• Volume 14,Issue 4,2021 Table of Contents
    Select All
    Display Type: |
    • >Basic Research
    • Nicotinamide suppresses bevacizumab-induced epithelial-mesenchymal transition of ARPE-19 cells by attenuating oxidative stress

      2021, 14(4):481-488. DOI: 10.18240/ijo.2021.04.01

      Abstract (1203) HTML (0) PDF 1.77 M (1194) Comment (0) Favorites

      Abstract:AIM: To investigate the effects of nicotinamide (NAM) on bevacizumab (BEV)-induced epithelial-mesenchymal transition (EMT) of human retinal pigment epithelial cells (ARPE-19) and the underling mechanisms. METHODS: ARPE-19 cells were treated with BEV for 24, 48, and 72h, and the variation degrees of EMT-related markers (fibronectin, α-SMA, vimentin, and ZO-1) were assessed by Western blotting to select the optimal treatment time point which exhibited the most obvious changes of EMT-related markers for the subsequent experiments. Furthermore, NAM was added to the medium, the mRNA and protein levels of the EMT-related markers were then measured. The accumulation of reactive oxygen species (ROS) and H2O2 and the total antioxidant capacity (TAC) of the cells were also measured to evaluate the level of oxidative stress. RESULTS: After being treated with BEV for 72h, the protein expression levels of EMT-related markers in ARPE-19 cells showed significant changes. Meanwhile the levels of ROS and H2O2 were obviously increased, and the TAC of ARPE-19 cells was decreased. Totally 72h was chosen to be the optimal treatment time point in subsequent experiments. Furthermore, NAM inhibited BEV-induced EMT by downregulating fibronectin, α-SMA, and vimentin and upregulating ZO-1, decreased the accumulation of ROS and H2O2, and enhanced TAC in BEV-treated ARPE-19 cells. CONCLUSION: This study demonstrates that NAM suppressed BEV-induced EMT in ARPE-19 cells by attenuating oxidative stress. Hence, NAM may be a potential therapeutic agent for alleviating neovascular fibrosis of the ocular fundus after anti-vascular endothelial growth factor therapy.

    • YM155 inhibits retinal pigment epithelium cell survival through EGFR/MAPK signaling pathway

      2021, 14(4):489-496. DOI: 10.18240/ijo.2021.04.02

      Abstract (1376) HTML (0) PDF 2.58 M (1139) Comment (0) Favorites

      Abstract:AIM: To investigate YM155's effect on retinal pigment epithelium (RPE) cells' viability and the potential regulatory mechanisms. METHODS: Human immortalized RPE cell lines (ARPE-19 cell line) were processed with YM155 and epidermal growth factor (EGF). ARPE-19 cell viability was detected by methyl thiazolyl tetrazolium assay, and apoptosis was tested by flow cytometry assay. ARPE-19 cell proliferation was assessed with bromodeoxyuridine tagged incorporation assay, and migration ability was evaluated via a wound-healing assay. Epidermal growth factor receptor (EGFR)/MAPK pathway proteins were tested via immunoblotting. EGFR localization was examined by immunofluorescence assay. RESULTS: YM155 suppressed ARPE-19 cells' viability in a time and concentration-dependent manner. A high dose of YM155 caused a small amount of ARPE-19 cell death. YM155 significantly diminished the ARPE-19 cells' proliferative and migrative capacity. YM155 down-regulated total EGFR and phosphorylated external signal-regulated protein kinase (ERK), and it up-regulated the phosphorylation of P38MAPK and c-Jun N-terminal kinase (JNK). YM155 induced endocytosis of EGFR in ARPE-19 cell. YM155 also attenuated EGF-induced ARPE-19 cells' proliferative and migrative capacity. Moreover, YM155 significantly decreased the expression of phosphorylated EGFR and ERK after treated by EGF. CONCLUSION: YM155 inhibits RPE cell survival, the cell proliferative and migrative capacity, and it effectuates a small amount of cell death through the EGFR/MAPK signaling pathway. YM155 might, therefore, be an agent to prevent and treat abnormal RPE cell survival in proliferative vitreoretinopathy.

    • Effect of Andrographis paniculata polysaccharide on human retinoblastoma Y79 cell proliferation and apoptosis

      2021, 14(4):497-503. DOI: 10.18240/ijo.2021.04.03

      Abstract (1556) HTML (0) PDF 1.09 M (1192) Comment (0) Favorites

      Abstract:AIM: To explore the effect of the Andrographis paniculata (A. paniculata) polysaccharide on the proliferation and apoptosis of human retinoblastoma (RB) Y79 cells and its mechanism. METHODS: The refined A. paniculata polysaccharide was obtained using techniques such as water extraction, ethanol precipitation, and decompression concentration. The inhibition effect of the A. paniculata polysaccharide on the proliferation of Y79 cells was detected by cell proliferation assay. Flow cytometry was used for the detection of cell apoptosis rate and cycle change. Real-time qunatitative polymerase chain reaction (RT qPCR)and Western blotting were used to detect the expression of cell apoptosis signal pathway-related factors (caspase-3, caspase-8, and caspase-9) and cell cycle signal pathway-related factors (CDK1 and cyclinB1) at the transcriptional and translational levels. RESULTS: Infrared and ultraviolet spectrum scanning showed that the extracted drug was a polysaccharide with high purity. After being treated with different concentrations of A. paniculata polysaccharide for different periods of time, the Y79 cells showed different degrees of proliferation inhibition. Flow cytometric observations showed that the cell apoptosis rate and the proportion of cells blocked in the G2/M phase were significantly increased after A. paniculata polysaccharide treatment. Further analysis revealed that the mRNA and protein expression of caspase-3, caspase-8, and caspase-9 in the A. paniculata polysaccharide treatment groups increased significantly compared with that in the control groups, while the expression of CDK1 and cyclinB1 decreased significantly. CONCLUSION: The A. paniculata polysaccharide could inhibit the proliferation and induce apoptosis of Y79 cells. Its possible mechanism is via the upregulation of caspase-3, caspase-8, and caspase-9 expression in the cell apoptotic signaling pathway and the downregulation of CDK1 and cyclinB1 expression in the cell cycle signaling pathway.

    • Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome

      2021, 14(4):504-509. DOI: 10.18240/ijo.2021.04.04

      Abstract (1039) HTML (0) PDF 994.23 K (971) Comment (0) Favorites

      Abstract:AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

    • >Clinical Research
    • Trabeculectomy with Ologen implant versus perfluoropropane gas bubble for open angle glaucoma in pseudophakic eyes

      2021, 14(4):510-516. DOI: 10.18240/ijo.2021.04.05

      Abstract (979) HTML (0) PDF 501.78 K (992) Comment (0) Favorites

      Abstract:AIM: To evaluate the safety and efficacy of augmented trabeculotomy with Ologen versus perfluoropropane in management of pseudophakic glaucoma. METHODS: This is a comparative randomized study included 57 pseudophakic eyes of 57 patients with medically uncontrolled open angle glaucoma (OAG). Twenty-nine patients were allocated in group I (trabeculectomy with Ologen; trab-ologen group), while 28 patients were assigned in group II (trabeculectomy with perfluoropropane gas bubble; trab-C3F8 gas bubble group). RESULTS: The intraocular pressure (IOP) was significantly reduced in both study groups at all postoperative follow up intervals (1wk, 3, 6, 12, 18, 24, 30 and 36mo, P<0.001). The differences between the mean IOP values of both groups remained statistically insignificance during the early 12 months of follow up. However, the trab-ologen group achieved a statistically significant reduction over the trab-C3F8 gas bubble group during the last 24 months of follow up. CONCLUSION: Augmentation of trabeculectomy with either Ologen implant or perfluoropropane gas bubble are associated with strict long term IOP control and evident safety in medically-uncontrolled pseudophakic eyes with OAG.

    • Clinical characteristics of progressive nonarteritic anterior ischemic optic neuropathy

      2021, 14(4):517-522. DOI: 10.18240/ijo.2021.04.06

      Abstract (1002) HTML (0) PDF 383.80 K (948) Comment (0) Favorites

      Abstract:AIM: To study whether patients with progressive nonarteritic anterior ischemic optic neuropathy (NAION) present earlier than patients with stable NAION and to describe their clinical characteristics and visual outcome. METHODS: This was a retrospective chart review. All patients with NAION seen during the acute stage from January 2012 to December 2018 were reviewed. Patients were included if they had documented disc edema and follow up of at least 3mo. Patients with progressive NAION were identified if they worsened in 2 out of 3 parameters: visual acuity ≥3 Snellen lines; Color vision ≥4 Ishihara plates; the visual field defect involved a new quadrant. The clinical characteristics, time from symptom onset to presentation, systemic risk factors and visual outcome were compared to patients with stable NAION. RESULTS: Totally 122 NAION cases met the inclusion criteria. Mean age was 58.1y (range 22-74), 70% were men. Twenty cases (16.4%) had progressive NAION. Patients with progressive NAION did not differ from stable NAION in their demographics, systemic risk factors or in their initial visual deficit. At last follow up, median visual acuity was 1.0 logMAR (IQR 0.64-1.55) in patients with progressive NAION, vs 0.18 (IQR 0.1-0.63) in stable NAION (P<0.001). Median color vision testing was 0 plates correct (IQR 0-2.5%) vs 92% plates correct (IQR 50%-100%) in the stable NAION group (P<0.001). Patients with progressive NAION differed in the time from symptom onset to presentation (median 2d vs 5d, P=0.011). CONCLUSION: We find no identifiable risk factors associated with progressive NAION. Progressors arrive earlier for ophthalmological evaluation.

    • Comparison of correcting myopia and astigmatism with SMILE or FS-LASIK and postoperative higher-order aberrations

      2021, 14(4):523-528. DOI: 10.18240/ijo.2021.04.07

      Abstract (1921) HTML (0) PDF 727.56 K (1094) Comment (0) Favorites

      Abstract:AIM: To compare the effect of myopia and astigmatism correction and postoperative change in higher-order aberration as results of receiving small-incision lenticule extraction (SMILE) and femtosecond laser-assisted in situ keratomileusis (FS-LASIK). METHODS: A prospective and non-randomized controlled study was conducted. The subjects are divided into two groups according to different operations received: 229 eyes of 116 patients in the SMILE group and 168 eyes of 86 patients in the FS-LASIK group. All subjects were followed up for 3mo by monitoring their uncorrected visual acuity (UCVA), best-corrected visual acuity (BCVA), spherical equivalent, higher-order aberrations, and the preoperative and postoperative complications. RESULTS: At 1wk, 1, and 3mo post-surgery, 224 eyes (97.8%), 227 eyes (99.1%) and 229 eyes (100%) had UCVA≥20/20 in the SMILE group, while 165 eyes (98.2%), 167 eyes (99.4%) and 167 eyes (99.4%) had UCVA≥20/20 in the FS-LASIK group, respectively (χ2=0.146, 2.135, and 1.124; all P>0.05). BCVA reduction was not observed in both groups at 1 and 3mo of post-surgery (χ2=0.734 and 1.898, P>0.05). There was no statistically significant difference in the spherical equivalent between the two groups at 1 and 3mo post-surgery, though the percentage of the spherical equivalent within ±0.50 D at 3mo post-surgery was 98% in the SMILE group, which was higher than that of the FS-LASIK group (92%, χ2=1.872, P>0.05). The root mean square (RMS) values of total high-order aberration, coma, and spherical aberration of the two groups increased significantly in the early postoperative period and decreased after 3mo, but the values were still higher than the preoperative levels (P<0.05); there was no significant difference between the two groups in the RMS values of total higher-order aberrations and specific higher-order aberrations (P>0.05). The incidence of complications in the SMILE group was lower than that in the FS-LASIK group (χ2=14.52, P<0.05). CONCLUSION: SMILE and FS-LASIK can effectively treat myopia, significantly improve visual acuity, and increase the total high-order aberration, spherical aberration, and coma. The incidence of complications after SMILE is relatively low.

    • Clinical performance of presbyopia correction with a multifocal corneoscleral lens

      2021, 14(4):529-535. DOI: 10.18240/ijo.2021.04.08

      Abstract (1062) HTML (0) PDF 389.46 K (979) Comment (0) Favorites

      Abstract:AIM: To assess the clinical performance of a multifocal corneoscleral lens for the presbyopia correction. METHODS: A prospective clinical trial of the Onefit? A multifocal corneoscleral lens was conducted with 40 participants with presbyopia. At 4wk of continuous wear of the corneoscleral lens, changes in the distance, intermediate, and near visual acuity (VA) were evaluated. The safety of the corneoscleral lens, central corneal thickness (CCT), corneal endothelial cell count, binocular stereopsis, tear film break-up time (BUT), corneal staining, corneal edema, corneal neovascularization (NV), and conjunctival hyperemia were examined. In addition, a subjective questionnaire addressing satisfaction (rated from 1 to 5 points) and discomfort (rated from 1 to 5 points) was administered. RESULTS: Forty participants were enrolled in this study. Six participants were excluded because of poor compliance with lens fitting (n=2) and loss to follow-up (n=4). The mean age of the participants was 53.0±4.9y. At 4wk of continuous wear of the corneoscleral lens, the best corrected far, intermediate, and near VA was 0.08±0.11, 0.10±0.12, and 0.10±0.12 logMAR, respectively. These results were significant improvements over the baseline uncorrected VA (far: P=0.004; intermediate: P=0.004; near: P=0.002). CCT, corneal endothelial cell count, binocular stereopsis, BUT, corneal staining, corneal edema, corneal NV, and conjunctival hyperemia were not significantly different between baseline and after corneoscleral lens use. The average satisfaction scores for fit sensation; corrected far, intermediate, and near VA; and ease of handling were 4.1, 3.4, 3.6, 3.5, and 3.4, respectively. The average discomfort scores for dryness, irritation, foreign body sensation, redness, fogging, and halo were 1.7, 1.8, 1.5, 1.7, 1.7, and 1.3, respectively. CONCLUSION: Far, intermediate, and near VA are improved in presbyopic patients with the multifocal corneoscleral lens compared to uncorrected baseline VA, without adverse ocular effects. This evidence supports the safety and effectiveness of presbyopia correction with multifocal corneoscleral lenses.

    • A comparison of visual acuity measured by ETDRS chart and Standard Logarithmic Visual Acuity chart among outpatients

      2021, 14(4):536-540. DOI: 10.18240/ijo.2021.04.09

      Abstract (1483) HTML (0) PDF 626.35 K (1196) Comment (0) Favorites

      Abstract:AIM: To compare the results of visual acuity (VA) measured by Early Treatment Diabetic Retinopathy Study (ETDRS) chart, 5 m Standard Logarithm Visual Acuity (5SL) chart, and 2.5 m Standard Logarithm Visual Acuity (2.5SL) chart in outpatients of age 12-80y. METHODS: Each patient (totally 2000 outpatients) had both eyes tested with ETDRS chart at 4 m, 5SL chart at 5 m, and 2.5SL chart at 2.5 m in random order. The VA values of outpatients were categorized by ages. VA values were expressed by logMAR recording method. RESULTS: The mean VA results of ETDRS charts, 5SL, and 2.5SL chart were 0.52±0.28, 0.50±0.30, and 0.46±0.28 logMAR, respectively. There was a statistically significant difference in the three eye charts in the whole group (P<0.001). For all subjects, the correlation of VA tested with three charts was statistically significant (Spearman correlation coefficient=0.944, 0.937, 0.946, all P<0.001). Bland–Altman analysis shows the 95% limits of agreement between the 5SL and 2.5SL chart were -0.182 to 0.210, -0.139 to 0.251, and -0.151 to 0.235 logMAR, respectively). CONCLUSION: The agreement between the three eye charts is not high. The VA measured by 5SL chart is slightly better than that by ETDRS chart and 5SL chart would be a suitable alternative when ETDRS chart are not available in the clinical situation. The VA measured by 2.5SL chart is about 0.5 line better than VA tested with ETDRS chart, which may overestimate VA.

    • Spasm of the near reflex: a common diagnostic dilemma?

      2021, 14(4):541-546. DOI: 10.18240/ijo.2021.04.10

      Abstract (1291) HTML (0) PDF 768.02 K (1089) Comment (0) Favorites

      Abstract:AIM: To report the clinical characteristics and diagnostic procedures used in patients with spasm of the near reflex (SNR), in order to present common investigation strategies and diagnostic pitfalls. METHODS: Retrospective case series of twenty-two patients, mainly children, with SNR or accommodation spasm (AS). AS was diagnosed on the basis of blurred vision and a difference of >2 dioptres between manifest and cycloplegic retinoscopy. If esotropia and miosis were present, the patients were diagnosed with SNR. All patients underwent visual acuity testing, orthoptic evaluation, assessment of refraction before and after cycloplegia, and dilated fundoscopy. Additional diagnostic investigations, such as neuroimaging, lumbar puncture (LP), electrophysiology and blood tests, were also recorded. Screen use among children was assessed in hours per day. RESULTS: There were 19 female and 3 male patients (age range 7-33y, median=10y). Seventeen patients had AS and 5 patients had SNR, with episodic blurry vision and headaches being the most common symptoms. Brain neuroimaging was performed in six patients (27%), although only one had a history of brain trauma. Two of those patients underwent visual evoked potentials and three also underwent LP and received intravenous steroid therapy. The majority of patients (90%) reported prolonged daily screen time (>2h/d), and in 55% of cases there were concurrent social problems or psychological triggers. Treatment consisted of careful explanation of the condition, atropine 1% eye drops and full cycloplegic correction by means of bifocal glasses. CONCLUSION: The diagnosis of SNR and AS may be challenging, because symptoms are usually intermittent and nonspecific, and a large number of patients are often subjected to redundant and potentially time-consuming examinations and treatment, that may exaggerate the underlying psychological disorder. Hence, detailed clinical testing and assessment of psychosocial profile is necessary, in order to avoid unnecessary investigations. Neuroimaging should be performed only in selected cases. Finally, due to prolonged screen use SNR and AS may become more frequent in the future.

    • Similar therapeutic effects of 125I seed radiotherapy and γ-ray radiotherapy on lacrimal gland adenoid cystic carcinoma

      2021, 14(4):547-553. DOI: 10.18240/ijo.2021.04.11

      Abstract (1201) HTML (0) PDF 675.86 K (909) Comment (0) Favorites

      Abstract:AIM: To evaluate the survival outcomes of patients with lacrimal gland adenoid cystic carcinoma who underwent eye-sparing surgery combined with 125I seed implantation radiotherapy or local external γ-ray radiotherapy. METHODS: In this retrospective comparative case series, the clinical records of 27 primary and 8 recurrent patients were reviewed. Univariate and multivariate analyses were used to identify risk factors associated with distant metastasis (DM), and the overall survival (OS) after the initial surgery was analyzed. RESULTS: The median follow-up after radiotherapy was 36mo (range 6-120mo). At the last follow-up after radiotherapy, 26 (74.3%) patients had no evidence of disease, 7 (20%) patients had DM, 2 (5.9%) patients died of DM, and 1 patient with DM was lost to follow-up. Univariate analyses showed that duration of symptoms, bone destruction, T stage classification, and wide excision surgery were risk factors influencing DM (P<0.05). The 5-year and 10-year OS rates after the initial surgery were 95.8% and 79.9%, respectively. The 5-year DM-free survival and disease-free survival rates after radiotherapy were 66.4% and 52.7%, respectively. CONCLUSION: 125I seed radiotherapy and local external γ-ray radiotherapy may have similar therapeutic effects in preventing DM. Patients with T1/T2 stage disease have a better prognosis than those with T3/T4 stage disease.

    • >Investigation
    • Distribution of IOP and its relationship with refractive error and other factors: the Anyang University Students Eye Study

      2021, 14(4):554-559. DOI: 10.18240/ijo.2021.04.12

      Abstract (972) HTML (0) PDF 627.04 K (1054) Comment (0) Favorites

      Abstract:AIM: To investigate the distribution of intraocular pressure (IOP) and its relationship with refractive error and other factors in university students from Anyang, China. METHODS: A university-based study was conducted. Subjects were invited to complete ophthalmic examinations, including visual acuity, noncontact tonometry (NCT), cycloplegic autorefraction, and ocular biometry. Univariable and multivariable analyses were used to evaluate the associations between IOP and other factors. Only data from right eyes were used in analysis. RESULTS: A total of 7720 subjects aged 16 to 26 years old were included, and 2834 (36.4%) of the participants were male. The mean IOP of the right eye for all subjects was 15.52±3.20 mm Hg (95%CI: 15.45, 15.59). Using multivariate linear regression analysis, IOP was found to correlate significantly with younger age (P<0.001; standardized regression coefficient β, -0.061; regression coefficient β, -0.139; 95%CI: -0.18, -0.09), higher myopic refractive error (P=0.044; standardized β, -0.060; regression coefficient β, -0.770; 95%CI: -0.15, -0.002), higher central corneal thickness (P<0.001; standardized β, 0.450; regression coefficient β, 0.044; 95%CI: 0.04, 0.05), and shorter axial length (AL; P<0.001; standardized β, -0.061; regression coefficient β, -0.163; 95%CI: -0.25, -0.07). CONCLUSION: This study described the normal distribution of IOP. In Chinese university students aged 16-26y, higher IOP is associated with younger age, higher myopic refractive error, higher thickness of the central cornea, and shorter AL.

    • Cost-effectiveness analysis of tele-retinopathy of prematurity screening in Iran

      2021, 14(4):560-566. DOI: 10.18240/ijo.2021.04.13

      Abstract (842) HTML (0) PDF 360.63 K (992) Comment (0) Favorites

      Abstract:AIM: To conduct a cost-utility analysis of the tele- retinopathy of prematurity (ROP) screening program against no screening. METHODS: A decision tree model was developed to identify and treat the infants with threshold ROP through the tele-screening system compared with no screening program from the societal perspective. We used the quality adjusted life years (QALY) index to measure the scenarios' effectiveness, which was discounted for the future years by 0.058. One hundred twenty-six randomly selected newborns with ROP required treatment were investigated to extract the treatment information. We considered the direct medical and non-medical costs in cost calculations analysed by the bottom-up approach. The figures of the model's inputs were calculated using the Monte Carlo simulation that generated 1000 random iteration of the data, and a one-way sensitivity analysis was performed on the model to cope with the potential uncertainties. RESULTS: The total and per capita needed the budget to establish a tele-ROP screening system were estimated at over 1.5 million and 35.13 USD, respectively. The total cost of identifying and treating an ROP case in tele-screening and no screening strategies were obtained as 108.72 and 63.52 USD, respectively, and their lifetime discounted QALY gained were calculated as 15.39 and 15.11, respectively. Therefore, incremental cost-effectiveness ratio (ICER) of tele-screening strategy against the competitive strategy was achieved as 161.43 USD. CONCLUSION: Tele-ROP screening program is one of the most cost-effective interventions in the Iranian health system and has a high priority to receive a budget for implementation.

    • Prevalence and risk factors of dry eye disease in young and middle-aged office employee: a Xi’an Study

      2021, 14(4):567-573. DOI: 10.18240/ijo.2021.04.14

      Abstract (1577) HTML (0) PDF 422.61 K (1112) Comment (0) Favorites

      Abstract:AIM: To estimate the prevalence of and risk factors for dry eye disease (DED) in young and middle-aged office employee in Xi'an. METHODS: This cross-sectional study of the prevalence of and risk factors for DED investigated 486 young and middle-aged Chinese office employee in Xi'an. DED symptoms and potential risk factors were assessed using the ocular surface disease index combined with a risk factors questionnaire, and tear function was evaluated using the tear film break-up time and Schirmer's test. Possible risk factors for DED were estimated by binary Logistic regression analysis. RESULTS: DED was diagnosed in 100 females and 96 males, giving a prevalence of 40.3% [95% confidence interval (CI)=36.0%-44.7%]. The multivariate binary Logistic regression model indicated that the possible risk factors for DED were being female (OR=1.592, 95%CI=1.034-2.451, P=0.035), being aged ≥40y (OR=1.593, 95%CI=1.034-2.454, P=0.035), using a VDT daily for >6h (OR=1.990, 95%CI=1.334-2.971, P=0.001), the presence of central air conditioning (OR=1.548, 95%CI=1.053-2.276, P=0.026), and self-reported dryness of the mouth and nose (OR=1.589, 95%CI=1.071-2.357, P=0.021). CONCLUSION: There is a high prevalence of clinically diagnosed DED in young and middle-aged video display terminal (VDT) users. Interventions against the modifiable risk factors should be taken to prevent the occurrence and development of DED in this population.

    • Clinical features and treatment outcomes of intraocular lymphoma: a single-center experience in China

      2021, 14(4):574-581. DOI: 10.18240/ijo.2021.04.15

      Abstract (1089) HTML (0) PDF 1.30 M (919) Comment (0) Favorites

      Abstract:AIM: To investigate the clinical manifestations, diagnostic approaches, treatments, and outcomes of intraocular lymphoma. METHODS: In this retrospective study, 16 patients (28 eyes) with intraocular lymphoma were recruited in the Department of Ophthalmology, Peking Union Medical College Hospital, from 2004 to 2019. All patients underwent comprehensive ophthalmic examinations. Vitreous specimens of 13 patients were sent for cytopathology examination and other adjunctive diagnostic procedures. Three patients were diagnosed with intraocular lymphoma according to analysis of the histopathological results of systemic lymphoma by one clinician. Twenty-three eyes were treated with intravitreal administration of methotrexate, 4 eyes could not receive ocular treatment due to life-threatening lymphoma, and 1 eye did not require ocular treatment because the fundus lesions regressed after systematic chemotherapy. RESULTS: In 28 eyes, 25 eyes were diagnosed with vitreoretinal lymphoma, and 3 eyes were diagnosed with ciliary body lymphoma, all of which were non-Hodgkin diffuse large B cell lymphomas. The final visual acuity improved in 15 eyes (54%), remained unchanged in 5 eyes (18%), and decreased in 8 eyes (29%). Anterior segment inflammation disappeared or reduced in 8 and 5 eyes, respectively; and 15 eyes had no anterior segment reaction. Twenty eyes had mild vitreous opacity, 1 eye had mild vitritis, and 7 eyes had pars plana vitrectomy combined with silicone oil tamponade. Fundus lesions disappeared in 9 eyes and were relieved in 5 eyes; 4 eyes showed no changes, and the remaining 10 eyes' fundus were normal. CONCLUSION: The clinical manifestations of intraocular lymphoma are diverse, and the misdiagnosis rate is high. Cytopathological analysis of vitreous is one of the gold standards for the diagnosis. Immunohistochemistry, gene rearrangement and flow cytometric immunophenotypic analysis can improve the diagnostic rate. Ocular chemotherapy or radiotherapy regimens may preserve visual acuity, and a multidisciplinary team can provide individualized treatment for the patients.

    • >Meta-Analysis
    • Surgery at early versus late for intermittent exotropia: a Meta-analysis and systematic review

      2021, 14(4):582-588. DOI: 10.18240/ijo.2021.04.16

      Abstract (1024) HTML (0) PDF 2.09 M (1051) Comment (0) Favorites

      Abstract:AIM: To compare the outcomes between early surgery and late surgery for intermittent exotropia (IXT) with a Meta-analysis. METHODS: Scientific databases including PubMed, Embase, Web of Science, Cochrane and China National Knowledge Infrastructure were searched prior to December 16, 2019. From this broad database search, we performed some Meta-analysis including eleven independent studies, to further evaluate the outcome(s) when comparing early versus late surgery for IXT. The boundaries between early and late surgery and the surgery methods were not inconsistent, so subgroup analyses were conducted by different boundaries of age at surgery and different surgical approaches. The pooled odds ratios (ORs) and the 95% confidence interval (CI) were estimated according to the random-effects model for high heterogeneity between studies. RESULTS: Eleven retrospective studies were included in this Meta-analysis. No significant difference between early and late surgery was observed for IXT patients (ORFirst follow-up= 0.88, 95%CI 0.53-1.44, P=0.61; ORFinal follow-up=1.48, 95%CI 0.94-2.31, P=0.09). However, sensitivity analysis performed by sequentially omitting individual studies showed that the final follow-up result was not stable. Subgroup analyses revealed that an earlier surgical procedure could lead to a better outcome in the 4-year boundary subgroup as well as the bilateral lateral rectus recession (BLR) subgroup for the final follow-up (OR4y=2.64, 95%CI 1.57-4.44, P=0.00; ORBLR=2.25, 95%CI 1.36-3.74, P=0.00). CONCLUSION: Early surgery for IXT provides a better long term follow-up outcome when patients are younger than 4 years old or choose the BLR surgical method.

    • >Bibliometric Research
    • Trends in research related to high myopia from 2010 to 2019: a bibliometric and knowledge mapping analysis

      2021, 14(4):589-599. DOI: 10.18240/ijo.2021.04.17

      Abstract (1710) HTML (0) PDF 2.77 M (1249) Comment (0) Favorites

      Abstract:AIM: To evaluate the global trends in and explore hotspots of high myopia (HM) research. METHODS: This bibliometric analysis was used to reveal the publication trends in HM research field based on the Web of Science Core Collection (WoSCC). VOSviewer version 1.6.13 software was used to analyze the data and construct a knowledge map including the yearly publication number, journals, countries, international collaborations, authors, research hotspots, and intellectual base in HM. RESULTS: The search engine found 3544 peer-reviewed publications on HM between 2010 and 2019, and the yearly research output substantially elevated over the past decade. China is the top publishing country, and Sun Yat-sen University was the most active academic institution. Jonas JB is the top publishing scientist, and Investigative Ophthalmology and Visual Science (IOVS) was the most productive journal. The highest cited references mainly focused on epidemiology and management. The keywords formed 6 clusters: 1) refractive surgery; 2) etiology and clinical characteristics; 3) the mechanism of eye growth; 4) management for myopic maculopathy; 5) vitrectomy surgical treatment; 6) myopia-associated glaucoma-like optic neuropathy. CONCLUSION: The evaluation of development trends based on the data extracted from WoSCC can provide valuable information and guidance for ophthalmologists and public health researchers to improve management procedures in HM field.

    • >Review Article
    • Commentary review on peripapillary morphological characteristics in high myopia eyes with glaucoma: diagnostic challenges and strategies

      2021, 14(4):600-605. DOI: 10.18240/ijo.2021.04.18

      Abstract (1500) HTML (0) PDF 375.08 K (1215) Comment (0) Favorites

      Abstract:The incidences of open angle glaucoma (OAG) and high myopia are increasing concomitantly. Considering the aging population and concurrent rapid increase in the number of individuals with myopia, the risk of visual defects caused by highly myopic OAG is likely to increase dramatically over the next few decades. However, precise screening and diagnosis of OAG is challenging because of the tilt and rotation of the optic disc, as well as extensive β-zone parapapillary atrophy in highly myopic eyes. Recent advances in optical coherence tomography (OCT) and OCT angiography (OCTA) technologies imply that both modalities are promising tools for the detection of highly myopic OAG. Notably, the diagnosis of OAG remains to be determined with the longitudinal changes of functional damages (e.g. visual field defect, visual electrophysiological changes). We herein describe some aspects of microvascular and microstructural pathology in patients with highly myopic OAG and proposes a framework for the development of novel diagnostic and therapeutic strategies.

    • Review on current concepts of myopia and its control strategies

      2021, 14(4):606-615. DOI: 10.18240/ijo.2021.04.19

      Abstract (2681) HTML (0) PDF 392.94 K (1794) Comment (0) Favorites

      Abstract:Myopia poses a significant burden on the healthcare system, economy and quality of life. It is an emerging global public health challenge and requires interventions to delay or stop onset and progression. With changing times and evidence, the concepts of myopia are changing along with the treatment and control strategies. Behavioural modifications including increased outdoors time and reduced near work, optical and pharmaceutical management options are reviewed. This paper presents a current overview on the concepts of myopia, and is expected to summarize updates on myopia control methods.

    • Ocular surface changes in Graves’ ophthalmopathy

      2021, 14(4):616-621. DOI: 10.18240/ijo.2021.04.20

      Abstract (1359) HTML (0) PDF 375.57 K (1192) Comment (0) Favorites

      Abstract:Many patients with Graves' ophthalmopathy (GO) suffer from dry eye syndrome (DES), and this is one of the most common reasons of eye discomfort in patients with GO. The prevalence of DES in patients with GO is significantly higher than normal subjects. The ocular surface changes involving changes in tears, cornea, conjunctiva and glands occur in GO patients. However, the mechanism of how DES occurs in GO still remains unclear. In this review, the ocular surface changes were illustrated and analyzed the reasons for high prevalence of DES in GO patients.

    • >Brief Report
    • A simple new technique for the induction of residual posterior vitreous cortex removal and membrane peeling

      2021, 14(4):622-625. DOI: 10.18240/ijo.2021.04.21

      Abstract (1122) HTML (0) PDF 1.08 M (1154) Comment (0) Favorites

      Abstract:AIM: To describe a quick, cost-effective alternative to using a scraper to remove the residual posterior vitreous cortex and create an inner limiting membrane (ILM) flap during vitrectomy. METHODS: The surgical technique and a retrospective interventional single-center series of cases were described. A hook was made on the tip of a conventional syringe needle (outer diameter, 0.6 mm; 23 gauge) by bending the needle against a plate. We used this hook to remove the residual posterior vitreous cortex and create an ILM flap during vitrectomy. The efficacy and safety of using this instrument in ophthalmological procedures for a variety of vitreoretinal disorders were evaluated. RESULTS: The hook was effective for removing focal or diffuse residual posterior vitreous cortex in eyes with rhegmatogenous retinal detachment, proliferative diabetic retinopathy, and pathological myopia. It was also successfully used to make a free edge of the ILM and help strip the epiretinal membrane. There were no serious complications associated with using the hook in delicate ophthalmological procedures. CONCLUSION: The hook, made by bending a conventional needle, is a simple and cost-effective instrument for removing residual posterior vitreous vortex and to create epiretinal and ILM flaps during vitrectomy in eyes with various vitreoretinal diseases.

    • >Letter to the Editor
    • Differential degeneration of rod/cone bipolar cells during retinal degeneration in Royal College of Surgeons rats

      2021, 14(4):626-629. DOI: 10.18240/ijo.2021.04.22

      Abstract (792) HTML (0) PDF 1.35 M (946) Comment (0) Favorites

      Abstract:

    • Bilateral choroidal detachment and exudative retinal detachment following laser peripheral iridotomy in a case of ocular Vogt-Koyanagi-Harada’s disease

      2021, 14(4):630-632. DOI: 10.18240/ijo.2021.04.23

      Abstract (1798) HTML (0) PDF 947.39 K (928) Comment (0) Favorites

      Abstract:

    • Tolosa-Hunt Syndrome with underlying latent tuberculosis: a diagnostic dilemma

      2021, 14(4):633-635. DOI: 10.18240/ijo.2021.04.24

      Abstract (680) HTML (0) PDF 682.46 K (949) Comment (0) Favorites

      Abstract:

    • A deletion mutation along with a novel DNA variation in OCRL cause Lowe syndrome in a child with multiple secondary manifestations

      2021, 14(4):636-638. DOI: 10.18240/ijo.2021.04.25

      Abstract (630) HTML (0) PDF 1.09 M (981) Comment (0) Favorites

      Abstract:

Editors-in-Chief: Yan-Nian Hui and Peter Wiedemann

Established in April, 2008

ISSN 2222-3959 print

ISSN 2227-4898 online

Press search
Search term
From To
  • Most Read
  • Most Cited
  • Article Ranking