Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome
Author:
Corresponding Author:

Xun-Lun Sheng. Department of Ophthalmology, Ningxia Eye Hospital, People's Hospital of Ningxia Hui Autonomous Region, Huanghe Road, Jinfeng District, Yinchuan 750002, the Ningxia Hui Autonomous Region, China. shengxunlun@163.com

Affiliation:

Clc Number:

Fund Project:

  • Article
  • |
  • Figures
  • |
  • Metrics
  • |
  • Reference
  • |
  • Related
  • |
  • Cited by
  • |
  • Materials
  • |
  • Comments
    Abstract:

    AIM: To characterize the genetic causes and clinical features in a four-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome (BPES). METHODS: Thirteen patients with BPES and eight healthy family members were included in this study. All participants received routine ophthalmic examinations. The target next-generation sequencing (NGS) was performed to determine the causative mutation for this family. The silico analysis was also applied to predict the pathogenesis of identified mutations. RESULTS: All patients had severe ptosis, normal intelligence, female patients have normal fertility. Genetic assessments revealed a heterozygous insertion variation in FOXL2 gene, c.672_701insGCGGCTGCCGC CGCAGCTGCTG CAGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA), carried by 13 patient but absent in all unaffected members. In silico analysis supported the pathogenic nature of this highly conserved variant. This mutation resulted in the insertion of 10 amino acids into the encoded polyala nine chain, which increased the number of original polyalanine chains from 14 to 24, resulting in an extended protein. CONCLUSION: A novel FOXL2 mutation c.672_701ins GCGGCTGCCGCCGCAGCTGCTGC AGGCGCT (p.Ala234_Gly235linsAAAAAAAAGA) was identified in a large Chinese family with BPES. This study amplified the genotypic spectrum of FOXL2-BPES and better illustrates its genotype-phenotype correlations, which provided a basis for elucidating the pathogenesis of BPES and genetic counseling.

    Reference
    Related
    Cited by
Get Citation

Wei-Ning Rong, Mei-Jiao Ma, Wei Yang, et al. Identification of a novel FOXL2 mutation in a fourth-generation Chinese family with blepharophimosis-ptosis-epicanthus inversus syndrome. Int J Ophthalmol, 2021,14(4):504-509

Copy
Article Metrics
  • Abstract:
  • PDF:
Publication History
  • Received:November 01,2020
  • Revised:January 29,2021
  • Adopted:
  • Online: February 25,2021
  • Published: