c-Jun, and IκB-α, while no impact on the expression levels of TRIF and TRAF6 were observed. CONCLUSION: LUT suppress the expression of proinflammatory adhesion molecules, chemokines, and cytokines in polyI:C exposed HCFs. These effects are likely mediated through TAK/NF-κB signal attenuation. Therefore, LUT is a candidate molecule that can prevent the TLR3-mediated inflammation response associated with corneal viral infection.

Indoleamine 2,3-dioxygenase adjusts neutrophils recruitment and chemotaxis in Aspergillus fumigatus keratitis

Shu-Xuan Guo, Nan Jiang, Li Zhang, Wei Jiang and Jing-Jing Ma — 2022/3/1 14:57:53
AIM: To explore the effect of indoleamine 2,3-dioxygenase (IDO) on recruitment and chemotaxis function of neutrophils in Aspergillus fumigatus (A. fumigatus) keratitis. METHODS: C57BL/6 mice models of A. fumigatus keratitis were established by inoculating hyphae of A. fumigatus evenly on the corneas. The clinical scores and inflammatory cytokines expression were measured respectively on the 1st, 3rd, 5th day after infection. The 1-MT (1 mg/mL) was administered by gavage to exert an inhibitory effect on IDO during infection. The mice were divided into control group, 1-MT group, A. fumigatus (A.F.) group, and 1-MT+A.F. groups. The corneas were monitored by slit lamp microscopy, and recorded disease scores in 3d after infection. Myeloperoxidase (MPO) assay was done to evaluate the neutrophils infiltration. Immunofluorescence staining was used to detect the recruitment of neutrophils in murine corneas. The mRNA of inflammatory cytokines was measured with reverse transcription-polymerase chain reaction (RT-PCR). RESULTS: The corneal inflammation and the clinical score reached the peak on the 3rd day after the corneal infection. The mRNA of inflammatory cytokines of the A.F. group reached the highest on the 3rd day after the infection accordingly. Meanwhile, the results of slit light photography indicated that inhibitors of IDO made inflammation more serious contrasted with the A.F. group on the 3rd day. Besides, imunofluorescence staining and MPO indicated that 1-MT enhanced the recruitment, infiltration and chemotaxis of neutrophils obviously in contrast to the A.F. group. RT-PCR indicated that 1-MT increased the expression of CXCL-1, ICAM-1, IL-1β, and IL-8 significantly. CONCLUSION: IDO participates in the pathogenesis of A. fumigatus keratitis and plays an important role in inducing immune protection by inhibiting neutrophils-related inflammatory reaction and suppressing recruitment and chemotaxis of the neutrophils.

Extracellular matrix gene expression in human trabecular meshwork cells following mechanical fluid flow stimulation

2022/3/1 14:57:53
AIM: To investigate changes in extracellular matrix (ECM) gene expression in human trabecular meshwork (HTM) cells in response to mechanical fluid flow stimulation. METHODS: HTM cells were grown on a glass plate coated with 0.02% type I collagen (COL) and exposed to shear stress (0, 0.2, 1.0 dyne/cm2) for 12h. Changes in genes related to the ECM were evaluated by real-time reverse transcriptase-polymerase chain reaction. Phosphorylation of Smad2 protein was investigated by Western blotting. RESULTS: After mechanical stimulation, COL type 4 alpha 2, COL type 6 alpha 1, and fibronectin-1 mRNA were significantly higher than the static control (P<0.05, <0.05, and <0.01, respectively). The metalloproteinase-2 and plasminogen activator inhibitor-1 mRNA were significantly higher than the static control (P<0.05 and <0.01, respectively), while the differences in the tissue inhibitors of metalloproteinases-2 mRNA were not significant. The phosphorylation of Smad2 levels was significantly higher compared to the static control cells. CONCLUSION: Changes in the expressions of genes associated ECM metabolism result in HTM cells after mechanical stimulation. The mechanical stimulation of the aqueous humor to the trabecular meshwork may promote ECM turnover and contribute to intraocular pressure homeostasis.

Resveratrol prevents hypoxia-induced retinal ganglion cell death related with ErbB2

2022/3/1 14:57:54
AIM: To confirm the changes in proteins related with hypoxia-induced retinal cell death and to assess the effects of resveratrol (Res). METHODS: The therapeutic effect of Res was verified using an ischemic/reperfusion (I/R) model in vivo and a hypoxia modelin retinal ganglion cells (RGCs) in vitro. Death of RGCs were confirmed by TUNEL assay. Protein expression was confirmed by Western blotting and immunohistochemistry. In addition, flow cytometric analysis was used to confirm the response in the cell unit to obtain more accurate data. RESULTS: ErbB2 expression and apoptosis in the ganglion cell layer (GCL) increased after I/R injury. Treatment of Res rescued I/R-induced ganglion cell death, downregulated apoptosis and ErbB2 protein expression in the retina. In subsequent in vitro models, Res affects apoptosis by regulating the phosphorylation and expression of mouse double minute 2 homolog (MDM2), along with those of ErbB2. These results suggest that Res reverses GCL-specific apoptosis via downregulation of ErbB2 in ischemic injury. CONCLUSION: In light of Res favorable properties, it should be evaluated in the treatment of RGC death and related retinal disease characterized by ErbB2 and MDM2 expression. Therefore, Res is appropriate therapeutic agent for treating ischemic injury-related eye diseases by targeting the expression of ErbB2 and MDM2.

Inhibitory effect on subretinal fibrosis by anti-placental growth factor treatment in a laser-induced choroidal neovascularization model in mice

2022/1/26 9:59:36
AIM: To investigate whether anti-placental growth factor (PGF) can inhibit subretinal fibrosis and whether this effect is mediated by the inhibitory effect of PGF on epithelial-mesenchymal transition (EMT) of retinal pigment epithelial (RPE) cells. METHODS: Subretinal fibrosis model was established in laser induced choroidal neovascularization (CNV) mice on day 21 after laser photocoagulation. Immunofluorescence staining (IFS) of cryosections and enzyme-linked immunosorbent assay (ELISA) were used to detect the expression of PGF. IFS of whole choroidal flat-mounts was used to detect the degree of subretinal fibrosis. IFS of cryosections and ELISA were used to detect the expression of EMT related indicators in subretinal fibrosis lesions. RESULTS: The expression of PGF protein in subretinal fibrosis lesions was significantly up-regulated (P&#x003C;0.05), and mainly co-stained with pan-cytokeratin labeled RPE cells. Intravitreal injection of anti-PGF neutralizing antibody reduced the area of subretinal fibrosis and the ratio of fibrotic/angiogenic area significantly at the concentrations of 0.25, 0.5, 1.0, and 2.0 μg/μL (all P&#x003C;0.05). The expression of E-cadherin in the local RPE cells decreased, while α-SMA increased significantly in subretinal fibrosis lesions, and the application of anti-PGF neutralizing antibody could reverse these changes (P&#x003C;0.05). CONCLUSION: The expression of PGF is up-regulated in the lesion site of subretinal fibrosis and mainly expressed in RPE cells. Intravitreal injection of anti-PGF neutralizing antibody can significantly inhibit the degree of subretinal fibrosis in CNV mice, and this effect may be mediated by the inhibition of PGF on EMT of RPE cells.

Artesunate inhibits proliferation and migration of RPE cells and TGF-β2 mediated epithelial mesenchymal transition by suppressing PI3K/AKT pathway

2022/1/26 9:59:36
AIM: To study the braking effectiveness of artesunate on transforming growth factor (TGF)-β2 mediated epithelial-mesenchymal transition (EMT) in retinal pigment epithelium (RPE) in vitro. METHODS: The fostered ARPE-19 cells were processed with artesunate alone or combined with the TGF-β2. The CCK-8 examination was utilized to test the cell propagation. Cell migration was detected by scratch as well as the Transwell examination. The EMT characters and activation of PI3K/Akt signal channel were estimated by Western blotting and immunofluorescence. The Western blotting was utilized in order to confirm the vitreous of controls as well as patients with proliferative vitreoretinopathy (PVR) were collected and the levels of PI3K, phospho-PI3K, Akt. RESULTS: Disposal of ARPE-19 cells with artesunate (50-150 μmol/L) obviously suppressed their propagation and immigration, which dependent on the concentration and time. Artesunate suppressed the EMT which was induced by TGF-β2 in ARPE-19 cells through sustaining the expression of vimentin and α-SMA through the suppression of PI3K, phospho-PI3K, phospho-Akt and Akt. Levels of PI3K, phospho-PI3K, AKT and phospho-Akt was increased in the vitreous in PVR (P&#x003C;0.05). CONCLUSION: Such findings indicate that PI3K/Akt signal channel is highly activated in vitreous of PVR. Artesuante is an operative depressor of the propagation, immigration and TGF-β2-mediated EMT of ARPE-19 cells by reduced the expression of PI3K/Akt channel.

Novel mutations in the BEST1 gene cause distinct retinopathies in two Chinese families

2022/1/26 9:59:36
AIM: To describe the clinical heterogeneity of patients with novel mutations in BEST1. METHODS: All the members in the two Chinese families underwent detailed clinical evaluations including best-corrected visual acuity, slit-lamp examination, applanation tonometry, and dilated fundus examination. Fundus autofluorescence, fundus fluorescein angiography, spectral-domain optical coherence tomography, electrooculography, and electroretinogram were also performed. Genomic DNA was extracted from venous blood for all the participants. The targeted next-generation sequencing of inherited retinal disease-associated genes was conducted to identify the causative mutation. RESULTS: A novel BEST1 missense mutation c.41T&#x003E;C (p.Leu14Ser) was identified in Family 1. It was co-segregated with the phenotype of best vitelliform macular dystrophy (BVMD) and bioinformatics analysis confirmed it was harmful. Another novel BEST1 frameshift mutation c.345_346insGGCAAGGACG (p.Glu119Glyfs*116) and a novel USH2A missense mutation c.12560G&#x003E;A, p.Arg4187His were identified in family 2 with retinitis pigmentosa (RP), which might interact and lead to the phenotype of RP. CONCLUSION: Two novel mutations in the BEST1 gene in two unrelated families with distinct phenotypes and BEST1 mutation accompanied with USH2A mutation would result in RP, which could be enormously helpful in understanding the pathogenesis of the inherited retinal disease caused by a BEST1 mutation.

Frequency cumulative effect of subthreshold energy laser-activated remote phosphors irradiation on visual function in guinea pigs

2022/1/26 9:59:37
AIM: To explore the effects of laser-activated remote phosphors (LARP) on visual function in guinea pigs. METHODS: Electroretinogram (ERG) of guinea pigs were observed after LARP irradiation at different frequencies and irradiation times. We evaluated the expression of rhodopsin, β-catenin, connexin36, calretinin, and calbindin in the retina of guinea pigs and measured the density of photoreceptor cells after high-frequency LARP irradiation. RESULTS: After LARP irradiation, the ERG results showed that the amplitude of the dark-adapted 3.0 b-wave of the model eye was lower than that of the control eye after high-frequency irradiation (P&#x003C;0.05). The expression of rhodopsin, β-catenin, connexin36, calretinin, and calbindin in the retina of guinea pig declined. CONCLUSION: There is frequency cumulative damage effect on the retina that relates to LARP illumination frequency. This has significance for staff visual protection policies under LARP lighting conditions.

Effect of miR-184 and miR-205 on the tumorigenesis of conjunctival mucosa associated lymphoid tissue lymphoma through regulating RasL10B and TNFAIP8

Yu-Zhen Li, Pei Mou, Ya Shen, Lian-Di Gao, Xin-Xin Chen and Rui-Li Wei — 2021/12/24 0:00:00
AIM: To explore the effect of miR-184 and miR-205 on the proliferation and metastasis of conjunctival mucosa associated lymphoid tissue (MALT) lymphoma. METHODS: Tissue of tumor and adjacent normal control from 5 patients with conjunctival MALT was included. RPMI8226 cell line was selected to verify the effect of miRNAs in B cells. The function of microRNA on the RPMI8226 cell apoptosis, migration and invasion was evaluated by apoptosis assay and Transwell assay. The mRNA and protein expression were examined by quantitative RT-PCR and Western blotting. The effect of microRNA on regulation of downstream gene expression was evaluated by luciferase report assay. RESULTS: A decreased level of miR-184 and miR-205 was observed in MALT lymphoma tissue. Exogenous miR-184 and miR-205 analogues promoted apoptosis, and inhibited the survival, migration, and invasion of RPMI8226 cells. miR-184 and miR-205 inhibitor reversed the process. The RNA and protein level of RasL10B and TNFAIP8 were downregulated in MALT lymphoma tissue. The exogenous of miR-184 and miR-205 promoted the expression of RasL10B and TNFAIP8. Meanwhile, inhibition of miR-184 and miR-205 repressed the expression of target gene, RasL10B and TNFAIP8. CONCLUSION: miR-184 and miR-205 suppresses the tumorigenesis of conjunctival MALT lymphoma through regulating RasL10B and TNFAIP8.

Effect of nano-selenium loaded with lycium barbarum polysaccharide on the proliferation of lens epithelial cells after UVB damage in vitro

2021/12/24 0:00:00
AIM: To investigate the effect of nano-selenium loaded with different concentrations of lycium barbarum polysaccharide (LBP-SeNPs) on the proliferation of human lens epithelial cells (HLECs) from UV irradiation. METHODS: LBP-SeNPs were prepared and their particle size was detected. HLECs (SRA01/04) were irradiated with UVB for different time (0, 10, 20, 30, 40, 50, 60min) to construct a damaged model, the survival rate of cells was determined by methylthiazol tetrazolium (MTT) assay. The 4’,6-Diamidine-2’-phenylindole dihydrochloride (DAPI) staining was used to observe the status of cell nucleus and drug entering cytoplasm through cell membrane in SRA01/04 cells after adding LBP-SENPS loaded with coumarin fluorescence agent 24h under fluorescence microscope. SRA01/04 normal and UVB-damaged cells were treated with different amounts of LBP-SeNPs at different concentrations, cells proliferation were observed. RESULTS: The particle size of LBP-SeNPs was stable in the range of 150-200 nm. The survival rate changes with time after UVB irradiation were statistically significant. The 10min of UVB exposure as the time was chosen to construct the cell damage model. With DAPI staining, LBP-SeNPs were observed to enter the cytoplasm through the cell membrane under fluorescence inverted microscope. Cytotoxicity of SRA01/04 at different concentrations of LBP-SeNPs were measured. Cell survival rate was statistically different compared with the control group. The higher the loading concentration of LBP in nano-Se drugs was, the higher the cell proliferation rate was (P<0.05). The lower the concentration of LBP-SeNPs, the higher the cell proliferation rate, showing a negative growth trend (P<0.05). The group with the highest average cell proliferation rate was 0.5 μmol/L 2.0 mg/mL LBP-SeNPs (128.80%). When the 2.0 mg/mL LBP-SeNPs group was selected for cell photography, the cell density was higher at 0.5 μmol/L. With the increase of concentration, SRA01/04 cells appeared more cytoplasm dehydration, cell shrinkage and apoptotic bodies, and cell density decreased. CONCLUSION: LBP-SeNPs has moderate particle size and good stability. LBP-SeNPs can protect HLECs (SRA01/04) from UVB-induced damage, and the cell proliferation rate is further increased with increasing the amount of loaded LBP and decreasing nano-selenium concentration.

Characterization and validation of a chronic retinal neovascularization rabbit model by evaluating the efficacy of anti-angiogenic and anti-inflammatory drugs

Sandeep Kumar, John Quach, Nicholas Cook, Glenwood Gum and Vatsala Naageshwaran — 2021/12/24 0:00:00
AIM: To establish a rabbit model with chronic condition of retinal neovascularization (RNV) induced by intravitreal (IVT) injection of DL-2-aminoadipic acid (DL-AAA), a retinal glial (Müller) cell toxin, extensive characterization of DL-AAA induced angiographic features and the suitability of the model to evaluate anti-angiogenic and anti-inflammatory therapies for ocular vascular diseases. METHODS: DL-AAA (80 mmol/L) was administered IVT into both eyes of Dutch Belted rabbit. Post DL-AAA delivery, clinical ophthalmic examinations were performed weekly following modified McDonald-Shadduck Scoring System. Color fundus photography, fluorescein angiography (FA), and optical coherence tomography (OCT) procedures were performed every 2 or 4wk until stable retinal vascular leakage was observed. Once stable retinal leakage (12wk post DL-AAA administration) was established, anti-vascular endothelial growth factor (VEGF) (bevacizumab, ranibizumab and aflibercept) and anti-inflammatory (triamcinolone, TAA) drugs were tested for their efficacy after IVT administration. Fluorescein angiograms were scored before and after treatment following a novel grading system, developed for the DL-AAA rabbit model. RESULTS: Post DL-AAA administration, eyes were presented with moderate to severe retinal/choroidal inflammation which was accompanied by intense vitreous flare and presence of inflammatory cells in the vitreous humor. Retinal hemorrhage was restricted to the tips of neo-retinal vessels. FA revealed maximum retinal vascular leakage at 2wk after DL-AAA injection and then persisted as evidenced by stable mean FA scores in weeks 8 and 12. Retinal vascular angiographic and tomographic features were stable and consistent up to 36mo among two different staggers induced for RNV at two different occasions. Day 7, mean FA scores showed that 1 μg/eye of bevacizumab, ranibizumab, aflibercept and 2 μg/eye of TAA suppress 65%, 90%, 100% and 50% retinal vascular leakage, respectively. Day 30, bevacizumab and TAA continued to show 66% and 44% suppression while ranibizumab effect was becoming less effective (68%). In contrast, aflibercept was still able to fully (100%) suppress vascular leakage on day 30. On day 60, bevacizumab, ranibizumab and TAA showed suppression of 7%, 12%, and 9% retinal vascular leakage, respectively, however, aflibercept continued to be more effective showing 50% suppression of vascular leakage. CONCLUSION: The DL-AAA rabbit model mimics RNV angiographic features like RNV and chronic retinal leakage. Based on these features the DL-AAA rabbit model provides an invaluable tool that could be used to test the therapeutic efficacy and duration of action of novel anti-angiogenic formulations, alone or in combination with anti-inflammatory compounds.

Effects of Lycium barbarum polysaccharide on the photoinduced autophagy of retinal pigment epithelium cells

Yuan-Yuan Gao, Juan Li, Jie Huang, Wu-Jun Li and Yang Yu — 2021/12/24 0:00:00
AIM: To investigate the relationship between autophagy and apoptosis in photoinduced injuries in retinal pigment epithelium (RPE) cells and how Lycium barbarum polysaccharide (LBP) contributes to the increased of RPE cells to photoinduced autophagy. METHODS: In vitro cultures of human RPE strains (ARPE-19) were prepared and randomly divided into the blank control, model, low-dose LBP, middle-dose LBP, high-dose LBP, and 3-methyladenine (3MA) groups. The viability of the RPE cells and apoptosis levels in each group were tested through cell counting kit-8 (CCK8) method with a flow cytometer (Annexin V/PI double staining technique). The expression levels of LC3II, LC3I, and P62 proteins were detected with the immunofluorescence method. The expression levels of beclin1, LC3, P62, PI3K, P-mTOR, mTOR, P-Akt, and Akt proteins were tested through Western blot. RESULTS: LBP considerably strengthens cell viability and inhibits the apoptosis of RPE cells after photoinduction. The PI3K/Akt/mTOR signal pathway is activated because of the upregulation of the phosphorylation levels of Akt and mTOR proteins, and thus autophagy is inhibited. CONCLUSION: LBP can inhibit the excessive autophagy in RPE cells by activating the PI3K/Akt/mTOR signaling pathways and thereby protect RPE cells from photoinduced injuries.

Heparanase-1 is downregulated in chemoradiotherapy orbital rhabdomyosarcoma and relates with tumor growth as well as angiogenesis

Wei-Qiang Tang, Yan Hei and Jing Lin — 2021/12/24 0:00:00
AIM: To determine the role of heparanase-1 (HPSE-1) in orbital rhabdomyosarcoma (RMS), and to investigate the feasibility of HPSE-1 targeted therapy for RMS. METHODS: Immunohistochemistry was performed to analyze HPSE-1 expression in 51 cases of orbital RMS patients (including 28 cases of embryonal RMS and 23 cases of alveolar RMS), among whom there were 27 treated and 24 untreated with preoperative chemoradiotherapy. In vitro, studies were conducted to examine the effect of HPSE-1 silencing on RMS cell proliferation and tube formation of human umbilical vein endothelial cells (HUVECs). RD cells (an RMS cell line) and HUVECs were infected with HPSE-1 shRNA lentivirus at a multiplicity of infection (MOI) of 10 and 30 separately. Real-time PCR and Western blot were applied to detect the mRNA and protein expression levels of HPSE-1. Cell viability of treated or control RD cells was evaluated by cell counting kit-8 (CCK-8) assay. Matrigel tube formation assay was used to evaluate the effect of HPSE-1 RNAi on the tube formation of HUVECs. RESULTS: Immunohistochemistry showed that the expression rate of HPSE-1 protein was 92.9% in orbital embryonal RMS and 91.3% in orbital alveolar RMS. Tissue from alveolar orbital RMS did not show relatively stronger staining than that from the embryonal orbital RMS. However, despite the types of RMS, comparing the cases treated chemoradiotherapy with those untreated, we have observed that chemoradiotherapy resulted in weaker staining in patients’ tissues. The expression levels of HPSE-1 declined significantly in both the mRNA and protein levels in HPSE-1 shRNA transfected RD cells. The CCK-8 assay showed that lentivirus-mediated HPSE-1 silencing resulted in significantly reduced RD cells viability in vitro. Silencing HPSE-1 expression also inhibited VEGF-induced tube formation of HUVECs in Matrigel. CONCLUSION: HPSE-1 silencing may be a promising therapy for the inhibition of orbital RMS progression.

Clinical utility of cytokine analysis in the diagnosis and efficacy monitoring of vitreoretinal lymphoma

Hao Kang and Yong Tao — 2022/11/22 10:48:17
AIM: To investigate the value of cytokine analysis in aqueous humor (AH) for discriminating vitreoretinal lymphoma (VRL) from uveitis and for evaluating the efficacy of intravitreal methotrexate (MTX) injections. METHODS: This retrospective study was done on 28 VRL patients between 2013 and 2019. AH interleukin (IL)-10, IL-6, IL-8, vascular endothelial growth factor (VEGF), and vascular cell adhesion molecules (VCAM) were measured in 28 VRL patients and 38 uveitis patients. As to the respective examinations for distinguishing VRL from uveitis, the diagnostic accuracy was evaluated by receiver operating characteristic (ROC) curve analysis. The response to treatment was monitored by observing changes in best-corrected visual acuity (BCVA), ocular manifestation, and AH cytokine levels in 21 patients with VRL who had undergo multiple intravitreal injections of MTX. RESULTS: Compared with uveitis patients, VRL patients had higher IL-10 level (P<0.001) and IL-10/IL-6 ratio (P<0.001), whereas patients with uveitis had significantly higher IL-6 level than those with VRL (P=0.003). An ROC analysis was used to identify the diagnostic threshold values for VRL, and it was found that optimal sensitivity and specificity improved to 94.1% and 100%, respectively, for IL-10/IL-6>1.55 and 88.2% and 81.1%, respectively, for IL-10>76.7 pg/mL. In 21 patients who had undergo repeated injections, improvements in BCVA, clinical remission of VRL and continuous decrease in cytokine levels over time were observed. In those patients, the BCVA correlated with the aqueous levels of IL-10 and IL-6 during the course of disease treatment. CONCLUSION: The combination of the aqueous cytokine profiles can be instrumental for conventional diagnostic methods and for progression monitoring and treatment response.

Anti-inflammatory effects of α-humulene and β-caryophyllene on pterygium fibroblasts

2022/11/22 10:48:17
AIM: To investigate the anti-inflammatory effects of the sesquiterpenes α-humulene and β-caryophyllene on pterygium fibroblasts. METHODS: Primary cultures of pterygium fibroblasts were established. Third passage pterygium fibroblasts were exposed to α-humulene and β-caryophyllene separately and together. The cell viability was assessed by 3- (4,5-dimethylthiazolyl-2) -2,5-diphenyltetrazolium bromide (MTT) assay at 12, 24, 48, and 72h after exposure. The levels of the inflammatory cytokines interleukin (IL)-1β, IL-6, IL-8, tumor necrosis factor (TNF)-α and IL-10 in the conditioned culture medium were assessed by enzyme-linked immunosorbent assay (ELISA) at 12, 24 and 48h after exposure. Data were statistically analyzed using Friedman repeated measures analysis of variances on ranks. RESULTS: The 25 μmol/L β-caryophyllene induced significant decrease in the IL-6 production by pterygium fibroblasts 48h after the exposure (P=0.041). The levels of IL-1β, IL-8, IL-10, and TNF-α were very low and had no statistically significant variations after exposure to α-humulene, β-caryophyllene, or both compounds together. CONCLUSION: The exposure to 25 μmol/L of β-caryophyllene significantly reduce the production of IL-6 by pterygium fibroblasts after 48h. This sesquiterpene may be a potential alternative adjuvant agent for the treatment of pterygium.

Establishment of blood glucose control model in diabetic mice

Cai-Hua Rao, Lun Liu, Jian Gao, Zi-Hao Du and Chen Gao — 2022/11/22 10:48:17
AIM: To explore the established method of the diabetic mouse blood glucose control model and preliminary observation of its influence on the retinas of diabetic mice. METHODS: The db/db BKS-DB (Leprko/ko) mice were randomly divided into two groups: the poor blood glucose control group (PG group, n=18) and the stable blood glucose control group (SG group, n=12), with BKS-DB (Leprwt/wt) as the normal blood glucose control group (NG group, n=18). According to the blood glucose values for 5 intervals which were monitored during the period of adaption, the PG group was injected with insulin aspart twice daily, fasted for 2h and then returned to normal. The SG group was injected with insulin aspart twice and insulin glargine once daily and fed with a quantitative ration. Fundus images were collected after eight weeks. The glycosylated hemoglobin (HbA1c), mean blood glucose level (MBG), standard deviation of blood glucose (SDBG), coefficient of variation of blood glucose (CVBG), and mean amplitude of glycemic excursion (MAGE) in each group were examined and calculated. RESULTS: The HbA1c, MBG, SDBG, CVBG, and MAGE levels in the PG group were significantly higher than those in the NG and SG groups (all P<0.05). MBG, SDBG, CVBG, and MAGE levels in the SG group were higher than those in the NG group (all P<0.05). There was no significant difference in HbA1c levels between the NG and SG groups (P>0.05). Preliminary observation of fundus images in the PG group and SG groups showed scattered retinal bleeding spots, while bleeding was more obvious in the PG group. CONCLUSION: The blood glucose control model of type 2 diabetes mellitus mice can be successfully established by subcutaneous injection of insulin aspart insulin glargine and rationed food, which is valuable for studying the mechanism of blood glucose fluctuations in diabetic complications in vivo.

Various phenotypes of autosomal dominant cone-rod dystrophy with cone-rod homeobox mutation in two Chinese families

2022/11/22 10:48:17
AIM: To present the clinical manifestations of 5 autosomal dominant cone-rod dystrophy (adCORD) patients from two Chinese families with cone-rod homeobox (CRX) mutation (p.R41W), and to explore the clinical heterogeneity of adCORD with CRX mutation (p.R41W). METHODS: Interrogation and ophthalmological examinations were undertaken in all patients and unaffected members. Analysis of clinical features was performed by visual acuity, slit lamp examination, visual field examination, fundoscopy, autofluorescence and spectral domain optical coherence tomography. Targeted next-generation sequencing was applied as a useful tool to identify the causative mutation of CORD genes. RESULTS: A CRX missense mutation c.121C>T was identified in all patients, resulting in an amino acid change from arginine acid to tryptophan (p.R41W). The patients presented with early onset, progressive and different severities with CORD. CONCLUSION: This is the first report of the clinical phenotype of CRX mutation (p.R41W) in Chinese families, and the mutation can lead to a wide range of various retinal phenotypes.

Comprehensive assessment of growth factors, inflammatory mediators, and cytokines in vitreous from patients with proliferative diabetic retinopathy

Qiao-Yun Gong, Guang-Yi Hu, Su-Qin Yu, Tian-Wei Qian and Xun Xu — 2022/10/25 14:09:31
AIM: To assess alterations in growth factors, inflammatory mediators, and cytokines associated with vitreous-retinal diseases in vitreous humor from patients with proliferative diabetic retinopathy (PDR), and to identify potential new treatment targets and strategies. METHODS: Control vitreous samples were collected from patients with macular hole, epiretinal membranes, or rhegmatogenous retinal detachments, and PDR samples from patients with complications of PDR, who required pars plana vitrectomy. Specimens were stored at −80℃ and then investigated by Luminex multi-factor assay. Parametric and nonparametric analyses of demographic characteristics and cytokine expression levels were conducted using SPSS. RESULTS: There were no significant differences in demographic characteristics between patients with and without PDR. Expression levels of growth factors [platelet-derived growth factor (PDGF)-AA, glial cell line-derived neurotrophic factor (GDNF), and vascular endothelial growth factor A (VEGFA)], inflammatory mediators [interleukin (IL)-8, IL-11, and tumor necrosis factor-α (TNF-α)] and cytokines [chemokine C-X-C ligand (CXCL)10, interferon-γ (IFN-γ), and granulocyte macrophage-colony stimulating factor (GM-CSF)] were significantly elevated in vitreous humor from patients with PDR compared with those in the control group (all P<0.05). Further, VEGFA levels were lower in patients with PDR treated with anti-VEGF injection than those who were not (P<0.05), and there was no difference between the PDR group treated with anti-VEGF and controls (P>0.05). CONCLUSION: This proof-of-concept study demonstrates the potential for combinational therapeutic strategies to ameliorate diabetic retinopathy progression by targeting growth factors, inflammatory factors, and cytokines, in addition to VEGFA.

A Trojan horse biomimetic delivery system using mesenchymal stem cells for HIF-1α siRNA-loaded nanoparticles on retinal pigment epithelial cells under hypoxia environment

2022/10/25 14:09:31
AIM: To demonstrate the feasibility of mesenchymal stem cell (MSC)-mediated nano drug delivery, which was characterized by the “Trojan horse”-like transport of hypoxia-inducible factor-1α small interfering RNA (HIF-1α siRNA) between MSCs and retinal pigment epithelial cells (RPE) under hypoxia environment. METHODS: Plasmid and lentivirus targeting the human HIF-1α gene were designed and constructed. HIF-1α siRNA was encapsulated into poly(lactic-co-glycolic acid) nanoparticles (PLGA-NPs) through the water-in-oil-in-water (w/o/w) multiple emulsion technique. The effect of PLGA-NPs uptake on the expression of HIF-1α mRNA was tested in RPE cells by real-time quantitative polymerase chain reaction (qPCR) and additional transfected conditions were used as control, including lentivirus group, nude plasmid group and blank PLGA group. MSCs were transfected with the NPs and the transfection efficacy was evaluated by flow cytometry. Transwell co-culture system of transfected MSCs and RPE cells was constructed under hypoxia environment. The effects of MSC-loaded HIF-1α siRNA PLGA-NPs on proliferation, apoptosis, and migration of RPE cells were then evaluated. The effect of transfected MSCs on HIF-1α expression of RPE cells was analyzed by using qPCR at the time points 24h, 3d, and 7d. RESULTS: The average diameter of PLGA-NPs loaded with HIF siRNA was 314.1 nm and the zeta potential was -0.36 mV. The transfection efficiency of PLGA-NPs was 67.3%±5.2% into MSCs by using flow cytometry. Compared with the lentivirus group, the PLGA-NPs loaded with HIF-1α siRNA can effectively reduce the expression of HIF-1α mRNA up to 7d in RPE (0.63±0.05 at 7d, P<0.001). In the Transwell co-culture system of transfected MSCs and RPE, the abilities of proliferation (2.34±0.17, 2.40±0.28, 2.47±0.24 at 48h, F=0.23, P=0.80), apoptosis (14.83%±2.43%, 12.94%±2.19%, 12.39%±3.21%; F=0.70, P=0.53) and migration (124.5±7.78, 119.5±5.32, 130±9.89, F=1.33, P=0.33) of the RPE cells had no differences between MSC-loaded HIF-1α siRNA PLGA-NPs and other groups. The inhibition of PLGA on the HIF-1α mRNA expression in RPE cells could continue until the 7th day, the level of HIF-1α mRNA was lower than that of other groups (F=171.98, P<0.001). CONCLUSION: The delivery of PLGA-NPs loaded with HIF-1α siRNA carried by MSCs is found to be beneficial temporally for HIF-1α mRNA inhibition in RPE cells under hypoxia environment. The MSC-based bio-mimetic delivery of HIF-1α siRNA nanoparticles is a potential method for therapy against choroidal neovascularization.

Association of CFH and MAP1LC3B gene polymorphisms with age-related macular degeneration in a high-altitude population

2022/10/25 0:00:00
AIM: To evaluate the association of complement factor H (CFH) and microtubule-associated protein 1 light chain 3 beta (MAP1LC3B) gene polymorphisms with the risk of age-related macular degeneration (AMD) in a high-altitude population. METHODS: The study group consisted of 172 participants with symptoms of AMD who were examined and diagnosed between January 2019 and June 2020. The control group was composed of 120 healthy individuals. Each participant was required to provide two milliliters of peripheral blood for DNA extraction. Two single nucleotide polymorphisms (SNPs) of CFH (rs1061170 and rs800292) and two SNPs of MAP1LC3B (rs8044820 and rs9903) were genotyped. The genotypes and allele frequencies of the SNPs in the study and control groups were further compared using Chi-square and Fisher’s exact tests. RESULTS: In a high-altitude population, the nominally significant differences of rs800292 and rs9903’s genotype AG frequencies were observed in the AMD group (P=0.034 and 0.004, respectively). The frequencies of allele G of rs800292 and allele A of rs9903 were also significantly different in the AMD group compared to the control [(P=0.034, OR=0.70, 95%CI: 0.50-0.98) and (P=0.004, OR=1.60, 95%CI: 1.15-2.22), respectively]. No significant differences in the genotype distributions (P=0.16 and 0.40, respectively) and allele frequencies (P>0.05) of rs1061170 and rs8044820 were observed in the AMD group. CONCLUSION: Genotype AG of rs800292 may be a protective factor for AMD. Conversely, rs9903 seems to be a risk factor for AMD. Therefore, allele G of rs800292 may be a protective factor, and allele A of rs9903, a risk factor for AMD in Qinghai high-altitude population.

Pharmacological drug screening to inhibit uveal melanoma metastatic cells either via EGF-R, MAPK, mTOR or PI3K

2022/9/21 16:28:47
AIM: To screen five potential pharmacological substances specifically targeting EGF-R, MAPK, mTOR, or PI3K for their antiproliferative effects, possible impact on cell viability, as well as cell death rates on three different uveal melanoma metastasis cell lines in vitro. METHODS: Three different uveal melanoma metastasis cell lines (OMM2.5, OMM2.3, and OMM1), that originated from human hepatic and subcutaneous metastasis, were exposed to inhibitors of different targets: erlotinib (EGF-R), everolimus (mTOR), selumetinib (MAPK), trametinib (MAPK) or the alkylphosphocholine erufosine (PI3K). Cell viability was assessed with a 2,3-bis-(2-methoxy-4-nitro-5-sulfophenyl)-2H-tetrazolium-5-carboxanilide (XTT) dye reduction assay after 24h of treatment. Antiproliferative effects were evaluated separately after a 72-hour incubation of the cells with the pharmacological substance. Subsequently, the IC50 was calculated. Tumor cell death was investigated using a double stain apoptosis detection assay. RESULTS: Selumetinib, trametinib, and erufosine significantly decreased cell viability of all OMM cell lines (P<0.04). In addition, selumetinib and trametinib showed a significant inhibition of cell proliferation (P<0.05). Everolimus and erlotinib solely inhibited cell proliferation at the used concentrations (P<0.05). Besides an increase of necrotic cells after erufosine treatment (P<0.001), no changes in the number of dead cells for the other substances were observed. CONCLUSION: The preliminary drug screening demonstrates five new candidates, successfully targeting the canonical MAPK/ERK and PI3K/AKT/mTOR pathways in uveal melanoma metastasis cells in vitro. Hence, these findings provide an experimental basis to explore future single or combined therapy strategies for metastatic uveal melanoma.

Effect of intravitreal ranibizumab on fibrovascular membranes in patients with proliferative diabetic retinopathy

2022/9/21 16:28:47
AIM: To assess the effects of intravitreal ranibizumab (IVR) on angiogenesis and glial activity of the fibrovascular membrane (FVM) in patients with proliferative diabetic retinopathy (PDR). METHODS: Forty-two eyes from 42 patients with PDR requiring vitrectomy were included and divided into two groups: control group (n=16) did not receive IVR, while IVR group (n=26) underwent IVR 5d before vitrectomy. FVM specimens were collected by the same surgeon during the interventions. Histopathological morphology was examined by hematoxylin-eosin (H-E) staining and cell densities in the FVM was assessed. Microvessels were outlined by immunohistochemical staining of CD31 and microvessel density (MVD) assessed as an index of FVM angiogenesis. Dual-color immunofluorescence staining, and confocal microscopy was used to detect co-localization and relative expression levels of glial fibrillary acidic protein (GFAP) and α-smooth muscle actin (α-SMA) as markers of glial-mesenchymal transition (GMT). The GMT index (GI; ratio of relative GFAP/α-SMA expression) was used to semi-quantify the degree of GMT or glial activity of FVMs. RESULTS: H-E staining showed similar vascularization in both groups, with microvessels and scattered stromal cells in the matrix. Infiltrated cell densities did not differ significantly between the two groups (P>0.05). The MVD of the IVR group (130.62±15.46/mm2) was significantly lower than that of the controls (142.25±19.16/mm2, P<0.05). In both groups, all sections were strongly immunostained for GFAP and α-SMA. The Pearson’s correlation coefficients (PCC) of intensity of automated pixel count of two markers indicated GFAP and α-SMA co-stained well and GMT participated in the remolding of FVMs in PDR. The mean relative GFAP expression in the IVR group was significantly lower, whereas that of α-SMA was significantly higher than in controls (P<0.05). GI in the IVR group (1.10±0.10) was significantly lower than in the controls (1.21±0.12, P<0.05). CONCLUSION: IVR can reduce angiogenesis, glial activity of FVM and promote glial-fibrotic transformation by reducing MVD and promoting GMT but does not decrease the cell density in patients with PDR.

17β-estradiol inhibits TGF-β-induced collagen gel contraction mediated by human Tenon fibroblasts via Smads and MAPK signaling pathways

2023/8/22 11:33:42
AIM: To investigate the impact of 17β-estradiol on the collagen gels contraction (CGC) and inflammation induced by transforming growth factor (TGF)-β in human Tenon fibroblasts (HTFs). METHODS: HTFs were three-dimensionally cultivated in type I collagen-generated gels with or without TGF-β (5 ng/mL), 17β-estradiol (12.5 to 100 µmol/L), or progesterone (12.5 to 100 µmol/L). Then, the collagen gel diameter was determined to assess the contraction, and the development of stress fibers was analyzed using immunofluorescence staining. Immunoblot and gelatin zymography assays were used to analyze matrix metalloproteinases (MMPs) and tissue inhibitors of metalloproteinases (TIMPs) being released into culture supernatants. Enzyme-linked immunosorbent assay (ELISA) and reverse transcription-quantitative polymerase chain reaction (RT-PCR) were used to detect interleukin (IL)-6, monocyte chemoattractant proteins (MCP)-1, and vascular endothelial growth factor (VEGF) in HTFs at the translational and transcriptional levels. The phosphorylation levels of Sma- and Mad-related proteins (Smads), mitogen-activated protein kinases (MAPKs), and protein kinase B (AKT) were measured by immunoblotting. Statistical analysis was performed using either the Tukey-Kramer test or Student's unpaired t-test to compare the various treatments. RESULTS: The CGC caused by TGF-β in HTFs was significantly inhibited by 17β-estradiol (25 to 100 µmol/L), and a statistically significant difference was observed when comparing the normal control group with 17β-estradiol concentrations exceeding 25 µmol/L (P<0.05). The suppressive impact of 17β-estradiol became evident 24h after administration and peaked at 72h (P<0.05), whereas progesterone had no impact. Moreover, 17β-estradiol attenuated the formation of stress fibers, and the production of MMP-3 and MMP-1 in HTFs stimulated by TGF-β. The expression of MCP-1, IL-6, and VEGF mRNA and protein in HTFs were suppressed by 100 µmol/L 17β-estradiol (P<0.01). Additionally, the phosphorylation of Smad2 Smad3, p38, and extracellular signal-regulated kinase (ERK) were downregulated (P <0.01). CONCLUSION: 17β-estradiol significantly inhibits the CGC and inflammation caused by TGF-β in HTFs. This inhibition is likely related to the suppression of stress fibers, inhibition of MMPs, and attenuation of Smads and MAPK (ERK and p38) signaling. 17β-estradiol may have potential clinical benefits in preventing scar development and inflammation in the conjunctiva.

Effect of a novel tyrosine kinase inhibitor nintedanib on bFGF and VEGF concentrations in a rabbit retinal vein occlusion model

Wei Fang, Jing Zhai, Zhen-Bin Qian, Hai-Dong Li, Meng-Di Wang, Li-Jun Shen — 2023/8/22 11:33:42
AIM: To evaluate whether a novel tyrosine kinase inhibitor nintedanib could inhibit basic fibroblast growth factor (bFGF) and vascular endothelial growth factor (VEGF) simultaneously for retinal vascular disease in vivo. METHODS: After a laser induced rabbit retinal vein occlusion (RVO) model was made, 0.5 mg of nintedanib was injected intravitreally in the left eye on the third day while the right eye was as a control. Intracameral samples were taken on the day before laser treatment and days 1, 3, 7, 14, 21, and 28 after treatment. Enzyme-linked immunosorbent assay (ELISA) was used to test the bFGF and VEGF-A concentrations in the aqueous humor. RESULTS: Both bFGF and VEGF-A rose significantly on the third day after laser treatment in both eyes. In the control eye the bFGF concentration peaked on the 14th day while the VEGF-A concentration dropped rapidly soon after the third day. After nintadanib injection in the study eye, both bFGF and VEGF-A showed a significant reduction on the 4th day (7th day after laser treatment) when compared to the control eye, and kept on low level in the following several weeks. CONCLUSION: Intravitreal injection of nintedanib can inhibit the expression of bFGF and VEGF in the process of RVO model to a certain extent, which is expected to become a new method for the treatment of retinal vascular diseases or fibrotic diseases.

Effects of autophagy inhibitor 3-methyladenine on a diabetic mice model

2023/8/22 11:33:42
AIM: To investigate the role of autophagy inhibitor 3-methyladenine (3-MA) on a diabetic mice model (DM) and the potential mechanism. METHODS: Male C57BL/6J mice were randomly divided into a normal control group (NC group) and an DM group. DM were induced by multiple low-dose intraperitoneal injection of streptozotocin (STZ) 60 mg/kg●d for 5 consecutive days. DM mice were randomly subdivided into untreated group (DM group), 3-MA (10 mg/kg●d by gavage) treated group (DM+3-MA group) and chloroquine (CQ; 50 mg/kg by intraperitoneal injection) treated group (DM+CQ group). The fasting blood glucose (FBG) levels were recorded every week. At the end of experiment, retinal samples were collected. The expression levels of pro-apoptotic proteins cleaved caspase-3, cleaved poly ADP-ribose polymerase 1 (PARP1) and Bax, anti-apoptotic protein Bcl-2, fibrosis-associated proteins Fibronectin and type 1 collagen α1 chain (COL1A1), vascular endothelial growth factor (VEGF), inflammatory factors interleukin (IL)-1β and tumor necrosis factor (TNF)-α, as well as autophagy related proteins LC3, Beclin-1 and P62 were determined by Western blotting. The oxidative stress indicators 8-hydroxydeoxyguanosine (8-OHdG) and malondialdehyde (MDA) were detected by commercial kits. RESULTS: Both 3-MA and CQ had short-term hypoglycemic effect on FBG and reduced the expression of VEGF and inflammatory factors IL-1β and TNF-α in DM mice. 3-MA also significantly alleviated oxidative stress indicators 8-OHdG and MDA, decreased the expression of fibrosis-related proteins Fibronectin and COL1A1, pro-apoptotic proteins cleaved caspase-3, cleaved PARP1, as well as the ratio of Bax/Bcl-2. CQ had no significant impact on the oxidative stress indicators, fibrosis, and apoptosis related proteins. The results of Western blotting for autophagy related proteins showed that the ratio of LC3 II/LC3 I and the expression of Beclin-1 in the retina of DM mice were decreased by 3-MA treatment, and the expression of P62 was further increased by CQ treatment. CONCLUSION: 3-MA has anti-apoptotic and anti-fibrotic effects on the retina of DM mice, and can attenuate retinal oxidative stress, VEGF expression and the production of inflammatory factors in the retina of DM mice. The underlying mechanism of the above effects of 3-MA may be related to its inhibition of early autophagy and hypoglycemic effect.

LIN28A attenuates high glucose-induced retinal pigmented epithelium injury through activating SIRT1-dependent autophagy

Dan-Qing Yu, Song-Ping Yu, Jing Wu, Li-Na Lan, Bang-Xun Mao — 2023/8/22 11:33:43
AIM: To evaluate the effects of LIN28A (human) on high glucose-induced retinal pigmented epithelium (RPE) cell injury and its possible mechanism. METHODS: Diabetic retinopathy model was generated following 48h of exposure to 30 mmol/L high glucose (HG) in ARPE-19 cells. Quantitative real-time polymerase chain reaction (qRT-PCR) and Western blot tested the expression of the corresponding genes and proteins. Cell viability as well as apoptosis was determined through cell counting kit-8 (CCK-8) and flow cytometry assays. Immunofluorescence assay was adopted to evaluate autophagy activity. Caspase 3 activity, oxidative stress markers, and cytokines were appraised adopting their commercial kits, respectively. Finally, ARPE-19 cells were preincubated with EX527, a Sirtuin 1 (SIRT1) inhibitor, prior to HG stimulation to validate the regulatory mechanism. RESULTS: LIN28A was downregulated in HG-challenged ARPE-19 cells. LIN28A overexpression greatly inhibited HG-induced ARPE-19 cell viability loss, apoptosis, oxidative damage as well as inflammatory response. Meanwhile, the repressed autophagy and SIRT1 in ARPE-19 cells challenged with HG were elevated after LIN28A overexpression. In addition, treatment of EX527 greatly inhibited the activated autophagy following LIN28A overexpression and partly abolished the protective role of LIN28A against HG-elicited apoptosis, oxidative damage as well as inflammation in ARPE-19 cells. CONCLUSION: LIN28A exerts a protective role against HG-elicited RPE oxidative damage, inflammation, as well as apoptosis via regulating SIRT1/autophagy.

Rabbit models of dry eye disease: comparative analysis

Vytautas Baranauskas, Julija Daukantaite and Saulius Galgauskas — 2023/7/25 10:38:14
AIM: To report ocular changes in rabbits after the implementation of three different induction methods to create dry eye (DE) conditions and provides evidence of DE-related disease evolution. METHODS: Experimental methods were divided into 3 models. The first model used involved triple injection of complete Freund’s adjuvant, 50 µL each, also called the meibomian gland dysfunction (MGD) model. In the second model, DE conditions were created by the resection of nictitating membranes (NM), Harderian glands (HG), and main lacrimal glands (LG), also called the LGR model. The third model involved the topical administration of benzalkonium chloride (BAK) 0.1% solution. The Schirmer test, ocular surface staining with fluorescein, and tear break-up time tests were implemented before and after excision. After euthanasia, the ocular tissues were dissected. Cornea, conjunctiva, and meibomian glands were treated with periodic acid–Schiff (PAS) staining and haematoxylin–eosin staining. RESULTS: The MGD model triggered inflammation of meibomian glands. It detected changes in the lipid layer of the tear film. The bilateral resection of NM, HG, and LG reduced the watering layer of the tear film. The topical administration of BAK of 0.1% solution impacted the mucosal layer of the tear film. CONCLUSION: Different changes are observed with different DE syndrome models. The composition of the tear film differ depending on which part of the eye is targeted. More studies need to be done to confirm whether an increased thickness of the cornea has any impact on the DE disease.

Astragalin attenuates diabetic cataracts via inhibiting aldose reductase activity in rats

Na Wang, Deepika Singh and Qiong Wu — 2023/7/25 10:38:14
AIM: To investigate the aldose reductase (AR) inhibition capacity of astragalin (AST) against streptozoticin-induced diabetic cataracts (DCs) in rats. METHODS: Ex vivo investigations were conducted by treating the lens of a goat placed for 72h in artificial aqueous humor (AAH) of pH 7.8 at room temperature with cataract-causing substance (55 mmol/L of galactose) and in vivo studies were performed on rats via induction with streptozotocin. AST was administered at different dose levels and scrutinize for DC activity. RESULTS: In diabetic rats, AST improved the body weight, blood insulin, and glucose as well as the levels of galactitol in a dose-dependent way, other biochemical parameters i.e. inflammatory mediators and cytokines, and also suppress AR activity. The level of the antioxidant parameters such as superoxide dismutase (SOD), catalase (CAT), and glutathione (GSH) activity were also altered on a diabetic lens after the administration of the AST. CONCLUSION: AST protects against lens opacification to avoid cataracts and polyols formation, indicating that it could be used as a potential therapeutic agent for diabetes.

Evaluation of trabecular meshwork-specific promoters in vitro and in vivo using scAAV2 vectors expressing C3 transferase

2023/7/25 10:38:14
AIM: To evaluate the potential of two trabecular meshwork (TM)-specific promoters, Chitinase 3-like 1 (Ch3L1) and matrix gla protein (MGP), for improving specificity and safety in glaucoma gene therapy based on self-complementary AAV2 (scAAV2) vector technologies. METHODS: An scAAV2 vector with C3 transferase (C3) as the reporter gene (scAAV2-C3) was selected. The scAAV2-C3 vectors were driven by Ch3L1 (scAAV2-Ch3L1-C3), MGP (scAAV2-MGP-C3), enhanced MGP (scAAV2-eMGP-C3) and cytomegalovirus (scAAV2-CMV-C3), respectively. The cultured primary human TM cells were treated with each vector at different multiplicities of infections. Changes in cell morphology were observed by phase contrast microscopy. Actin stress fibers and Rho GTPases/Rho-associated protein kinase pathway-related molecules were assessed by immunofluorescence staining, real-time quantitative polymerase chain reaction and Western blot. Each vector was injected intracamerally into the one eye of each rat at low and high doses respectively. In vivo green fluorescence was visualized by a Micron III Retinal Imaging Microscope. Intraocular pressure (IOP) was monitored using a rebound tonometer. Ocular responses were evaluated by slit-lamp microscopy. Ocular histopathology analysis was examined by hematoxylin and eosin staining. RESULTS: In TM cell culture studies, the vector-mediated C3 expression induced morphologic changes, disruption of actin cytoskeleton and reduction of fibronectin expression in TM cells by inhibiting the Rho GTPases/Rho-associated protein kinase signaling pathway. At the same dose, these changes were significant in TM cells treated with scAAV2-CMV-C3 or scAAV2-Ch3L1-C3, but not in cells treated with scAAV2-eMGP-C3 or scAAV2-MGP-C3. At low-injected dose, the IOP was significantly decreased in the scAAV2-Ch3L1-C3-injected eyes but not in scAAV2-MGP-C3-injected and scAAV2-eMGP-C3-injected eyes. At high-injected dose, significant IOP reduction was observed in the scAAV2-eMGP-C3-injected eyes but not in scAAV2-MGP-C3-injected eyes. Similar to scAAV2-CMV-C3, scAAV2-Ch3L1-C3 vector showed efficient transduction both in the TM and corneal endothelium. In anterior segment tissues of scAAV2-eMGP-C3-injected eyes, no obvious morphological changes were found except for the TM. Inflammation was absent. CONCLUSION: In scAAV2-transduced TM cells, the promoter-driven efficiency of Ch3L1 is close to that of cytomegalovirus, but obviously higher than that of MGP. In the anterior chamber of rat eye, the transgene expression pattern of scAAV2 vector is presumably affected by MGP promoter, but not by Ch3L1 promoter. These findings would provide a useful reference for improvement of specificity and safety in glaucoma gene therapy using scAAV2 vector.

Down-regulation of histone deacetylase 7 reduces biological activities of retinal microvascular endothelial cells under high glucose condition and related mechanism

Jia-Yi Ning, Han-Yi Yang, Ting-Ke Xie, Yi-Xuan Chen and Jing Han — 2023/7/25 10:38:15
AIM: To investigate the expression and effect of histone deacetylase 7 (HDAC7) in human retinal microvascular endothelial cells (HRMECs) under high glucose condition and related mechanism, and the expression of HDAC7 in the retinal tissue in diabetic rats. METHODS: The expression of HDAC7 in HRMECs under high glucose and the retinal tissue from normal or diabetic rats were detected with immunohistochemistry and Western blot. LV-shHDAC7 HRMECs were used to study the effect of HDAC7 on cell activities. Cell count kit-8 (CCK-8), 5-ethynyl-2’-deoxyuridine (EdU), flow cytometry, scratch test, Transwell test and tube formation assay were used to examine the ability of cell proliferation, migration, and angiogenesis. Finally, a preliminary exploration of its mechanism was performed by Western blot. RESULTS: The expression of HDAC7 was both up-regulated in retinal tissues of diabetic rats and high glucose-treated HRMECs. Down-regulation of HDAC7 expression significantly reduced the ability of proliferation, migration, and tube formation, and reversed the high glucose-induced high expression of CDK1/Cyclin B1 and vascular endothelial growth factor in high glucose-treated HRMECs. CONCLUSION: High glucose can up-regulate the expression of HDAC7 in HRMECs. Down-regulation of HDAC7 can inhibit HRMECs activities. HDAC7 is proposed to be involved in pathogenesis of diabetic retinopathy and a therapeutic target.

Identification of hub genes for glaucoma: a study based on bioinformatics analysis and experimental verification

Rui-Ling Xie, Hai-Yan Nie and Yu-Xin Xu — 2023/6/27 16:00:21
AIM: To explore hub genes for glaucoma based on bioinformatics analysis and an experimental model verification. METHODS: In the Gene Expression Omnibus (GEO) database, the GSE25812 and GSE26299 datasets were selected to analyze differentially expressed genes (DEGs) by the GEO2R tool. Through bioinformatics analysis, 9 hub genes were identified. Receiver operating characteristic (ROC) curves and principal component analysis (PCA) were performed to verify whether the hub gene can distinguish glaucoma from normal eyes. The mouse model of glaucoma was constructed, and the real-time reverse transcriptase-polymerase chain reaction (RT-qPCR) assay was performed to detect the expression levels of hub genes in glaucoma. RESULTS: There were 128 overlapping DEGs in the GSE25812 and GSE26299 datasets, mainly involved in intracellular signalling, cell adhesion molecules and the Ras signalling pathway. A total of 9 hub genes were screened out, including GNAL, BGN, ETS2, FCGP4, MAPK10, MMP15, STAT1, TSPAN8, and VCAM1. The area under the curve (AUC) values of 9 hub genes were greater than 0.8. The PC1 axle could provide a 70.5% interpretation rate to distinguish glaucoma from normal eyes. In the ocular tissues of glaucoma in the mice model, the expression of BGN, ETS2, FCGR4, STAT1, TSPAN8, and VCAM1 was increased, while the expression of GNAL, MAPK10, and MMP15 was decreased. CONCLUSION: Nine hub genes in glaucoma are identified, which may provide new biomarkers and therapeutic targets for glaucoma.

Protective effect of ginsenoside Rg1 on 661W cells exposed to oxygen-glucose deprivation/reperfusion via keap1/nrf2 pathway

2023/6/27 16:00:21
AIM: To construct an in vitro model of oxygen-glucose deprivation/reperfusion (OGD/R) induced injury to the optic nerve and to study the oxidative damage mechanism of ischemia-reperfusion (I/R) injury in 661W cells and the protective effect of ginsenoside Rg1. METHODS: The 661W cells were treated with different concentrations of Na2S2O4 to establish OGD/R model in vitro. Apoptosis, intracellular reactive oxygen species (ROS) levels and superoxide dismutase (SOD) levels were measured at different time points during the reperfusion injury process. The injury model was pretreated with graded concentrations of ginsenoside Rg1. Real-time polymerase chain reaction (PCR) was used to measure the expression levels of cytochrome C (cyt C)/B-cell lymphoma-2 (Bcl2)/Bcl2 associated protein X (Bax), heme oxygenase-1 (HO-1), caspase9, nuclear factor erythroid 2-related factor 2 (nrf2), kelch-like ECH-associated protein 1 (keap1) and other genes. Western blot was used to detect the expression of nrf2, phosphorylated nrf2 (pnrf2) and keap1 protein levels. RESULTS: Compared to the untreated group, the cell activity of 661W cells treated with Na2S2O4 for 6 and 8h decreased (P<0.01). Additionally, the ROS content increased and SOD levels decreased significantly (P<0.01). In contrast, treatment with ginsenoside Rg1 reversed the cell viability and SOD levels in comparison to the Na2S2O4 treated group (P<0.01). Moreover, Rg1 reduced the levels of caspase3, caspase9, and cytC, while increasing the Bcl2/Bax level. These differences were all statistically significant (P<0.05). Western blot analysis showed no significant difference in the protein expression levels of keap1 and nrf2 with Rg1 treatment, however, Rg1 significantly increased the ratio of pnrf2/nrf2 protein expression compared to the Na2S2O4 treated group (P<0.001). CONCLUSION: The OGD/R process is induced in 661W cells using Na2S2O4. Rg1 inhibits OGD/R-induced oxidative damage and alleviates the extent of apoptosis in 661W cells through the keap1/nrf2 pathway. These results suggest a potential protective effect of Rg1 against retinal I/R injury.

Effects of endogenous dopamine induced by low concentration atropine eye drops on choroidal neovascularization in high myopia mice

Yan-Yan Ji, Shi-Xi Zhang, Ye Kang and Song Chen — 2023/6/27 16:00:21
AIM: To evaluate effects of endogenous dopamine induced by low concentration atropine eye drops on choroidal neovascularization (CNV) in high myopia mice. METHODS: The C57BL/6J mice were deprived of the right eye for 4wk, and the high myopia was diagnosed by optometry, the diopter was less than -6.00 D, and CNV was induced by 532 nm laser. The changes of dopamine D1 receptor (DRD1), dopamine D2 receptor (DRD2), and vascular endothelial growth factor A (VEGFA) were detected by Western blot technology at 0.5, 1, 2h, and 7d after 0.01%, 0.05%, and 0.1% atropine eye drops, respectively, the area of CNV was measured. RESULTS: Significant increases were observed on the expression of DRD2 in mouse high myopia model at 0.5, 1, 2h, 7d with 0.05% and 0.1% atropine eye drops (P<0.05). Significant decreases were observed on the expression of DRD1 and VEGFA in mouse high myopia model at 0.5, 1, 2h, 7d with 0.05% and 0.1% atropine eye drops (P<0.05). The area of CNV induced by laser in the drug-treated group was significantly smaller than that in the control group, and the higher the concentration, the more significant the inhibitory effect (P<0.05). CONCLUSION: The 0.01%, 0.05%, 0.1% atropine eye drops can decrease the level of VEGFA and inhibit high myopia CNV indirectly by up-regulating the level of DRD2 and down-regulating the level of DRD1, and the effect of 0.05% and 0.1% atropine eye drops is more significant.

Preliminary proteomic analysis of human tears in lacrimal adenoid cystic carcinoma and pleomorphic adenoma

Han Yue, Feng-Xi Meng, Rui Zhang and Jiang Qian — 2023/5/30 14:30:32
AIM: To detect proteomic differences in tears between adenoid cystic carcinoma (ACC) and pleomorphic adenoma (PA). METHODS: Tear samples were collected from 4 patients with ACC, 5 with PA, and 4 control cases. Label-free analysis and parallel reaction monitoring (PRM) were used to screen and validate the tear proteome. Gene Ontology (GO) annotation and Kyoto Encyclopedia of Genes and Genomes (KEGG) were conducted for bioinformatics analysis. RESULTS: In total, 1059 proteins in tear samples were identified by label-free analysis. Between ACC and PA, 415 differentially expressed proteins were detected. Based on the GO annotation, enzyme regulator activity and serine-type endopeptidase inhibitor activity in the molecular function category, blood microparticle and extracellular matrix in the cellular component category, and response to nutrient levels in the biological process category were most predominant. By KEGG pathway annotation, the different proteins between ACC and PA mainly participated in complement and coagulation cascades, amoebiasis, African trypanosomiasis and cholesterol metabolism. Eight proteins with mostly significant differences were verified by PRM, and five proteins with more than 10-fold increases in ACC compared with PA, including integrin β, α-2-macroglobulin, epididymal secretory sperm binding protein Li 78p, RAB5C, and complement C5, were identified. CONCLUSION: The combined tools of label-free analysis and PRM are very effective and efficient, especially for samples such as tears. Some proteomic differences in tears between ACC and PA are identified and these protein candidates may be specific biomarkers for future exploration.

All-trans retinoic acid regulates the expression of MMP-2 and TGF-β2 via RDH5 in retinal pigment epithelium cells

2023/5/30 14:30:32
AIM: To investigate the effect of all-trans retinoic acid (ATRA) on retinol dehydrogenase 5 (RDH5), matrix metalloproteinase-2 (MMP-2) and transforming growth factor-β2 (TGF-β2) transcription levels, and the effect of RDH5 on MMP-2 and TGF-β2 in retinal pigment epithelium (RPE) cells. METHODS: After adult RPE cell line-19 (ARPE-19 cells) intervened with gradient concentrations of ATRA (0-20 μmol/L) for 24h, flow cytometry was used to detect the proliferation and apoptosis of cells in each group, and quantitative real-time polymerase chain reaction (qRT-PCR) was used to detect RDH5, MMP-2 and TGF-β2 mRNA expression. Then, after ARPE-19 cells transfected with three different siRNA targets for 48h, the RDH5 knockdown efficiency of each group and expression of MMP-2 and TGF-β2 mRNA within them was detected by qRT-PCR. RESULTS: Flow cytometry results showed that ATRA could inhibit the proliferation of RPE cells and promote the apoptosis of RPE cells, and the difference of apoptosis was statistically significant when the ATRA concentration exceeded 5 μmol/L and compared with the normal control group (P=0.027 and P=0.031, respectively). qRT-PCR results showed that ATRA could significantly inhibit the expression level of RDH5 mRNA (P<0.001) and promote the expression of MMP-2 and TGF-β2 mRNA (P=0.03 and P<0.001, respectively) in a dose-dependent manner, especially when treated with 5 μmol/L ATRA. The knockdown efficiency of RDH5 siRNA varies with different targets, among which RDH5 siRNA-435 had the highest knockdown efficiency, i.e., more than 50% lower than that of the negative control group (P=0.02). When RDH5 was knocked down for 48h, the results of qRT-PCR showed that the expressions of MMP-2 and TGF-β2 mRNA were significantly up-regulated (P<0.001). CONCLUSION: ATRA inhibits the expression of RDH5 and promotes MMP-2 and TGF-β2, and further RDH5 knockdown significantly upregulates MMP-2 and TGF-β2. These findings suggest that RDH5 may be involved in an epithelial-mesenchymal transition of RPE cells mediated by ATRA.

Beneficial effects of protocatechuic acid on diabetic retinopathy in streptozocin-induced diabetic rats

Ling Wan, Jun Li, Wei-Bai Chen and Guo-Qiang Wu — 2023/5/30 14:30:32
AIM: To determine the effects of protocatechuic acid (PCA) on streptozocin-induced diabetic retinopathy (DR) in rats. METHODS: Wistar rats were given a 50 mg/kg intraperitoneal injection of streptozocin to induce diabetes. Animals were assigned randomly one of four groups (8 rats per group): control, diabetic, diabetic plus PCA (25 mg/kg•d), and diabetic plus PCA (50 mg/kg•d). After inducing diabetes, treatments were started one week later and continued for eight weeks. After the experiment, the rats were sacrificed, and their retinas were taken for biochemical and molecular analysis. RESULTS: PCA administration diminished the blood glucose and glycated haemoglobin levels relative to the diabetic group. In diabetic rats, PCA lowered elevated levels of advanced glycosylated end products (AGEs) and receptor for AGEs (RAGE). In the retina of diabetic rats, PCA effectively decreased inflammatory cytokine, nuclear factor-κB, tumour necrosis factor-α, interleukin-1β, and vascular endothelial growth factor, and increased antioxidant markers glutathione, superoxide dismutase, and catalase. CONCLUSION: The protective benefits of PCA against DR may be attributable to its suppression of the AGEs and RAGE and its antioxidant and anti-inflammatory properties.

Identification and functional analyses of a novel FOXL2 pathogenic variant causing blepharophimosis, ptosis, and epicanthus inversus syndrome

Yu-Cheng Yan, Lu Zhou and Jin-Cai Fan — 2023/4/27 14:30:44
AIM: To discover the molecular pathogenic basis of the blepharophimosis, ptosis, and epicanthus inversus syndrome (BPES), and to predict the clinical subtype according to in vitro experiments, which is significant to the prognosis. METHODS: A 3-year-old sporadic female patient with typical clinical manifestations of BPES was enrolled. The coding region of forkhead box L2 (FOXL2) gene was sequenced, and the functional assays were performed in vitro by Western blotting, subcellular localization experiment, luciferase reporter assay, and quantitative real-time polymerase chain reaction. RESULTS: A novel FOXL2 point pathogenic variant (c.274G>T) was detected, resulting in a truncated protein (p.E92*). Functional studies demonstrated that the FOXL2 pathogenic variant induced the subcellular mislocalization and the abnormal transcriptional activity on promoters of the steroidogenic acute regulatory protein (StAR or STARD1) gene and the odd-skipped related 2 transcription factor (OSR2) gene. CONCLUSION: A novel pathogenic variant is identified to expand the spectrum of the known FOXL2 mutations. The in vitro experiments provide reference data and more insights to the molecular pathogenesis of BPES. The predicted high risk of ovarian insufficiency makes it significant for the patient enrolled to have further follow-up and therapy concerning female endocrinology.

Protective effects of ferulic acid against ionizing radiation-induced oxidative damage in rat lens through activating Nrf2 signal pathway

2023/4/27 14:30:44
AIM: To examine the protection of ferulic acid (FA) against ionizing radiation (IR)-induced lens injury in rats, as well as the underlying mechanisms. METHODS: FA (50 mg/kg) was administered to rats for 4 consecutive days before they were given 10 Gy γ-radiation, as well as for 3 consecutive days afterward. Two weeks after radiation, the eye tissues were collected. Histological alterations were evaluated by hematoxylin-eosin staining. Enzyme linked immunosorbent assay (ELISA) was utilized to assess the activities of glutathione reductase (GR) and superoxide dismutase (SOD), as well as the levels of glutathione (GSH) and malondialdehyde (MDA) in the lenses. The protein and mRNA levels of Bcl-2, caspase-3, Bax, heme oxygenase-1 (HO-1), and glutamate-cysteine ligase catalytic subunit (GCLC) were quantified using Western blot and quantitative reverse transcription polymerase chain reaction, respectively. With nuclear extracts, the nuclear factor erythroid-2 related factor (Nrf2) protein expressions in the nuclei were also measured. RESULTS: Rats exposed to IR showed lens histological alterations which could be alleviated by FA. FA treatment reversed apoptosis-related markers in IR-induced lens, as evidenced by lower levels of Bax and caspase-3 and higher level of Bcl-2. Furthermore, IR induced oxidative damage manifested by decreased GSH level, increased MDA level, and decreased SOD and GR activities. FA boosted nuclear translocation of Nrf2 and increased the expressions of HO-1 and GCLC to inhibit oxidative stress, as evidenced by an increase in GSH, a decrease in MDA, and an increase in GR and SOD activities. CONCLUSION: FA may work well in preventing and treating IR-induced cataract through promoting the Nrf2 signal pathway to attenuate oxidative damage and cell apoptosis.

Novel homozygous ADAMTS17 missense variant in Weill-Marchesani syndrome

2023/4/27 14:30:44
AIM: To explore the phenotype and genotype of Weill-Marchesani syndrome (WMS) in a Chinese family and review related literature. METHODS: Three WMS patients and other unaffected individuals in this family with a history of consanguineous marriage were included in this study. Medical history, comprehensive ophthalmic examinations, and systemic evaluation, as well as whole exome and Sanger sequencing of specific genomic regions, were performed. RESULTS: The three affected siblings presented with short stature, brachydactyly and ocular disorders, including very shallow anterior chamber, high myopia, microspherophakia lens subluxation with stretched zonules and glaucoma. Genetic analysis verified a homozygous missense mutation (c.2983C>T: p. Arg995Trp) in ADAMTS17, which was correlated with the diseases in this family, indicating an autosomal recessive inherited manner of WMS. This review aims to summarize the mutation sites of WMS genes, so as to prevent the disease and better guide clinical diagnosis and treatment. CONCLUSION: A novel homozygous missense variant of ADAMTS17 is identified in a WMS family with a history of consanguineous marriage. Our study expands the range of mutations associated with WMS and deepens our understanding of pathology in disease associated with ADAMTS17 variants.

Organoid-derived human retinal progenitor cells promote early dedifferentiation of Müller glia in Royal College of Surgeons rats

Qiang Guo, Yu-Xiao Zeng, Shu-Dong Huang, Ting Zou and Zheng-Qin Yin — 2023/3/30 16:20:46
AIM: To explore whether the subretinal transplantation of retinal progenitor cells from human embryonic stem cell-derived retinal organoid (hERO-RPCs) could promote Müller glia dedifferentiation and transdifferentiation, thus improving visual function and delaying retinal degenerative progression. METHODS: hERO-RPCs were subretinally transplanted into Royal College of Surgeons (RCS) rats. Electroretinography (ERG) recording was performed at 4 and 8wk postoperation to assess retinal function. Using immunofluorescence, the changes in outer nuclear layer (ONL) thickness and retinal Müller glia were explored at 2, 4, and 8wk postoperation. To verify the effect of hERO-RPCs on Müller glia in vitro, we cocultured hERO-RPCs with Müller glia with a Transwell system. After coculture, Ki67 staining and quantitative polymerase chain reaction (qPCR) were performed to measure the proliferation and mRNA levels of Müller glia respectively. Cell migration experiment was used to detect the effect of hERO-RPCs on Müller glial migration. Comparisons between two groups were performed by the unpaired Student’s t-test, and comparisons among multiple groups were made with one-way ANOVA followed by Tukey’s multiple comparison test. RESULTS: The visual function and ONL thickness of RCS rats were significantly improved by transplantation of hERO-RPCs at 4 and 8wk postoperation. In addition to inhibiting gliosis at 4 and 8wk postoperation, hERO-RPCs significantly increased the expression of dedifferentiation-associated transcriptional factor in Müller glia and promoted the migration at 2, 4 and 8wk postoperation, but not the transdifferentiation of these cells in RCS rats. In vitro, using the Transwell system, we found that hERO-RPCs promoted the proliferation and migration of primary rat Müller glia and induced their dedifferentiation at the mRNA level. CONCLUSION: These results show that hERO-RPCs might promote early dedifferentiation of Müller glia, which may provide novel insights into the mechanisms of stem cell therapy and Müller glial reprogramming, contributing to the development of novel therapies for retinal degeneration disorders.

Identification of a novel mutation in the FGF10 gene in a Chinese family with obvious congenital lacrimal duct dysplasia in lacrimo-auriculo-dento-digital syndrome

2023/3/30 16:20:46
AIM: To identify the pathogenic gene variant in a family with lacrimo-auriculo-dento-digital syndrome [LADD (MIM 149730)] showing congenital lacrimal duct dysplasia as the main clinical manifestation and lay the foundation for future research on the pathogenic gene. METHODS: Ophthalmological examinations, including slit-lamp biomicroscopy and lacrimal duct probing, and computed tomography dacryocystography (CT-DCG) were performed for all participants. The family pedigree was drawn, genetic features were analyzed, and the genomic DNA of the subjects was extracted. Pathogenic genes were screened via whole exome sequencing (WES) and confirmed using Sanger sequencing. RESULTS: Six patients belonged to this three-generation family, and their clinical manifestations included congenital nasolacrimal duct obstruction, congenital absence of lacrimal puncta and canaliculi, lacrimal fistulae, and limb deformities. This pattern indicates autosomal dominant inheritance. Diagnosis was based on the clinical characteristics of LADD syndrome, which presented in all the patients in this family. A novel frameshift mutation in the FGF10 gene (NM_004465.1), c.234dupC (p.Trp79Leus*15), was identified in all patients via WES. The variant was confirmed by Sanger sequencing and classified as a “pathogenic mutation” according to the American College of Medical Genetics and Genomics (ACMG) variant interpretation guidelines. CONCLUSION: A novel frameshift mutation in the FGF10 gene is found in all patients. This finding helps this family with LADD syndrome receiving a more accurate clinical diagnosis and genetic counseling by extending the mutation range of the FGF10 gene.

Nintedanib induces apoptosis in human pterygium cells through the FGFR2-ERK signalling pathway

Yan Gong, Yan-Hong Liao, Quan-Yong Yi, Meng Li, Li-Shuang Chen and Yan-Yan Wang — 2023/3/30 16:20:46
AIM: To investigate whether nintedanib can inhibit pterygium cells through the fibroblast growth factor receptor 2 (FGFR2)/extracellular-signal-regulated kinase (ERK) pathway. METHODS: Human primary pterygium cells were cultured in vitro. After treatment with nintedanib, the cell morphology was observed under microscopy, the morphological changes of the nucleus were observed after DAPI staining, apoptosis was analyzed by Annexin-V FITC/PI double staining, and the changes of apoptosis-associated proteins were detected by Western blot. The binding ability of nintedanib to FGFR2 was predicted by molecular docking. Finally, by silencing FGFR2, we explored whether nintedanib inhibited FGFR2/ERK pathway. RESULTS: The results showed that nintedanib inhibited the growth of pterygium cells and caused nuclear pyknosis. The results of Annexin-VFITC/PI double staining showed that nintedanib was able to induce early and late apoptosis of pterygium cells, significantly increasing the expression of apoptosis-associated proteins Bax and cleaved-Caspase3 (P<0.05), and reducing the expression of Bcl-2 (P<0.05). In addition, nintedanib significantly inhibited ERK1/2 phosphorylation through FGFR2 (P<0.05). After silencing the expression of FGFR2, there was no significant difference in the inhibition of ERK1/2 phosphorylation by nintedanib (P>0.05). CONCLUSION: Nintedanib induces apoptosis of pterygium cells by inhibiting FGFR2/ERK pathway.

Role of apigenin in high glucose-induced retinal microvascular endothelial cell dysfunction via regulating NOX4/p38 MAPK pathway in vitro

Li-Li Liu and Zhi-Yi Zhao — 2023/3/30 16:20:46
AIM: To investigate the retinoprotective role of Apigenin (Api) against high glucose (HG)-induced human retinal microvascular endothelial cells (HRMECs), and to explore its regulatory mechanism. METHODS: HRMECs were stimulated by HG for 48h to establish the in vitro cell model. Different concentrations of Api (2.5, 5, and 10 μmol/L) were applied for treatment. Cell counting kit-8 (CCK-8), Transwell, and tube formation assays were performed to examine the effects of Api on the viability, migration, and angiogenesis in HG-induced HRMECs. Vascular permeability was evaluated by Evans blue dye. The inflammatory cytokines and oxidative stress-related factors were measured using their commercial kits. Protein expression of nicotinamide adenine dinucleotide phosphate (NADPH) oxidase 4 (NOX4) and p38 mitogen-activated protein kinase (MAPK) was measured by Western blot. RESULTS: Api prevented HG-induced HRMECs viability, migration, angiogenesis, and vascular permeability in a concentration-dependent manner. Meanwhile, Api also concentration-dependently inhibited inflammation and oxidative stress in HRMECs exposed to HG. In addition, HG caused an elevated expression of NOX4, which was retarded by Api treatment. HG stimulation facilitated the activation of p38 MAPK signaling in HRMECs, and Api could weaken this activation partly via downregulating NOX4 expression. Furthermore, overexpression of NOX4 or activation of p38 MAPK signaling greatly weakened the protective role of Api against HG-stimulated HRMECs. CONCLUSION: Api might exert a beneficial role in HG-stimulated HRMECs through regulating NOX4/p38 MAPK pathway.

4D label-free proteomic analysis of vitreous from patients with rhegmatogenous retinal detachment

Qiu-Yi Huo, Meng-Chao Zhu, Wen-Chao Yang, Yi-Peng Wang and Song Chen — 2023/3/30 16:20:46
AIM: To identify metabolites, proteins, and related pathways involved in the etiology of rhegmatogenous retinal detachment (RRD) for use as biomarkers in diagnosing and treating RRD. METHODS: Vitreous specimens were collected and liquid chromatography-tandem mass spectrometry analysis was performed using the four-dimensional label-free technique. Statistically significant differentially expressed proteins, gene ontology (GO) terms, Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway representations, and protein interactions were analyzed. RESULTS: Nine specimens were subjected to proteomic analysis. In total, 161 proteins were identified as differentially expressed proteins (DEPs), including 53 upregulated proteins and 108 downregulated proteins. GO functional analysis revealed that some DEPs were enriched in neuron-related terms and membrane protein terms. Moreover, KEGG analysis indicated that the cell adhesion molecule metabolic pathway was associated with the greatest number of DEPs. Finally, the evaluation of protein-protein interaction network revealed that DEPs were clustered in neuronal adhesion, apoptosis, inflammation and immune responses, correct protein folding, and glycolysis. CONCLUSION: Proteomic profiling is useful for the exploration of molecular mechanisms that underlie RRD. This study reveals increased expression levels of proteins related to heat shock protein content, glycolysis, and inflammatory responses in RRD. Knowledge regarding biomarkers of RRD pathogenesis may help to prevent the occurrence of RRD in the future.

Aberrant expression of COL4A1 in age-related cataract and its effect on cell proliferation, apoptosis and gene expression changes

Dan Zhu, Peng Li, Li Wang, Yuan He and Hui-Zi Zhang — 2023/3/2 15:56:06
AIM: To evaluate the regulation of the aberrant expression of collagen type IV alpha 1 chain (COL4A1) in the development of age-related cataract (ARC). METHODS: Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) and Western blot analysis were employed to evaluate the expression of COL4A1 in ARC patients and healthy controls. The proliferation, apoptosis, cell cycle and epithelial-mesenchymal transition (EMT) of human lens epithelial cell (HLE-B3) were further analyzed under the condition of COL4A1 gene silence. Alteration of gene expression at mRNA level after knockdown COL4A1 were also evaluated by qRT-PCR on HLE-B3 cells. RESULTS: The aberrant expression of COL4A1 was identified a clinically associated with the ARC. Silencing of COL4A1 promoted the apoptosis and inhibited the proliferation of HLE-B3 by blocking the cell cycle. Moreover, COL4A1 gene silence didn't affect the cytoskeleton of HLE-B3 but down-regulated the Collagen type IV Alpha 2 Chain (COL4A2), paired box 6 (PAX6), procollagen-lysine 2-oxoglutarate 5-dioxygenases 1 (PLOD1) and procollagen-lysine 2-oxoglutarate 5-dioxygenases 2 (PLOD2) expression levels in HLE-B3 cells. Silencing the COL4A1 gene induced EMT of the HLE-B3 cells by promoting the transforming growth factor beta (TGF-β) expression. CONCLUSION: Silencing of COL4A1 induces S-phase arrest, also inhibits the proliferation and enhance HLE-B3 apoptosis and EMT, and down-regulates the expression of COL4A2, PAX6, PLOD1 and PLOD2. Thus, the expression alteration of COL4A1 may play a critical role in the pathogenesis of ARC.

Effect of epigallocatechin gallate in green tea on preventing lens opacity and αB-crystallin aggregation in rat model of diabetes

Andita Gustria Caesary, Nina Handayani and Hidayat Sujuti — 2023/3/2 15:56:06
AIM: To evaluate the effect of epigallocatechin gallate (EGCG) in preventing lens opacity and the aggregation of lens αB-crystallin in model rats of diabetes mellitus (DM). METHODS: This experimental study included Wistar rats for DM as in vivo models and divided into 5 groups. The treatment groups were administered EGCG by orally for 20d and were then assessed for their degree of lens opacity with binocular microscope and lens αB-crystallin expression from Western blot analyze. RESULTS: Pearson correlation test and regression analysis on EGCG exposure and final random blood sugar (RBS) obtained a significance level of P<0.05. EGCG exposure can significantly lower RBS with an R2 of 0.5634 (56.34%). The same analysis on EGCG exposure and the degree of lens opacity obtained a significance level of P<0.05 and increased exposure to EGCG can significantly lower the degree of lens opacity with an R2 of 0.8577 (85.77%). Correlation analysis between EGCG and the expression of lens αB-crystallin can be concluded that the higher the EGCG exposure administered, the higher the native lens αB-crystallin expression and the lower the aggregate lens αB-crystallin expression. There was also significant effect in which every 1 mg/kg body weight dose of EGCG can increase the native lens αB-crystallin expression by 0.0063 and decrease the aggregate lens αB-crystallin expression by 0.0076. CONCLUSION: The administration of EGCG at a dose of 300, 600, and 1200 mg shows a significant effect on preventing lens opacity and aggregation of αB-crystallin in diabetic rat models and this research could be a biomolecular prevention of cataract.

Expression levels of ROS and Atg proteins in the vitreous in rhegmatogenous retinal detachment

Nan Huang, Xue-Yan Gao, Jin-Ping Li, Xing Lu, Hua-Mei Zhu and Kai Dong — 2023/3/2 15:56:06
AIM: To detect the concentrations of reactive oxygen species (ROS), transient receptor potential mucin-1 (TRPML1), and autophagy-related (Atg) proteins (LC3-I, LC3-II, and Beclin1) in vitreous humor of patients with simple rhegmatogenous retinal detachment (RRD). METHODS: RRD patients enrolled as the RRD group, and patients with idiopathic macular hole (IMH) and idiopathic macular epiretinal membrane (IMEM) were enrolled as control group. The levels of ROS, TRPML1, LC3-I, LC3-II, and Beclin1 in vitreous humor of patients in the RRD and control groups were detected by enzyme-linked immunosorbent assay (ELISA). RESULTS: The RRD group included 28 eyes 28 patients and had a higher concentration of ROS in vitreous humor (631.86±18.05 vs 436.34±108.22 IU/mL, P<0.05). The ROS level in patients with a wide retinal detachment (RD) extent (RD range ≥1/2) was higher than that with a narrow RD extent (RD range<1/2, P<0.05). ROS concentration was negatively correlated with RD time (r=-0.46, P=0.01). The expression levels of LC3-I and Beclin1 significantly decreased in RRD (P<0.05), but there were no correlations with the RD time, RD extent, or macular involvement. CONCLUSION: In eyes with RRD, the concentration of ROS in vitreous humor increases and the expression levels of Atg proteins decrease, reflecting possibly that autophagy is inhibited.

Comparison of biological behavior of lacrimal gland adenoid cystic carcinoma with high-grade transformation cells

Chuan-Li Zhang, Li-Min Zhu, Xun Liu, Mei-Xia Jiang, Ting-Ting Lin and Yan-Jin He — 2023/2/2 15:59:14
AIM: To evaluate the differences between human lacrimal gland adenoid cystic carcinoma with high-grade transformation (LACC-HGT) primary cells cultured by high-grade transformation tissue and non-high-grade transformation (non-HGT) primary cells cultured by non-high-grade transformation tissue in proliferation, metastasis, drug susceptibility, and genes. METHODS: LACC-HGT primary cells were established by tissue block culture, and the 4th to 10th generation primary cells were selected as research objects. The cells were preliminarily identified by immunofluorescent staining. The differences between non-HGT and LACC-HGT primary cells in terms of proliferation, metastasis, and drug susceptibility were compared by cell counting kit-8 (CCK-8) assay, wound healing, and drug sensitivity experiments. Differentially expressed genes were screened using mRNA array. Gene expression was analyzed using real-time quantitative polymerase chain reaction (RT-qPCR). RESULTS: LACC-HGT primary cells were successfully cultured by tissue block culture. Immunofluorescence staining results showed that cytokeratin (CK) and CK7 expression levels were positive in LACC-HGT primary cells. CCK-8 results showed that the proliferation ability of LACC-HGT cells was significantly higher than that of non-HGT cells. Wound healing experiment showed that the migration ability of LACC-HGT cells was significantly higher than that of non-HGT cells. LACC-HGT cells were also less sensitive to cisplatin and paclitaxel than non-HGT cells. Compared with non-HGT cells, 9566 differentially expressed genes were found in LACC-HGT primary cells, of which 5162 were up-regulated and 4404 were down-regulated. The expression of N-acetylneuraminate pyruvate lyase (NPL), MARVEL domain containing 3 (MARVELD3), syntabulin (SYBU), and allograft inflammatory factor 1 (AIF1) was higher in LACC-HGT cells than in non-HGT cells, whereas that of periostin (POSTN) was lower. CONCLUSION: LACC-HGT primary cells have faster proliferation, stronger migration ability, and poorer sensitivity to chemotherapy drugs than non-HGT primary cells. The expression of mRNAs in non-HGT and LACC-HGT primary cells are significantly different. These features are speculated to be the reasons why high-grade transformation tissues exhibit higher malignant degree and poorer prognosis than their counterparts.

Ultraviolet light exposure and its penetrance through the eye in a porcine model

2023/2/2 15:59:15
AIM: To determine the amount of ultraviolet (UV) light irradiance that various layers of the eye receive as sunlight passes through the eye, and to investigate the protective benefits of UV light-blocking contact lenses. METHODS: Twenty-four porcine eyes were prepared in one of three ways: isolated cornea, cornea and lens together, or whole eye preparation. UV light irradiance was measured with a UV-A/B light meter before and after the eye preparations were placed over the meter to measure UV light penetration in each eye structure. In the whole eye preparation, a hole was placed in the fovea to measure light as it passed through the vitreous. Subsequently, UV-protective contact lenses were placed over the structures, and UV light penetrance was measured. Measurements of UV light exposure were taken outdoors at various locations and times. RESULTS: Cornea absorbed 63.56% of UV light that reached the eye. Cornea and lens absorbed 99.34% of UV light. Whole eye absorbed 99.77% of UV light. When UV-protective contact lenses were placed, absorption was 98.90%, 99.55%, and 99.87%, respectively. UV light exposure was dependent on directionality and time of day, and was greatest in areas of high albedo that reflect significant amounts of light, such as a beach. CONCLUSION: Cornea absorbs the majority of UV light that reaches the eye in this model. UV-protective contact lenses reduce UV exposure to the eye. Locations with high albedo expose the eye to higher levels of UV light.

Alu antisense RNA ameliorates methylglyoxal-induced human lens epithelial cell apoptosis by enhancing antioxidant defense

2023/2/2 15:59:15
AIM: To determine whether an antisense RNA corresponding to the human Alu transposable element (Aluas RNA) can protect human lens epithelial cells (HLECs) from methylglyoxal-induced apoptosis. METHODS: Cell counting kit-8 (CCK-8) and 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assays were used to assess HLEC viability. HLEC viability/death was detected using a Calcein-AM/PI double staining kit; the annexin V-FITC method was used to detect HLEC apoptosis. The cytosolic reactive oxygen species (ROS) levels in HLECs were determined using a reactive species assay kit. The levels of malondialdehyde (MDA) and the antioxidant activities of total-superoxide dismutase (T-SOD) and glutathione peroxidase (GSH-Px) were assessed in HLECs using their respective kits. RT-qPCR and Western blotting were used to measure mRNA and protein expression levels of the genes. RESULTS: Aluas RNA rescued methylglyoxal-induced apoptosis in HLECs and ameliorated both the methylglyoxal-induced decrease in Bcl-2 mRNA and the methylglyoxal-induced increase in Bax mRNA. In addition, Aluas RNA inhibited the methylglyoxal-induced increase in Alu sense RNA expression. Aluas RNA inhibited the production of ROS induced by methylglyoxal, restored T-SOD and GSH-Px activity, and moderated the increase in MDA content after treatment with methylglyoxal. Aluas RNA significantly restored the methylglyoxal-induced down-regulation of Nrf2 gene and antioxidant defense genes, including glutathione peroxidase, heme oxygenase 1, γ-glutamylcysteine synthetase and quinone oxidoreductase 1. Aluas RNA ameliorated methylglyoxal-induced increases of the mRNA and protein expression of Keap1 that is the negative regulator of Nrf2. CONCLUSION: Aluas RNA reduces apoptosis induced by methylglyoxal by enhancing antioxidant defense.

Effect of palmitoylethanolamide on degeneration of a human-derived retinal pigment epithelial cell induced by all-trans retinal

2023/2/2 15:59:15
AIM: To study the effect of palmitoylethanolamide (PEA) on apoptosis of retinal pigment epithelial (RPE) cells induced by all-trans retinal (atRAL) and to explore the possible molecular mechanism. METHODS: CellTiter 96® Aqueous One Solution Cell Proliferation Assay (MTS) was used to detect the effect of PEA on human-derived retinal epithelial cells (ARPE-19) viability induced by atRAL. A Leica DMi8 inverted microscope was used to observe cell morphology. Reactive oxygen species (ROS) production was evaluated with 2’,7’-dichlorodihydrof-luorescein diacetate (H2DCFDA) staining and fluorescence microscopy. Expression of c-Jun N-terminal kinase (JNK), phosphorylated JNK (p-JNK), c-Jun, phosphorylated c-Jun (p-c-Jun), Bak, cleaved caspase-3, C/EBP homologous protein (CHOP), and binding (Bip) protein levels were tested by Western blot. Abca4-/-Rdh8-/- mice, mouse models of atRAL clearance defects which displays some symbolic characteristics of dry age-related macular degeneration (AMD) and Stargardt disease (STGD1). In the animal models, PEA was injected intraperitoneally. The full-field electroretinogram was used to detect visual function under scotopic conditions traced from mice. Optical coherence tomography showed reconstitution or thickening of the retinal pigment epithelium layer. Effect of PEA on fundus injury induced by light in Abca4-/-Rdh8-/- mice was observed by fundus photography. RESULTS: PEA ameliorated ARPE-19 cells apoptosis and inhibited ROS (including mitochondrial ROS) production induced by atRAL. PEA improved the retinal functional, prohibited both RPE and photoreceptor from death, ameliorates light-induced fundus impairment in Abca4-/-Rdh8-/- mice. In vitro and in vivo, PEA inhibited JNK, p-JNK, c-Jun, p-c-Jun, Bak, cleaved caspase-3, CHOP, and Bip protein levels induced by all-trans retinal in ARPE-19 cells. CONCLUSION: PEA has effect on treating RPE cells apoptosis in retinopathy caused by atRAL accumulation. PEA is a potential treatment strategy for dry AMD and STGD1. The molecular mechanism is affecting the ROS-JNK-CHOP signaling pathway partly.

Intravitreal slow-release dexamethasone alleviates traumatic proliferative vitreoretinopathy by inhibiting persistent inflammation and Müller cell gliosis in rabbits

2022/12/23 15:16:42
AIM: To evaluate the effects of intravitreal slow-release dexamethasone on traumatic proliferative vitreoretinopathy (PVR) and Müller cell gliosis and preliminarily explored the possible inflammatory mechanism in a rabbit model induced by penetrating ocular trauma. METHODS: Traumatic PVR was induced in the right eyes of pigmented rabbits by performing an 8-mm circumferential scleral incision placed 2.5 mm behind the limbus, followed by treatment with a slow-release dexamethasone implant (Ozurdex) or sham injection. Left eyes were used as normal controls. The intraocular pressure (IOP) was monitored using an iCare tonometer. PVR severity was evaluated via anatomical and histopathological examinations every week for 6wk; specific inflammatory cytokine and proliferative marker levels were measured by quantitative real-time polymerase chain reaction, Western blot, protein chip analysis, or immunofluorescence staining. RESULTS: During the observation period, PVR severity gradually increased. Intense Müller cell gliosis was observed in the peripheral retina near the wound and in the whole retina of PVR group. Ozurdex significantly alleviated PVR development and Müller cell gliosis. Post-traumatic inflammation fluctuated and was persistent. The interleukin-1β (IL-1β) mRNA level was significantly upregulated, peaking on day 3 and increasing again on day 21 after injury. The expression of nod-like receptor family pyrin domain containing 3 (NLRP3) showed a similar trend that began earlier than that of IL-1β expression. Ozurdex suppressed the expression of IL-1β, NLRP3, and phosphorylated nuclear factor-kappa B (NF-κB). The average IOP after treatment was within normal limits. CONCLUSION: The present study demonstrates chronic and fluctuating inflammation in a traumatic PVR rabbit model over 6wk. Ozurdex treatment significantly inhibites inflammatory cytokines expression and Müller cell gliosis, and thus alleviates PVR severity. This study highlights the important role of IL-1β, and Ozurdex inhibites inflammation presumably via the NF-κB/NLRP3/IL-1β inflammatory axis. In summary, Ozurdex provides a potential therapeutic option for traumatic PVR.

Apolipoprotein A1 suppresses the hypoxia-induced angiogenesis of human retinal endothelial cells by targeting PlGF

Jie Hu, Zhu-Ting Chen, Kun-Yi Su, Yu Lian, Lin Lu and An-Di-Na Hu — 2022/12/23 15:16:42
AIM: To investigate the anti-angiogenic effect of apolipoprotein A1 (apoA1) on primary human retinal vascular endothelial cells (HRECs) and explore the possible mechanism. METHODS: The primary HRECs were transfected with apoA1-GFP recombinant lentiviral and were compared with cells undergoing transfection with empty lentiviral vectors. Hypoxia chambers were used to simulate the anoxic environment of cells under pathological condition. The concentrations of secreted vascular endothelial growth factor (VEGF) and placental growth factor (PlGF) were measured by enzyme-linked immunosorbent assay (ELISA). Cell migration ability was detected by wound healing assay. The sprouting of HRECs was determined by tube formation assay. The protein levels of extracellular signal regulated kinase 1/2 (ERK1/2) and phosphorylated ERK1/2 (p-ERK1/2) were measured by Western blot. RESULTS: Overexpressed apoA1 in hypoxia-induced HRECs significantly suppressed PlGF (0.67±0.10 folds, P=0.007). Overexpressed apoA1 also attenuated hypoxia-induced cell migration (0.32±0.11 folds, P<0.0001), tube formation (0.66±0.01 folds, P<0.0001) and the phosphorylation levels of ERK (0.6±0.11 folds, P=0.025). Pretreatment of mitogen-activated protein kinase kinase (MEK) inhibitor (U0126) further reduced the PlGF and angiogenesis in hypoxia-induced HRECs. CONCLUSION: ApoA1 inhibits the angiogenesis at least in part by inactivating ERK1/2 in hypoxia-induced HRECs. Moreover, apoA1 suppresses the PlGF expression, which selectively associated with pathological angiogenesis.

Comparison of vegetable oils on the uptake of lutein and zeaxanthin by ARPE-19 cells

Jeonghun Baek, Chun Wai Mai, Wei Meng Lim and Lai Chun Wong — 2022/12/23 15:16:42
AIM: To compare the effect of vegetable oils on the uptake of lutein and zeaxanthin by adult retinal pigment epithelial (ARPE)-19 cells in vitro. METHODS: ARPE-19 cells were cultured in Dulbecco’s Modified Eagle Medium-F-12 supplemented with 10% foetal bovine serum and 1% penicillin–streptomycin in a humidified 5% CO2 incubator maintained at 37℃. Cells were treated with 247 µmol/L lutein, 49 µmol/L zeaxanthin and 1% (v/v) of either coconut oil, corn oil, peanut oil, olive oil, sunflower oil, soybean oil, castor oil, or linseed oil for 48h. Lutein and zeaxanthin concentration in the cells were quantified by high performance liquid chromatography. RESULTS: Among the oils tested, the highest lutein and zeaxanthin uptake was observed with coconut oil while the lowest was observed with linseed oil. CONCLUSION: ARPE-19 uptake of lutein and zeaxanthin are found to be dependent on the type of oils.

Identifying a novel frameshift pathogenic variant in a Chinese family with neurofibromatosis type 1 and review of literature

Xiao-Hui Guo, Xin Jin, Bin Wang and Zhao-Yan Wang — 2022/12/23 15:16:43
AIM: To detect the pathogenic gene variant in a family with neurofibromatosis type 1 (NF1). METHODS: This patient with NF1 was sequenced using target sequence capture and high-throughput sequencing technology. After detecting the suspicious pathogenic variant type, the pathogenic variant sites of the patient and the patient’s family members were verified by multiple ligation dependent probe amplification and Sanger sequencing. Sift, polyphen-2, Mutation Taster and GERP++ software were used to predict the pathogenicity of the unknown loci. The clinical data, diagnosis and treatment process of the patients were reviewed. Using the keyword “NF1; frameshift pathogenic variant”, relevant literature was gathered for analysis from Chinese and international databases, with articles dating from the establishment of each database to April 2022. RESULTS: A heterozygous frameshift pathogenic variant of NF1 in exon 33 was detected in the patient. The insertion of adenine in coding region 4486 resulted in the replacement of isoleucine with asparagine in protein 1497. Sanger sequencing validation and segregation analysis were performed, which demonstrated that the NF1 gene was cosegregated with the disease phenotype in this family. This study identified a novel NF1 heterozygous frameshift mutation c.4486dupA (p.I1497Nfs*12). Relevant literature retrieval found 7 Chinese articles and 12 foreign articles. With NF1 gene mutation, mutation types are diverse, including point mutation, frameshift mutation, splice site mutation, exon mutation, chimeric mutation and de novo mutation. Foreign reports are based on autosomal dominant inheritance. CONCLUSION: This study’s results demonstrate that a novel deletion in exon 33 caused NF1 in this Chinese family, expanding the mutational spectrum of the NF1 gene.

Association analysis of BclI with benign lymphoepithelial lesions of the lacrimal gland and glucocorticoids resistance

2023/10/25 10:43:18
AIM: To evaluate the relationship between gene polymorphism (BclI, ER22/23EK, N363S) and the occurrence, progression and sensitivity to glucocorticoid of lacrimal gland benign lymphoepithelial lesion (LGBLEL). METHODS: Clinical peripheral blood samples of 52 LGBLEL patients and 10 normal volunteers were collected for DNA extraction and polymerase chain reaction sequencing to analyze single nucleotide polymorphism (SNP) genotypes. The lacrimal tissues of LGBLEL were surgically removed and made into paraffin sections for subsequent hematoxylin-eosin (HE) and Masson staining analysis. The duration of disease and hormone use of LGBLEL patients from diagnosis to surgery were also analyzed. The Meta-analysis follows PRISMA guidelines to conducted a systematic review of human studies investigating the relationship between the NR3C1 BclI polymorphism and glucocorticoids (GCs) sensitivity. RESULTS: There was no association between ER22/23EK or N363S and the occurrence of LGBLEL or GCs sensitivity (P>0.05); BclI GC genotype was closely related to GCs resistance (P=0.03) as is the minor allele C (P=0.0017). The HE staining and Masson staining showed that the GC genotype of BclI remarkably slowed down the disease progression and reduced fibrosis (P<0.05), especially for GCs-dependent patients (P<0.0001). Meta-analysis showed that BclI was not significantly associated with GCs responsiveness. CONCLUSION: The LGBLEL patients who carry the NR3C1 BclI allele C may be more sensitive to GCs and associated with lower fibrosis and slower disease progression. The results may guide the clinical treatment strategy for the LGBLEL patients.

In vitro protective effect of recombinant prominin-1 combined with microRNA-29b on N-methyl-D-aspartate-induced excitotoxicity in retinal ganglion cells

Jun-Hua Li, Guan-Shun Yu, Yu-Da Wang, Tian-Kun Li — 2023/10/25 10:43:19
AIM: To determine the in vitro protective effect of recombinant prominin-1 (Prominin-1)+microRNA-29b (P1M29) on N-methyl-D-aspartate (NMDA)-induced excitotoxicity in retinal ganglion cells (RGCs). METHODS: RGC-5 cells were cultured, and NMDA-induced excitotoxicity at the range of 100–800 μmol/L was assessed using the MTT assay. NMDA (800 μmol/L) was selected as the appropriate concentration for preparing the cell model. To evaluate the protective effect of P1M29 on the cell model, Prominin-1 was added at the concentration of 1–6 ng/mL for 48h, and the cell survival was investigated with/without microRNA-29b. After obtaining the appropriate concentration and time of P1M29 at 48h, real-time polymerase chain reaction (PCR) was utilized to detect the relative mRNA expression of vascular endothelial growth factor (VEGF) and transforming growth factor (TGF)-β2. Western blot detection was applied to measure the phosphorylation levels of protein kinase B (AKT) and extracellular regulated protein kinases (ERK) in RGC-5 cells after treatment with Prominin-1. Apoptosis study of the cell model was conducted by flow cytometry for estimating the anti-apoptotic effect of P1M29. Immunofluorescence analysis was used to analyze the expression levels of VEGF and TGF-β2. RESULTS: MTT cytotoxicity assays demonstrated that P1M29 group had significantly higher cell survival rate than Prominin-1 group (P<0.05). Real-time PCR data indicated that the expression levels of VEGF were significantly increased in both Prominin-1 and P1M29 groups compared NMDA and microRNA-29b group (P<0.05), while TGF-β2 were significantly decreased in both microRNA-29b and P1M29 groups compared NMDA and Prominin-1 group (P<0.05). Western blot results showed that both Prominin-1 and P1M29 groups significantly increased the phosphorylation levels of AKT and ERK compared to NMDA and microRNA-29b groups (P<0.05). Flow cytometry analysis revealed that P1M29 could prevent RGC-5 cell apoptosis in the early stage of apoptosis, while immunofluorescence results showed that P1M29 group had higher expression of VEGF and lower expression of TGF-β2 with a stronger green fluorescence than NMDA group. CONCLUSION: Prominin-1 combined with microRNA-29b can provide a suitable therapeutic option for ameliorating NMDA-induced excitotoxicity in RGC-5 cells.

Bioinformatics and in vitro study reveal the roles of microRNA-346 in high glucose-induced human retinal pigment epithelial cell damage

Peng Li, Li Wang, Qing Liu, Zhao-Jiang Du — 2023/10/25 10:43:19
AIM: To study microRNAs (miRNAs) and their potential effects in high glucose-induced human retinal pigment epithelial cell damage. METHODS: We screened the GSE52233 miRNA expression dataset for differentially expressed miRNAs (DEMs). The target genes of the top 10 DEMs were predicted using miRWalk 2.0 database, followed by function enrichment and protein-protein interaction analysis. miRNA expression was determined in the human retinal pigment epithelial cell line ARPE-19 treated with high glucose (HG) by quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Cell proliferation was determined using cell counting kit (CCK)-8 assay. Cell cycle, apoptosis, and reactive oxygen species (ROS) levels were determined by flow cytometry. The direct interaction between miRNA and targets was validated using dual-luciferase reporter assay. RESULTS: Thirty-nine DEMs were screened, and we predicted 125 miRNA-mRNA pairs for the top 10 DEMs, including 119 target genes of seven DEMs such as miR-346, which was upregulated in diabetic retinopathy (DR). miR-346 target genes were substantially enriched in the regulation of intracellular transport and retinoic acid-inducible gene I (RIG-I)-like receptor signaling pathway. Expression of three upregulated and downregulated miRNAs were verified by qRT-PCR in HG-treated ARPE-19 cells. Expression of miR-346 was elevated in HG treated ARPE-19 cells in a dose-dependent manner. HG inhibited cell proliferation and induced apoptosis, which were partly reversed by transfecting an miR-346 inhibitor, which even decreased the ROS levels elevated due to HG. Argonaute 2 (AGO2) was a target of miR-346. CONCLUSION: miR-346 is a key miRNA and plays an important role in HG-induced damage in human retinal pigment epithelial cells.

Therapeutic effect of folic acid combined with decitabine on diabetic mice

Gang Du, Yong Yan, Jun-Feng Gao, Chun-Yan Guo, Xiao Shen, Xun-Wen Lei — 2023/10/25 10:43:19
AIM: To evaluate the therapeutic effect of folic acid combined with decitabine on diabetic mice. METHODS: The diabetic model of db/db mice were randomly divided into model group, folic acid group, decitabine group, folic acid combined with decitabine group, and C57 mice as normal control group. The density of retinal blood vessels and retinal thickness were detected by fundus photography and optical coherence tomography, respectively. Pathological changes of retina were observed by hematoxylin-eosin (HE) staining. The homocysteine (Hcy) in serum was detected by enzyme linked immunosorbent assay (ELISA). TdT-mediated dUTP nick-end labeling (TUNEL) was used to detect apoptosis in retinal tissue. Evans blue dye was used to detect the permeability of retinal blood vessels. The platelet endothelial cell adhesion molecule-1 (CD31) and vascular endothelial growth factor receptor (VEGFR) protein were detected by Western blot. The 3-nitrotyrosine (3-NT) and 4-hydroxynonanine (4-HNE) were detected by immunohistochemistry. RESULTS: The density of retinal blood vessels, retinal thickness, retinal vascular permeability and the proportion of apoptotic cells of retinal tissue in the model group increased significantly than control group (P<0.05). The Hcy in serum and the levels of CD31, VEGFR, 3-NT, and 4-HNE in retinal tissue increased significantly in the model group (P<0.01). Folic acid and decitabine both reversed these changes significantly, and the combination of the folic acid and decitabine worked best. CONCLUSION: The combination of folic acid and decitabine has a more significant protective effect on the retina in diabetic mice.

A novel approach for 25-gauge transconjunctival sutureless vitrectomy to evaluate vitreous substitutes in rabbits

Rui-Jin Ran, Ting Wang, Meng-Ying Tao, Yue-Qin Gou, Ming Zhang — 2023/9/19 15:49:11
AIM: To improve the standard three-port vitrectomy for establishing and evaluating an endotamponade model in rabbits. METHODS: Three ports were prepared near the third eyelid of rabbits, and the infusion port was placed at the inferior nasal quadrant with the inserted cannula linking with a self-designed handheld rigid infusion catheter. All right eyes of rabbits underwent a modified 25-gauge vitrectomy and were subsequently filled with balanced salt solution, silicone oil, and eight-arm polyethylene glycols (8-arm PEGs) hydrogel separately for comparison. Ophthalmic examinations were performed regularly to record the changes after the surgery. RESULTS: Successful vitrectomy was achieved among 44 chinchilla rabbits. The mean operation time was 4.51±1.25min. Four eyes (9.1%) presented limited lens touch and two eyes (4.5%) showed retinal touch during surgery. Incision leakage was found in three eyes (6.8%) after surgery. There was no endophthalmitis, hemorrhage, or retinal detachment during the observation period and ophthalmic examinations after the implantation of vitreous substitutes. CONCLUSION: The modified technique of the standard vitrectomy applied in the endotamponade model in rabbits shows excellent safety and practicality.

Influence of hypoxia on retinal progenitor and ganglion cells in human induced pluripotent stem cell-derived retinal organoids

2023/9/19 15:49:11
AIM: To observe the effect of low oxygen concentration on the neural retina in human induced pluripotent stem cell (hiPSC)-derived retinal organoids (ROs). METHODS: The hiPSC and a three-dimensional culture method were used for the experiments. Generated embryoid bodies (EBs) were randomly and equally divided into hypoxic and normoxic groups. Photographs of the EBs were taken on days 38, 45, and 52, and the corresponding volume of EBs was calculated. Simultaneously, samples were collected at these three timepoints, followed by fixation, sectioning, and immunofluorescence. RESULTS: The proportion of Ki67-positive proliferating cells increased steadily on day 38; this proliferation-promoting effect tended to increase tissue density rather than tissue volume. On days 45 and 52, the two groups had relatively similar ratios of Ki67-positive cells. Further immunofluorescence analysis showed that the ratio of SOX2-positive cells significantly increased within the neural retina on day 52 (P<0.05). In contrast, the percentage of PAX6- and CHX10-positive cells significantly decreased following hypoxia treatment at all three timepoints (P<0.01), except for CHX10 at day 45 (P>0.05). Moreover, the proportion of PAX6-/TUJ1+ cells within the neural retinas increased considerably (P<0.01, <0.05, <0.05 respectively). CONCLUSION: Low oxygen promotes stemness and proliferation of neural retinas, suggesting that hypoxic conditions can enlarge the retinal progenitor cell pool in hiPSC-derived ROs.

Effect of miR-27b-3p and Nrf2 in human retinal pigment epithelial cell induced by high-glucose

Qiao-Ling Lai, Ting Xie, Wei-Dong Zheng, Yan Huang — 2023/9/19 15:49:12
AIM: To determine whether the microRNA-27b-3p (miR-27b-3p)/NF-E2-related factor 2 (Nrf2) pathway plays a role in human retinal pigment epithelial (hRPE) cell response to high glucose, how miR-27b-3p and Nrf2 expression are regulated, and whether this pathway could be specifically targeted. METHODS: hRPE cells were cultured in normal glucose or high glucose for 1, 3, or 6d before measuring cellular proliferation rates using cell counting kit-8 and reactive oxygen species (ROS) levels using a dihydroethidium kit. miR-27b-3p, Nrf2, NAD(P)H quinone oxidoreductase 1 (NQO1) and heme oxygenase-1 (HO-1) mRNA and protein levels were analyzed using reverse transcription quantitative polymerase chain reaction (RT-qPCR) and immunocytofluorescence (ICF), respectively. Western blot analyses were performed to determine nuclear and total Nrf2 protein levels. Nrf2, NQO1, and HO-1 expression levels by RT-qPCR, ICF, or Western blot were further tested after miR-27b-3p overexpression or inhibitor lentiviral transfection. Finally, the expression level of those target genes was analyzed after treating hRPE cells with pyridoxamine. RESULTS: Persistent exposure to high glucose gradually suppressed hRPE Nrf2, NQO1, and HO-1 mRNA and protein levels and increased miR-27b-3p mRNA levels. High glucose also promoted ROS release and inhibited cellular proliferation. Nrf2, NQO1, and HO-1 mRNA levels decreased after miR-27b-3p overexpression and, conversely, both mRNA and protein levels increased after expressing a miR-27b-3p inhibitor. After treating hRPE cells exposed to high glucose with pyridoxamine, ROS levels tended to decreased, proliferation rate increased, Nrf2, NQO1, and HO-1 mRNA and protein levels were upregulated, and miR-27b-3p mRNA levels were suppressed. CONCLUSION: Nrf2 is a downstream target of miR-27b-3p. Furthermore, the miR-27b-3p inhibitor pyridoxamine can alleviate high glucose injury by regulating the miR-27b-3p/Nrf2 axis.

Effectiveness of conjunctival bleb scarring by knock-down of heat shock protein 47 in rat model

Wei-Wei Wang, Hai-Yan Li, Huan-Huan Yan — 2023/9/19 15:49:12
AIM: To evaluate the effectiveness of knock-down of heat shock protein 47 (HSP47) on conjunctival bleb scarring in a rat model and its possible mechanism. METHODS: Male Sprague–Dawley rats were used for glaucoma filtration surgery (GFS) and were treated with either phosphate buffered solution, shControl, mitomycin C, or sh-HSP47 using a microsyringe immediately after GFS. The morphology of filtering blebs was observed postoperatively. The levels of HSP47 were analyzed at 2, 5, 8, and 11d after GFS via realtime quantitative polymerase chain reaction (PCR) and Western blot. The silencing effect of HSP47, the expression of collagen I and III, and the potential signaling pathways of HSP47 during scarification were explored 11d post GFS. The protein levels of transforming growth factor-β1 (TGF-β1), phospho-Smad2 (pSmad2), phospho-Smad3 (p-Smad3), and phospho-p38 (p-p38) were also analyzed using Western blot. RESULTS: Sh-HSP47 treatment significantly prolonged the functional filtration bleb retention. The levels of HSP47 were increased significantly at 5, 8, and 11d postoperatively compared to the control group (P<0.05, P<0.01, and P<0.001). The levels of HSP47 protein at day 11 postoperatively were significantly down-regulated after HSP47 silencing using sh-HSP47 adenovirus transfection (P<0.01). Expression levels of collagen I and III within the blebs were significantly reduced in the absence of HSP47 (P<0.01). Moreover, the protein levels of TGF-β1, p-Smad2/3, and p-p38 were dramatically inhibited after treatment with sh-HSP47 (P<0.01). CONCLUSION: The inhibitory effects of HSP47 knock-down on scarring after GFS have the potential to be an efficacious therapeutic option for the treatment of conjunctival bleb scarring.

A novel pathogenic splicing mutation of RPGR in a Chinese family with X-linked retinitis pigmentosa verified by minigene splicing assay

Hui-Qin Wang, Pei-Kuan Cong, Tian He, Xiao-Feng Yu, Ya-Nan Huo — 2023/9/19 15:49:12
AIM: To report a novel splicing mutation in the RPGR gene (encoding retinitis pigmentosa GTPase regulator) in a three-generation Chinese family with X-linked retinitis pigmentosa (XLRP). METHODS: Comprehensive ophthalmic examinations including best corrected visual acuity, fundus photography, vision field, and pattern-visual evoked potential were performed to identify the disease phenotype of a six-year-old boy from the family (proband). Genomic DNA was extracted from peripheral blood of five available members of the pedigree. Whole-exome sequencing (WES), Sanger sequencing, and pSPL3-based exon trapping were used to investigate the aberrant splicing of RPGR. Human Splice Finder v3.1 and NNSPLICE v0.9 were used for in silico prediction of splice site variants. RESULTS: The proband was diagnosed as having retinitis pigmentosa (RP). He had severe symptoms with early onset. A novel splicing mutation, c.619+1G>C in RPGR was identified in the proband by WES and in four family members by Sanger sequencing. Minigene splicing assays verified that c.619+1G>C in RPGR would result in the formation of a damaging alternative transcript in which the last 91 bp of exon 6 were skipped, leading to the subsequent deletion of 623 correct amino acids (c.529_619del p.Val177Glnfs*16). CONCLUSION: We identify a novel splice donor site mutation causing aberrant splicing of RPGR. Our findings add to the catalog of pathological mutations of RPGR and further emphasize the functional importance of RPGR in RP pathogenesis and its complex clinical phenotypes.

International Journal of Ophthalmology Press -->Basic Research

Effect of Z,E-butylidedephthalide on experimental choroidal neovascularization in rat and ocular blood flow in rabbits

Expression of transforming growth factor-β type 1 receptor and transforming growth factor-β type 2 receptor in diabetic rat retina

The changes of protein kinase C for human retinal

Carnosine inhibits cataract formation and inactivation of Na+-K+ATPase induced by a glucocorticoid

Hydroxyapatite modified titanium promotes superior adhesion and proliferation of corneal fibroblast in comparison with pure titanium

Experimental study of TGF-β2 antisense oligodeoxynucleotide as an anti -scarring agent in glaucoma surgery

Inhibition of human pterygium fibroblasts by vitamin E succinate

Construction and identification of the eukaryotic expression vector carrying specific siRNA of LEDGF p52 gene

Cloning and expression of immunotoxin DT389-hbFGF

Alteration of intraocular pigment epithelium-derived factor and vascular endothelial growth factor in patients with diabetic retinopathy

Inhibitory effect of tetrandrine eye drops on corneal allograft rejection in rats

A study on accommodation mechanism with numeri- cal simulation

Preparation of endostatin protein andthe measurement of its biologic activity

ET-１ expression and ultrastructural changes inthe retina after exposureto infrasound in rats

Morphological investigationon acrysof natural's protective function from acute retinal light injury

Effect of d-timolol and l-timololon rat experimental choroidal neovascularization in vivo and endothelial cells in vitro

Advanced glycation endproducts enhance proliferation but nottube formation in choroidal microvascular endothelial cells

Quantitative researchon effectsof pyrrolidine dithiocarba mateonthe aqueous flare in a pvr ｍodel ｗith lfcＭ

Expression of fas／fasl andthe apoptosis in rat ischeｍia／reperfusion-induced retinal injury and effectsof bfgf

Effects of high-concentration insulinon expressionof vascular endothelial groｗth factor in cultured Ｍüller cells in vitro

Effect of heat shocｋ protein-７０on lens epithelial cells in huｍan diabetic cataract

Effects of resveratrolon Proliferationof retinal vascular endothelial cells and exPressionof VEGF

Genotyping analysis of a polymorphic G-954C of NOS2A in diabetic retinopathy with cystoid macular edema

Inhibitory effects of pioglitazone on alkaline burninduced corneal neovascularization in rats

Effects of brain-derived neurotrophic factor on the expression of caspase -2 and caspase -3 and cell apoptosis in retinal ischemia/reperfusion injury

Effect of vitamin A on the conjunctival goblet cells of rat after corneal transplantation

Effect of carnosine on steroid-induced modification of lens α-crystallin

PTEN mRNA expression in proliferative LECs of the rabbit

The effects of laminin and fibronectin on human lens epithelial cells growth characters and vimentin expression

COX-2 and its inhibitor Celecoxib in corneal neovascularization

PCNA, Bcl-2 and TERT expression in epiretinal membrane of rat traumatic proliferative vitreore- tinopathy

Expression of subretinal fluid hepatocyte growth factor and proliferative vitreoretinopathy

Sequential changes of HIF-1α protein and mRNA in hypoxic bovine retinal microvessel endothelial cell

Neuroprotective effect of Erigeron Breviscapus (vant) Hand -Mazz on NMDA -induced retinal neuron injury in rats

Inhibition of proliferation of retinal microvascular endothelial cells by pericytes through down-regulating KDR/Flk-1 in a co-culture system

The inhibitory effect of triamcinolone acetonide on the proliferation of monkey choroid-retinal endothelial cells in hypoxia condition

A new method of duplication of the chronic intraocular hypertension model: underwater electrocoagulation

Inhibitory effect of Meloxicam on the cultured fibroblasts from the excised pterygium

Anti cataract potential of phyllanthus niruri in galactose induced cataractogenesis of rat

Gel and porous polyethylene implants for anophthalmic cavity reconstruction-evaluation using the B scan ultrasound

Inhibitory effect of captopril on retinal neovascularization in mice

Effect of fetal bovine serum on the proliferation and differentiation of murine corneal epithelial cells in vitro

Quantitative detection of the expression level of transforming growth factor -βand its receptors in pterygium with RT- PCR

N -acetylcysteine and Taurine inhibit hyperoxia - induced cataract in rabbit lens

Implantation of modified poly 2 -hydroxyethy methacrylate -Polymethyl methacrylate Keratopro - stheses in rabbit and monkey corneas

Quantitative detection of the expression level of transforming growth factor -β1 and -β2 in rat retina with real time PCR

Effects of naringenin on ocular blood flow and choroidal neovascularization in experimental animals

Effects of hydralazine on ocular blood flow and laser-induced choroidal neovascularization

Preliminary findings of immunological characteristics in primary human corneal endothelial cells

Optimization of culture medium for primary retinal pigment epithelium cells and investigation of medium effects on growth factor expression

Injection of tissue plasminogen activator into the optic nerve in an animal model of retinal vein occlusion

Electrophysiological evaluation of the safety of injection of tissue plasminogen activator into optic nerve in rabbits

Neovascularization profile in rat allogenic penetrating keratoplasty

Comparison of IOL master and ultrasound biomi - croscopy in anterior chamber depth measurement

Effects of topical application of 5 -FU on the corneoscleral limbus of rabbits

Application of surface -enhanced laser desorption/ ionization time -of -flight -based serum proteomic array technique for the early diagnosis of retinoblas- toma

Expression of transforming growth factor-β type I receptor and transforming growth factor-β type II receptor in rat retina

Experimental study on cervical lymph nodes removal enhance allograft survival in alkali-burned cornea

Role of aquaporins -1 in corneal endothelial fluid transport

Mechanism of angiostatin induced reduction of vascular leakage in retina and iris of rats with retinopathy of prematurity

Expression of junctional adhesion molecule -1 in human corneal epithelium

Concomitant expression and combined localization of Ets-1 and VEGF in experimental diabetic rat's retina

HIF-1α expression and retinal cell apoptosis in rat retina ischemia-reperfusion injury

Increased expression of Ets-1 in the diabetic retina of streptozotocin-induced rat model

Expression of FLK-1 in laser-induced choroidal neovascularization in mouse

Effect of amniotic membrane transplantation on rabbit conjunctival surface reconstruction at the recovering stage of alkali burn

Expression of caspase-9 affected by AG on retina of rats with chronic IOP elevation

Effect of the dipeptide Arg-Gln on retinopathy of prematurity in mice

Effect of Tetrandrine on proliferation of human pterygium fibroblasts

Promotion of proliferation and migration of Müller cells by RPE cells in a co-culture system

Effects of platelet-derived growth factor α receptor in experimental rabbit PVR

Effects of hydralazine on NaIO3 -induced rat retinal pigment epithelium degeneration

Antioxidant activity of naringenin on various oxidants induced damages in ARPE-19 cells and HUVEC

The role of MMP-9 and TIMP-3 in induction of choroidal neovascularization in a murine model

Support of acellular porcine corneal stroma for growth of corneal epithelium and stromal cell in vitro

Angiogenesis induced by micropocket assay on rat cornea

Inhibition of β1 -integrin on apoptosis of rabbit corneal epithelial cells

Comparative study of four culture methods to engineer murine corneal epithelial sheet

Influence on cultured human keratocytes by liposome

Carnosine inhibits cataract formation and inactivation of Na⁺-K⁺ATPase induced by a glucocorticoid